Structured Review

Addgene inc lenticrisprv2
Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with <t>lentiCRISPRv2.</t> (b) Immunoblots of CRISPR-induced KO cells.
Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 99/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2/product/Addgene inc
Average 99 stars, based on 57 article reviews
Price from $9.99 to $1999.99
lenticrisprv2 - by Bioz Stars, 2019-10
99/100 stars

Images

1) Product Images from "Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens"

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens

Journal: Nature

doi: 10.1038/nature18631

Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.
Figure Legend Snippet: Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.

Techniques Used: Knock-Out, CRISPR, Gene Knockout, Sequencing, Western Blot

2) Product Images from "Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells"

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells

Journal: Nature Communications

doi: 10.1038/ncomms14686

Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.
Figure Legend Snippet: Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.

Techniques Used: Expressing, Purification, FACS, Staining, Construct, Cell Culture, Infection, Polymerase Chain Reaction

3) Product Images from "Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9"

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9

Journal: Nature biotechnology

doi: 10.1038/nbt.3437

Comparative performance of the Avana library. ( a ) Distribution of Rule Set 1 scores across libraries. The box represents the 25 th , 50 th , and 75 th percentiles, whiskers show 5 th and 95 th percentiles. (b ) Comparison of the FDR-corrected q-values determined by STARS for the top 100 ranked genes in the vemurafenib resistance assay in A375 cells. ( c ) Validation of individual sgRNAs for vemurafenib resistance in a competition assay in A375 cells. Horizontal bars represent the average of the individual sgRNAs for each gene. Previously-validated genes are labeled in blue. ETP = early time point. ( d ) Subsampling analysis of the Avana library. We first identified genes that passed at different FDR thresholds with STARS when all six subpools were analyzed (first number in legend), the average number of retained genes that score at different FDR thresholds following removal of subpools (second number in legend). LG = lentiGuide; LC = lentiCRISPRv2. ( e ) ROC-AUC analysis of individual sgRNAs targeting core essential genes in dropout screens in A375 cells. AUC values are indicated in parentheses.
Figure Legend Snippet: Comparative performance of the Avana library. ( a ) Distribution of Rule Set 1 scores across libraries. The box represents the 25 th , 50 th , and 75 th percentiles, whiskers show 5 th and 95 th percentiles. (b ) Comparison of the FDR-corrected q-values determined by STARS for the top 100 ranked genes in the vemurafenib resistance assay in A375 cells. ( c ) Validation of individual sgRNAs for vemurafenib resistance in a competition assay in A375 cells. Horizontal bars represent the average of the individual sgRNAs for each gene. Previously-validated genes are labeled in blue. ETP = early time point. ( d ) Subsampling analysis of the Avana library. We first identified genes that passed at different FDR thresholds with STARS when all six subpools were analyzed (first number in legend), the average number of retained genes that score at different FDR thresholds following removal of subpools (second number in legend). LG = lentiGuide; LC = lentiCRISPRv2. ( e ) ROC-AUC analysis of individual sgRNAs targeting core essential genes in dropout screens in A375 cells. AUC values are indicated in parentheses.

Techniques Used: Competitive Binding Assay, Labeling, Liquid Chromatography

4) Product Images from "Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors"

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors

Journal: eLife

doi: 10.7554/eLife.15104

Hormone receptors in melanocytes. ( A ) Relative gene expression of classical hormone receptors in MCF7 cells and melanocytes, as determined by qRT-PCR. Ct values were normalized to actin, and set relative to the expression of androgen receptor (AR) in MCF7 cells. ( B ) Average RPKM values for classical and nonclassical estrogen and progesterone receptor transcripts in human melanocytes, by convention, RPKM values > 1 indicate the gene is expressed. ( C ) Expression of GPER and PAQR7 displayed as 1/Ct value. ( D ) Relative expression of GPER and PAQR7 transcripts in melanocytes, fibroblasts, and keratinocytes, as determined by qRT-PCR, displayed relative to the expression level in melanocytes. ( E ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting GPER. ( F ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting PAQR7. ( G ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or GPER. Cells were treated with either vehicle or estrogen. ( H ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or PAQR7. Cells were treated with either vehicle or progesterone. Error bars denote +/- s.d., *p
Figure Legend Snippet: Hormone receptors in melanocytes. ( A ) Relative gene expression of classical hormone receptors in MCF7 cells and melanocytes, as determined by qRT-PCR. Ct values were normalized to actin, and set relative to the expression of androgen receptor (AR) in MCF7 cells. ( B ) Average RPKM values for classical and nonclassical estrogen and progesterone receptor transcripts in human melanocytes, by convention, RPKM values > 1 indicate the gene is expressed. ( C ) Expression of GPER and PAQR7 displayed as 1/Ct value. ( D ) Relative expression of GPER and PAQR7 transcripts in melanocytes, fibroblasts, and keratinocytes, as determined by qRT-PCR, displayed relative to the expression level in melanocytes. ( E ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting GPER. ( F ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting PAQR7. ( G ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or GPER. Cells were treated with either vehicle or estrogen. ( H ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or PAQR7. Cells were treated with either vehicle or progesterone. Error bars denote +/- s.d., *p

Techniques Used: Expressing, Quantitative RT-PCR, Transduction

5) Product Images from "SZT2 Dictates GATOR Control of mTORC1 Signaling"

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling

Journal:

doi: 10.1038/nature21378

The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.
Figure Legend Snippet: The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.

Techniques Used: Transfection

6) Product Images from "SZT2 Dictates GATOR Control of mTORC1 Signaling"

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling

Journal:

doi: 10.1038/nature21378

The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.
Figure Legend Snippet: The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.

Techniques Used: Transfection

Related Articles

Transduction:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: Paragraph title: Lentiviral constructs and transduction of cell lines ... For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in .

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: The gene encoding S. pyogenes Cas9 (Sp Cas9) can be introduced by transfection or viral transduction with a Cas9 expression construct or by direct delivery of Cas9 protein [ – ]. .. Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene).

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: Cells were cloned by limiting dilution into 96-well plates. .. TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. Puromycin-containing culture medium was replaced daily for 5 days until all cells in uninfected control had died.

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ].

Article Title: Targeted positron emission tomography imaging of CXCR4 expression in patients with acute myeloid leukemia
Article Snippet: Assessment of CXCR4 mRNA of AML cell lines was performed as described in the Online Supplementary Appendix. .. OCI-AML3 cells were stably transduced with lentiCRISPRv2 (Addgene plasmid #52961), coding for Cas9 and a CXCR4-specific sgRNA. .. Indel formation was assessed as described previously.

Clone Assay:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: To construct ERBB2-Puro, human ERBB2 insert was PCR amplified from HER2/PLNCX2 vector, a gift from Dr Paul Chiao , using two primers (5′-CCATAGAAGATTCTAGAGCTAGCGCTAGCGCTACCGGACT-3′ and 5′-tcgcagatccttcgcggccgcACCTACAGGTGGGGTCTTTC-3′). pCDH-CMV-MCS-EF1-Puro was linearized with Not I and Nhe I, and ligated with Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org.

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: It has been reported that CRISPR/Cas9 technology can generate homozygous biallelic mutations more frequently than expected in diploid cells or cancer cells , , perhaps because both alleles were independently repaired in an identical manner or because one allele served as a template for homology-directed repair of the other allele. .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors
Article Snippet: Guide RNAs were designed using software tools developed by the Zhang Lab and provided on the website http://www.genome-engineering.org/ ( ). .. Guide RNAs were subsequently cloned into lentiCRISPRv2 (Addgene # 52961) according to the accompanying protocol ( ). .. Guide RNA sequences are as follows: lentiCRISPR GFP 5’ GAA GTT CGA GGG CGA CAC CC 3’; lentiCRISPR GPER.1 5’ ACAGGCCGATCACGTACTGC 3’; lentiCRISPR GPER.2 5’ GAGCACCAGCAGTACGTGAT 3’; lentiCRISPR PAQR7.1 5’ CGTACATCTATGCGGGCTAC 3’; lentiCRISPR PAQR7.5 5’ CGTGCGGAAATAGAAGCGCC 3’

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: The final oligonucleotide sequence was thus: 5’-[Forward Primer]CGTCTCA CACC G[sgRNA, 20 nt] GTTT CGAGACG[Reverse Primer]. .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin.

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: Cell lines were authenticated and mycoplasma negative. .. To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. Cells survived the selection were plated in 96-well plates using limited dilution method with approximately one cell per well.

Article Title: The Shieldin complex mediates 53BP1-dependent DNA repair
Article Snippet: Our discovery of Shieldin also has implications for the management of BRCA1 -mutated malignancies, as alterations in Shieldin-coding genes may cause clinical resistance to PARP inhibitors. .. DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , . .. Sequences of the sgRNAs used in this study are included in .

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: Oligos used for gRNA cloning: LIN28B exon 2: (CAC CGC ATC GAC TGG AAT ATC CAA G, AAA CCT TGG ATA TTC CAG TCG ATG C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: Individual gRNAs were ordered as oligonucleotides (IDT-DNA), phosphorylated, hybridized, and cloned via into the EGFP gRNA plasmid for the HBE1 screen or DsRed gRNA plasmid for the HER2 screens using BsmBI sites. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments.

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: After two weeks, single cell clones were expanded and screened by immunoblotting for target protein depletion. .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2. .. To insert a FLAG tag into this site via homologous recombination, we generated a double-stranded DNA with FLAG coding sequence followed by a GG linker that was flanked on either side by 40 base pairs of sequence surrounding the SZT2 start codon.

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: sgRNAs were designed using the MIT CRISPR design software ( http://crispr.mit.edu ). .. Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA. .. Lentiviral particles were produced in 293T cells as described above.

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: Eight-week-old male C57BL/6 (CD45.2+ ) or SJL (CD45.1+ ) mice (~20 g) were purchased from Charles River and maintained under pathogen-free conditions. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. To produce lentivirus, lentiCRISPRv2-vector, lentiCRISPRv2-scramble or lentiCRISPRv2-sgRNA was co-transfected into 293T cells with packaging plasmids, pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260), as described previously .

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. To express p27-specific guide RNA, we replaced the Cas9 coding region in the LentiCRISPRv2 backbone with mCherry as a flow-sorting marker.

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: Cells were cloned by limiting dilution into 96-well plates. .. TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin.

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: CRISPR-Cas9 single guide RNAs (sgRNAs) for selected target genes were designed using the CRISPR Design Tool [ ], sgRNA Designer [ ] and E-CRISPR v4.2 [ ] online tools based on the target genome sequences obtained from Ensembl genome browser or merged Ensembl/Havana transcripts. .. Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production. .. To validate the genome editing in the targeted cells, we performed T7EI assays.

Centrifugation:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. Lentiviruses were produced by transfecting HEK 293T cells with the vector, pMD2.G and psPAX2 (a gift from Didier Trono, Addgene plasmid no. 12259 and 12260) DNAs in 5:2:3 ratio with TurboFect (Thermo Fisher Scientific, Waltham, MA).

Amplification:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: To construct ERBB2-Puro, human ERBB2 insert was PCR amplified from HER2/PLNCX2 vector, a gift from Dr Paul Chiao , using two primers (5′-CCATAGAAGATTCTAGAGCTAGCGCTAGCGCTACCGGACT-3′ and 5′-tcgcagatccttcgcggccgcACCTACAGGTGGGGTCTTTC-3′). pCDH-CMV-MCS-EF1-Puro was linearized with Not I and Nhe I, and ligated with Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org.

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: Additional primer sites were appended to allow differential amplification of subsets from the same synthesis pool. .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961).

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: The donor plasmid was cloned by inserting homology arms (surrounding the HBE1 stop codon), amplified by PCR from genomic DNA of K562 cells, flanking a P2A-mCherry sequence with a LoxP-puromycin resistance cassette using Gibson assembly. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments.

Stable Transfection:

Article Title: Targeted positron emission tomography imaging of CXCR4 expression in patients with acute myeloid leukemia
Article Snippet: Assessment of CXCR4 mRNA of AML cell lines was performed as described in the Online Supplementary Appendix. .. OCI-AML3 cells were stably transduced with lentiCRISPRv2 (Addgene plasmid #52961), coding for Cas9 and a CXCR4-specific sgRNA. .. Indel formation was assessed as described previously.

Synthesized:

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: Oligonucleotides were synthesized at the Broad Technology Laboratory (BTL) on a B3 Synthesizer (CustomArray). .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961).

Article Title: The Shieldin complex mediates 53BP1-dependent DNA repair
Article Snippet: DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , . .. DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , .

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: sgRNAs were designed using the MIT CRISPR design software ( http://crispr.mit.edu ). .. Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA. .. Lentiviral particles were produced in 293T cells as described above.

Article Title: A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma
Article Snippet: We designed CRISPR gRNAs to target the 87-aa ORF sequences of PINT87aa using the online software at http://crispr.mit.edu/ . .. To clone the target sequences into the lentiCRISPRv2 (AddGene 52961) backbone, we synthesized oligos containing the same overhangs after BsmBI. .. The transfer plasmid lentiCRISPRv2-gRNA (1.2 µg) was co-transfected into 293T cells with the lentiviral packaging plasmids pVSVg (AddGene 8454, 0.5 µg) and psPAX2 (AddGene 12260, 1 µg).

Construct:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: To construct ERBB2-Puro, human ERBB2 insert was PCR amplified from HER2/PLNCX2 vector, a gift from Dr Paul Chiao , using two primers (5′-CCATAGAAGATTCTAGAGCTAGCGCTAGCGCTACCGGACT-3′ and 5′-tcgcagatccttcgcggccgcACCTACAGGTGGGGTCTTTC-3′). pCDH-CMV-MCS-EF1-Puro was linearized with Not I and Nhe I, and ligated with Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. All constructs were sequence verified and the primer sequence information is shown in .

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: LIN28B exon 4: (CAC CGC CTT GTA GAT GCT ACA ACT G, AAA CCA GTT GTA GCA TCT ACA AGG C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761). .. Lentiviral particles were prepared as previously described . pLKO.1 short hairpin expression constructs (Sigma Mission shRNA): LIN28B shRNAs (sh1: TRCN0000144508, sequence: 5′-CCTGTTTAGGAAGTGAAAGAA-3′; sh2: TRCN0000122599, sequence: 5′-GCCTTGAGTCAATACGGGTAA-3′).

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: Individual gRNAs were ordered as oligonucleotides (IDT-DNA), phosphorylated, hybridized, and cloned via into the EGFP gRNA plasmid for the HBE1 screen or DsRed gRNA plasmid for the HER2 screens using BsmBI sites. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments. .. The p300 core effector domain was PCR-amplified from Addgene #61357 , with a C-terminal FLAG epitope included.

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: Paragraph title: Cells, constructs and CRISPR design ... CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses.

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: The gene encoding S. pyogenes Cas9 (Sp Cas9) can be introduced by transfection or viral transduction with a Cas9 expression construct or by direct delivery of Cas9 protein [ – ]. .. Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene).

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: All viruses were propagated and titrated on VERO cells. .. The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. In brief, lentiCRISPRv2 was digested with BsmBI and ligated with a pair of oligonucleotides with the specific guide sequence.

Modification:

Article Title: The Shieldin complex mediates 53BP1-dependent DNA repair
Article Snippet: Our discovery of Shieldin also has implications for the management of BRCA1 -mutated malignancies, as alterations in Shieldin-coding genes may cause clinical resistance to PARP inhibitors. .. DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , . .. Sequences of the sgRNAs used in this study are included in .

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: Ectopic expression of untagged MAGOH was performed either using pLX304 (with stop codon introduced prior to V5 tag) or Gateway-compatible, Hygromycin-resistant, doxycycline-inducible overexpression vector with cDNA expression driven from Tet-regulated CMV promoter, created by modification of prior similar vectors , . .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in .

Activity Assay:

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: Paragraph title: Delivery of Cas9 and sgRNAs and Cas9 activity ... Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene).

Cell Culture:

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA. .. Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA.

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. To produce lentivirus, lentiCRISPRv2-vector, lentiCRISPRv2-scramble or lentiCRISPRv2-sgRNA was co-transfected into 293T cells with packaging plasmids, pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260), as described previously .

Expressing:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: To each sgRNA sequence, BsmBI recognition sites were appended along with the appropriate overhang sequences (underlined) for cloning into sgRNA expression plasmids. .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961).

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: The lentiviral gRNA expression plasmid was cloned by combining a U6-gRNA cassette with an EGFP-P2A-Bsr or DsRed-P2A-Bsr cassette into a lentiviral expression backbone using Gibson assembly. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments.

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. To express p27-specific guide RNA, we replaced the Cas9 coding region in the LentiCRISPRv2 backbone with mCherry as a flow-sorting marker.

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: Furthermore, a germ-line Cas9 mouse has been generated, providing a source of animals and primary cells in which Cas9 expression is already established [ , ]. .. Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene). .. In hard-to-transfect cells, including many primary cell types, transduction with a viral vector provides an alternative, using, for example, lentiCRISPRv2.

Genome Wide:

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. In brief, lentiCRISPRv2 was digested with BsmBI and ligated with a pair of oligonucleotides with the specific guide sequence.

Knock-In:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: Paragraph title: Generation of Knockout and Knockin Cell Lines ... To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961).

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: After two weeks, single cell clones were expanded and screened by immunoblotting for target protein depletion. .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2. .. To insert a FLAG tag into this site via homologous recombination, we generated a double-stranded DNA with FLAG coding sequence followed by a GG linker that was flanked on either side by 40 base pairs of sequence surrounding the SZT2 start codon.

Western Blot:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Following completion of antibiotic selection, cells were seeded for downstream assays as described.

Over Expression:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: Ectopic expression of untagged MAGOH was performed either using pLX304 (with stop codon introduced prior to V5 tag) or Gateway-compatible, Hygromycin-resistant, doxycycline-inducible overexpression vector with cDNA expression driven from Tet-regulated CMV promoter, created by modification of prior similar vectors , . .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in .

Activated Clotting Time Assay:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: LIN28B exon 4: (CAC CGC CTT GTA GAT GCT ACA ACT G, AAA CCA GTT GTA GCA TCT ACA AGG C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Derivative Assay:

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: Male and female GBM (Nf−/−;DNp53 ) astrocytes were generated as previously reported [ ] and cells were grown in DMEM/F12 media supplemented with 10% FBS and 1% penicillin-streptomycin. .. CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. To express p27-specific guide RNA, we replaced the Cas9 coding region in the LentiCRISPRv2 backbone with mCherry as a flow-sorting marker.

Transfection:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. Cells were co-transfected with Left and Right TALEN containing constructs and an mCherry expressing construct using lipofectamine 2000 (Life technologies) according to manufactures guidelines.

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: Furthermore, a germ-line Cas9 mouse has been generated, providing a source of animals and primary cells in which Cas9 expression is already established [ , ]. .. Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene). .. In hard-to-transfect cells, including many primary cell types, transduction with a viral vector provides an alternative, using, for example, lentiCRISPRv2.

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. Puromycin-resistant cells were cloned by limiting dilution into 96-well plates, followed by genotyping and phenotypic analysis.

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ].

FLAG-tag:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2.

Infection:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: Puromycin selection began twenty four hours after lentiviral infection of BE(2)C and Kelly cells. .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Article Title: A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma
Article Snippet: To clone the target sequences into the lentiCRISPRv2 (AddGene 52961) backbone, we synthesized oligos containing the same overhangs after BsmBI. .. The transfer plasmid lentiCRISPRv2-gRNA (1.2 µg) was co-transfected into 293T cells with the lentiviral packaging plasmids pVSVg (AddGene 8454, 0.5 µg) and psPAX2 (AddGene 12260, 1 µg).

Generated:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2.

Article Title: The Shieldin complex mediates 53BP1-dependent DNA repair
Article Snippet: DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , . .. DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , .

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: Individual gRNAs were ordered as oligonucleotides (IDT-DNA), phosphorylated, hybridized, and cloned via into the EGFP gRNA plasmid for the HBE1 screen or DsRed gRNA plasmid for the HER2 screens using BsmBI sites. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments. .. The p300 core effector domain was PCR-amplified from Addgene #61357 , with a C-terminal FLAG epitope included.

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: Male and female GBM (Nf−/−;DNp53 ) astrocytes were generated as previously reported [ ] and cells were grown in DMEM/F12 media supplemented with 10% FBS and 1% penicillin-streptomycin. .. CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses.

Article Title: Resources for the design of CRISPR gene editing experiments
Article Snippet: Furthermore, a germ-line Cas9 mouse has been generated, providing a source of animals and primary cells in which Cas9 expression is already established [ , ]. .. Delivery of Cas9 by transfection can be quite efficient in many cell types; frequently employed expression vectors include pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPRv2 [ , , ] (available from AddGene).

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: Cells were cloned by limiting dilution into 96-well plates. .. TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. Puromycin-containing culture medium was replaced daily for 5 days until all cells in uninfected control had died.

Transplantation Assay:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: Paragraph title: Mouse strains, lentiviral production and bone marrow transplantation ... We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Sequencing:

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: The final oligonucleotide sequence was thus: 5’-[Forward Primer]CGTCTCA CACC G[sgRNA, 20 nt] GTTT CGAGACG[Reverse Primer]. .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961).

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2.

Article Title: The Shieldin complex mediates 53BP1-dependent DNA repair
Article Snippet: DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , . .. DNA corresponding to sgRNAs were cloned into pX330 (Addgene: 42230, Cambridge, MA, USA), LentiGuide-Puro (Addgene: 52963), LentiCRISPRv2 (Addgene: 52961), or a modified form in which Cas9 was replaced by NLS-tagged GFP or mCherry using Age I and Bam HI (designated as LentiGuide-NLS-GFP or –mCherry), as described , .

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: The donor plasmid was cloned by inserting homology arms (surrounding the HBE1 stop codon), amplified by PCR from genomic DNA of K562 cells, flanking a P2A-mCherry sequence with a LoxP-puromycin resistance cassette using Gibson assembly. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments.

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: Eight-week-old male C57BL/6 (CD45.2+ ) or SJL (CD45.1+ ) mice (~20 g) were purchased from Charles River and maintained under pathogen-free conditions. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. To produce lentivirus, lentiCRISPRv2-vector, lentiCRISPRv2-scramble or lentiCRISPRv2-sgRNA was co-transfected into 293T cells with packaging plasmids, pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260), as described previously .

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: Cells were cloned by limiting dilution into 96-well plates. .. TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. Puromycin-containing culture medium was replaced daily for 5 days until all cells in uninfected control had died.

Injection:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Cellular Antioxidant Activity Assay:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: LIN28B exon 3.2: (CAC CGA ATG ATT ACC TAT CTC CCT T, AAA CAA GGG AGA TAG GTA ATC ATT C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

In Vivo:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. To produce lentivirus, lentiCRISPRv2-vector, lentiCRISPRv2-scramble or lentiCRISPRv2-sgRNA was co-transfected into 293T cells with packaging plasmids, pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260), as described previously .

Gene Knockout:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: It has been reported that CRISPR/Cas9 technology can generate homozygous biallelic mutations more frequently than expected in diploid cells or cancer cells , , perhaps because both alleles were independently repaired in an identical manner or because one allele served as a template for homology-directed repair of the other allele. .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: Cell lines were authenticated and mycoplasma negative. .. To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. Cells survived the selection were plated in 96-well plates using limited dilution method with approximately one cell per well.

Article Title: Nuclear lactate dehydrogenase A senses ROS to produce α-hydroxybutyrate for HPV-induced cervical tumor growth
Article Snippet: The NLS and NES sequences were listed as follow: NLS: 5′-CCTAAGAAGAAGAGGAAGGTT-3′ NES: 5′-CTTCAGCTACCACCGCTTGAGAGACTTACTCTT-3′. .. CRISPR-Cas9-based gene knockout was performed by oligonucleotides, three sgRNAs containing the LDHA -targeting sequences, and two sgRNAs containing NRF2 -targeting sequences using lentiCRISPRv2 (Addgene) system. .. The targeting sequences were as follow: LDHA sgRNA-1: 5′-CATTAAGATACTGATGGCAC-3′ LDHA sgRNA-2: 5′-CCGATTCCGTTACCTAATGG-3′ LDHA sgRNA-3: 5′-CCCGATTCCGTTACCTAATG-3′ NRF2 sgRNA-1: 5′-CCCGTCCCGGCACCACCGCA-3′ NRF2 sgRNA-2: 5′-TGGGACGGGAGTCCCGGCGG-3′.

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: All viruses were propagated and titrated on VERO cells. .. The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. In brief, lentiCRISPRv2 was digested with BsmBI and ligated with a pair of oligonucleotides with the specific guide sequence.

Mutagenesis:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: It should be noted that in aneuploid Huh7.5.1 cells, we sometimes observed cellular subclones where all mutant alleles contained the same mutation (e.g. CD81 and ELAVL1). .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin.

Isolation:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. Transfected cells were single cell sorted based on mCherry expression into 96well plates using BD influx cell sorter.

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Functional Assay:

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. All sgRNAs were designed using the publicly available CRISPR design tool ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ).

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: Paragraph title: CRISPR-Cas9 engineering of targeted cells and functional screen ... Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production.

Mouse Assay:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: Eight-week-old male C57BL/6 (CD45.2+ ) or SJL (CD45.1+ ) mice (~20 g) were purchased from Charles River and maintained under pathogen-free conditions. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Polymerase Chain Reaction:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: To construct ERBB2-Puro, human ERBB2 insert was PCR amplified from HER2/PLNCX2 vector, a gift from Dr Paul Chiao , using two primers (5′-CCATAGAAGATTCTAGAGCTAGCGCTAGCGCTACCGGACT-3′ and 5′-tcgcagatccttcgcggccgcACCTACAGGTGGGGTCTTTC-3′). pCDH-CMV-MCS-EF1-Puro was linearized with Not I and Nhe I, and ligated with Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org.

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin.

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: The final oligonucleotide sequence was thus: 5’-[Forward Primer]CGTCTCA CACC G[sgRNA, 20 nt] GTTT CGAGACG[Reverse Primer]. .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin.

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: Individual gRNAs were ordered as oligonucleotides (IDT-DNA), phosphorylated, hybridized, and cloned via into the EGFP gRNA plasmid for the HBE1 screen or DsRed gRNA plasmid for the HER2 screens using BsmBI sites. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments. .. The p300 core effector domain was PCR-amplified from Addgene #61357 , with a C-terminal FLAG epitope included.

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: Paragraph title: CRISPR/Cas9 sgRNA design, lentivirus production and PCR-based assay to detect genomic deletions ... Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA.

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production. .. Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production.

Selection:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: Puromycin selection began twenty four hours after lentiviral infection of BE(2)C and Kelly cells. .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Quantitative RT-PCR:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Following completion of antibiotic selection, cells were seeded for downstream assays as described.

CRISPR:

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: It has been reported that CRISPR/Cas9 technology can generate homozygous biallelic mutations more frequently than expected in diploid cells or cancer cells , , perhaps because both alleles were independently repaired in an identical manner or because one allele served as a template for homology-directed repair of the other allele. .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin.

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: Paragraph title: CRISPR/Cas9 ... Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: Paragraph title: CRISPR/Cas9 sgRNA design, lentivirus production and PCR-based assay to detect genomic deletions ... Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA.

Article Title: Nuclear lactate dehydrogenase A senses ROS to produce α-hydroxybutyrate for HPV-induced cervical tumor growth
Article Snippet: The NLS and NES sequences were listed as follow: NLS: 5′-CCTAAGAAGAAGAGGAAGGTT-3′ NES: 5′-CTTCAGCTACCACCGCTTGAGAGACTTACTCTT-3′. .. CRISPR-Cas9-based gene knockout was performed by oligonucleotides, three sgRNAs containing the LDHA -targeting sequences, and two sgRNAs containing NRF2 -targeting sequences using lentiCRISPRv2 (Addgene) system. .. The targeting sequences were as follow: LDHA sgRNA-1: 5′-CATTAAGATACTGATGGCAC-3′ LDHA sgRNA-2: 5′-CCGATTCCGTTACCTAATGG-3′ LDHA sgRNA-3: 5′-CCCGATTCCGTTACCTAATG-3′ NRF2 sgRNA-1: 5′-CCCGTCCCGGCACCACCGCA-3′ NRF2 sgRNA-2: 5′-TGGGACGGGAGTCCCGGCGG-3′.

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: Male and female GBM (Nf−/−;DNp53 ) astrocytes were generated as previously reported [ ] and cells were grown in DMEM/F12 media supplemented with 10% FBS and 1% penicillin-streptomycin. .. CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. To express p27-specific guide RNA, we replaced the Cas9 coding region in the LentiCRISPRv2 backbone with mCherry as a flow-sorting marker.

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: Paragraph title: CRISPR-Cas9 engineering of targeted cells and functional screen ... Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production.

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: Paragraph title: Generation of cells with gene knockouts with CRISPR-Cas9 technology ... The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ].

Article Title: Targeted positron emission tomography imaging of CXCR4 expression in patients with acute myeloid leukemia
Article Snippet: Paragraph title: CRISPR-Cas9 mediated knock-out of CXCR4 ... OCI-AML3 cells were stably transduced with lentiCRISPRv2 (Addgene plasmid #52961), coding for Cas9 and a CXCR4-specific sgRNA.

Article Title: A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma
Article Snippet: Paragraph title: Target DNA deletion using CRISPR/Cas9 technology ... To clone the target sequences into the lentiCRISPRv2 (AddGene 52961) backbone, we synthesized oligos containing the same overhangs after BsmBI.

Chloramphenicol Acetyltransferase Assay:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: LIN28B exon 3.1: (CAC CGC AGA GCA AAC TAT TCA TGG A, AAA CTC CAT GAA TAG TTT GCT CTG C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

Plasmid Preparation:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: To construct ERBB2-Puro, human ERBB2 insert was PCR amplified from HER2/PLNCX2 vector, a gift from Dr Paul Chiao , using two primers (5′-CCATAGAAGATTCTAGAGCTAGCGCTAGCGCTACCGGACT-3′ and 5′-tcgcagatccttcgcggccgcACCTACAGGTGGGGTCTTTC-3′). pCDH-CMV-MCS-EF1-Puro was linearized with Not I and Nhe I, and ligated with Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. All constructs were sequence verified and the primer sequence information is shown in .

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: It has been reported that CRISPR/Cas9 technology can generate homozygous biallelic mutations more frequently than expected in diploid cells or cancer cells , , perhaps because both alleles were independently repaired in an identical manner or because one allele served as a template for homology-directed repair of the other allele. .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors
Article Snippet: The following shRNAs were expressed from the GIPZ vector and are available through GE Dharmacon (Lafayette, CO). shPAR7.3 (V3LHS_364596, TGTGGTAGAGAAGAGCTGG), shPAQR7.4 (V3LHS_364598, AGAAGTGTGCCAAGGCACT), shGPER.1 (V2LHS_132008, TCCTTCTCCTCTTTAACTC), shGPER.3 (V3LHS_390319, TGATGAAGTACAGGTCGGG). .. Guide RNAs were subsequently cloned into lentiCRISPRv2 (Addgene # 52961) according to the accompanying protocol ( ).

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin.

Article Title: CRISPR–Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome
Article Snippet: Individual gRNAs were ordered as oligonucleotides (IDT-DNA), phosphorylated, hybridized, and cloned via into the EGFP gRNA plasmid for the HBE1 screen or DsRed gRNA plasmid for the HER2 screens using BsmBI sites. .. The lentiviral dCas9-p300 construct was generated by PCR-amplification of Cas9 from lentiCRISPRv2 (Addgene #52961) with primers generating D10A and H840A mutations in overlapping fragments.

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: sgRNAs were designed using the MIT CRISPR design software ( http://crispr.mit.edu ). .. Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA. .. Lentiviral particles were produced in 293T cells as described above.

Article Title: Cooperative p16 and p21 action protects female astrocytes from transformation
Article Snippet: Male and female GBM (Nf−/−;DNp53 ) astrocytes were generated as previously reported [ ] and cells were grown in DMEM/F12 media supplemented with 10% FBS and 1% penicillin-streptomycin. .. CRISPR/Cas9 based gene depletion was achieved in the GBM astrocytes using LentiCRISPRv2 (Addgene plasmid: 52,961 by Dr. Feng Zhang) derived lentiviruses. .. To express p27-specific guide RNA, we replaced the Cas9 coding region in the LentiCRISPRv2 backbone with mCherry as a flow-sorting marker.

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: Cells were cloned by limiting dilution into 96-well plates. .. TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. Puromycin-containing culture medium was replaced daily for 5 days until all cells in uninfected control had died.

Article Title: A paralogous pair of mammalian host restriction factors form a critical host barrier against poxvirus infection
Article Snippet: All viruses were propagated and titrated on VERO cells. .. The plasmids used for the gene knockout were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) according to the published protocol [ ]. .. In brief, lentiCRISPRv2 was digested with BsmBI and ligated with a pair of oligonucleotides with the specific guide sequence.

Article Title: Targeted positron emission tomography imaging of CXCR4 expression in patients with acute myeloid leukemia
Article Snippet: Assessment of CXCR4 mRNA of AML cell lines was performed as described in the Online Supplementary Appendix. .. OCI-AML3 cells were stably transduced with lentiCRISPRv2 (Addgene plasmid #52961), coding for Cas9 and a CXCR4-specific sgRNA. .. Indel formation was assessed as described previously.

Software:

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors
Article Snippet: Guide RNAs were designed using software tools developed by the Zhang Lab and provided on the website http://www.genome-engineering.org/ ( ). .. Guide RNAs were subsequently cloned into lentiCRISPRv2 (Addgene # 52961) according to the accompanying protocol ( ).

Article Title: ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
Article Snippet: sgRNAs were designed using the MIT CRISPR design software ( http://crispr.mit.edu ). .. Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#1: CTGGCGAGCCTGCATGGCGC; AR-RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3: ACTCTCTTCACAGCCGAAGA.

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production. .. Hybridized PCR products were digested with T7 endonuclease 1 (NEB) for 20 min at 37°C in NEBuffer 2 (NEB, USA) and analyzed by agarose gel electrophoresis (2%).

Article Title: A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma
Article Snippet: We designed CRISPR gRNAs to target the 87-aa ORF sequences of PINT87aa using the online software at http://crispr.mit.edu/ . .. To clone the target sequences into the lentiCRISPRv2 (AddGene 52961) backbone, we synthesized oligos containing the same overhangs after BsmBI.

Irradiation:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Negative Control:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

shRNA:

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: MAGOH-reconstitution experiments were performed with V5-tagged MAGOH with the exception of those shown in Supplemental Figure 4e, which were performed using an untagged construct. .. For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Lentivirus was produced in HEK293T cells as per the “low throughput viral production” protocol on the RNAi Consortium Portal (see ).

Agarose Gel Electrophoresis:

Article Title: Characterization of host proteins interacting with the lymphocytic choriomeningitis virus L protein
Article Snippet: Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production. .. Complementary oligo sgRNAs ( ) were cloned into Bsm BI restriction site of LentiCRISPRv2 [ ] (Addgene ID 49535) that was used for lentivirus particle production.

Knock-Out:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: Paragraph title: Generation of Knockout and Knockin Cell Lines ... To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961).

Article Title: Nuclear lactate dehydrogenase A senses ROS to produce α-hydroxybutyrate for HPV-induced cervical tumor growth
Article Snippet: Paragraph title: Generation of knockout cells ... CRISPR-Cas9-based gene knockout was performed by oligonucleotides, three sgRNAs containing the LDHA -targeting sequences, and two sgRNAs containing NRF2 -targeting sequences using lentiCRISPRv2 (Addgene) system.

Article Title: Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer
Article Snippet: For shRNA experiments, constitutive shRNAs were expressed from the pLKO.1 vector (Addgene # 10878, Puromycin resistance) using an shRNA targeting GFP (shGFP) as a negative control. shRNA constructs were obtained from the RNAi Consortium shRNA collection (see ) Inducible shRNAs were cloned into a Gateway-compatible doxycycline-inducible lentiviral shRNA expression system (G418 resistance), as described . sgRNAs were cloned into lentiCRISPRv2 (Addgene #52961) as described (see ). shRNA and sgRNA target sequences are listed in . .. Following completion of antibiotic selection, cells were seeded for downstream assays as described.

Article Title: Targeted positron emission tomography imaging of CXCR4 expression in patients with acute myeloid leukemia
Article Snippet: Paragraph title: CRISPR-Cas9 mediated knock-out of CXCR4 ... OCI-AML3 cells were stably transduced with lentiCRISPRv2 (Addgene plasmid #52961), coding for Cas9 and a CXCR4-specific sgRNA.

Produced:

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org.

Oligonucleotide Synthesis:

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961).

CTG Assay:

Article Title: Multiple mechanisms disrupt the let-7 microRNA family in neuroblastoma
Article Snippet: LIN28B exon 3.1: (CAC CGC AGA GCA AAC TAT TCA TGG A, AAA CTC CAT GAA TAG TTT GCT CTG C). .. Cas9/gRNA constructs: lentiCRISPRv2, lentiCRISPR:EGFPsgRNA-1, and lentiCRISPR:EGFPsgRNA-2, were gifts from Feng Zhang , (Addgene plasmids #52961, #51760, and #51761).

FACS:

Article Title: The transcription factor Zfp90 regulates the self-renewal and differentiation of hematopoietic stem cells
Article Snippet: We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector. .. We replaced GFP with puromycin in lentiCRISPRv2 (Addgene, 52961) plasmid and cloned an sgRNA guide sequence targeting Zfp90 into this vector.

Article Title: Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells
Article Snippet: TUBD1−/− cell lines were generated using lentiCRISPRv2 (Addgene plasmid #52961 ( ; ) with the sgRNA sequence CTGCTCTATGAGAGAGAATG (pTS4617). hTERT RPE-1 TP53−/− GFP-centrin cells were transduced with lentivirus and 8 µg/mL Sequabrene for 72 hr, then passaged into medium containing 6 µg/mL puromycin. .. TUBE1−/− cell line 1 was generated using pX330 (Addgene plasmid #42230 ) with the sgRNA sequence GGGTAGAGACCTGGTCGCCG (pX330-TUBE1, pTS3752). hTERT RPE-1 TP53−/− cells were transiently co-transfected with pX330-TUBE1 and EGFP-expressing vector pEGFP-N1 (Clontech, pTS3627) at 9:1 ratio using Continuum Transfection Reagent (Gemini Bio-Products).

Homologous Recombination:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Addgene inc lenticrisprv2 construct
    CRISPR-Cas9 loss-of-function screen identifies protein-coding genes, including known oncogenes STAT5A and BCL2, as important for MV4-11 cell line growth. (A) Overall experimental design of <t>lentiCRISPRv2</t> library screen. (B) Log2 Fold Change of each protein-coding gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. (C) Fold change of STAT5A normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (D) Western blot of STAT5A using cellular extract from STAT5A-CR1, STAT5A-C2, or EV control infected MV4-11 cells with actin serving as load control. (E) DNA sequencing of the STAT5A locus from four representative STAT5A-CR1 infected MV4-11 clones (C1-C4). STAT5A represents the wild type (WT) sequence. Black box indicates translational start site. Arrow represents predicted cleavage site of Cas9 endonuclease. Red box identifies mutated region, with dashed lines indicating deleted nucleotides. (F, G) Growth curve for STAT5A-CR1 or STAT5A-CR2 infected MV4-11 cells compared to EV control. (H) Fold change of BCL2 normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (I) Western blot of BCL2 in BCL2-CR1 or EV control infected MV4-11 cells with actin serving as load control. (J) Growth curve for BCL2-CR1 infected MV4-11 cells compared to EV control. (B, C, H) Represents combined data from three independently performed lentiCRISPRv2 library infections. Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S1 Table .
    Lenticrisprv2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 95 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 construct/product/Addgene inc
    Average 91 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 construct - by Bioz Stars, 2019-10
    91/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR-Cas9 loss-of-function screen identifies protein-coding genes, including known oncogenes STAT5A and BCL2, as important for MV4-11 cell line growth. (A) Overall experimental design of lentiCRISPRv2 library screen. (B) Log2 Fold Change of each protein-coding gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. (C) Fold change of STAT5A normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (D) Western blot of STAT5A using cellular extract from STAT5A-CR1, STAT5A-C2, or EV control infected MV4-11 cells with actin serving as load control. (E) DNA sequencing of the STAT5A locus from four representative STAT5A-CR1 infected MV4-11 clones (C1-C4). STAT5A represents the wild type (WT) sequence. Black box indicates translational start site. Arrow represents predicted cleavage site of Cas9 endonuclease. Red box identifies mutated region, with dashed lines indicating deleted nucleotides. (F, G) Growth curve for STAT5A-CR1 or STAT5A-CR2 infected MV4-11 cells compared to EV control. (H) Fold change of BCL2 normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (I) Western blot of BCL2 in BCL2-CR1 or EV control infected MV4-11 cells with actin serving as load control. (J) Growth curve for BCL2-CR1 infected MV4-11 cells compared to EV control. (B, C, H) Represents combined data from three independently performed lentiCRISPRv2 library infections. Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S1 Table .

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: CRISPR-Cas9 loss-of-function screen identifies protein-coding genes, including known oncogenes STAT5A and BCL2, as important for MV4-11 cell line growth. (A) Overall experimental design of lentiCRISPRv2 library screen. (B) Log2 Fold Change of each protein-coding gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. (C) Fold change of STAT5A normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (D) Western blot of STAT5A using cellular extract from STAT5A-CR1, STAT5A-C2, or EV control infected MV4-11 cells with actin serving as load control. (E) DNA sequencing of the STAT5A locus from four representative STAT5A-CR1 infected MV4-11 clones (C1-C4). STAT5A represents the wild type (WT) sequence. Black box indicates translational start site. Arrow represents predicted cleavage site of Cas9 endonuclease. Red box identifies mutated region, with dashed lines indicating deleted nucleotides. (F, G) Growth curve for STAT5A-CR1 or STAT5A-CR2 infected MV4-11 cells compared to EV control. (H) Fold change of BCL2 normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (I) Western blot of BCL2 in BCL2-CR1 or EV control infected MV4-11 cells with actin serving as load control. (J) Growth curve for BCL2-CR1 infected MV4-11 cells compared to EV control. (B, C, H) Represents combined data from three independently performed lentiCRISPRv2 library infections. Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S1 Table .

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: CRISPR, Western Blot, Infection, DNA Sequencing, Clone Assay, Sequencing

    Identification of individual microRNAs, including miR-155, that regulate MV4-11 cell line growth. (A) Western blots of Ago2 and Drosha using cellular extract from Ago2-CR1, Drosha-CR1, and EV infected MV4-11 cell lines with actin serving as load control. (B) Growth curve for Ago2-CR1 and Drosha-CR1 infected MV4-11 cells compared to EV control. (C) Log2 Fold Change of each conserved microRNA gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. Represents combined data from three independently performed lentiCRISPRv2 library infections. (D) Schematic of miR-155 hairpin sequence as annotated in miRBase and sgRNA design of two independent miR-155-targeting lentiCRISPRv2 constructs (155-CR1, 155-CR2). (E) Expression levels of miR-155 in MV4-11 cells infected with EV control, 155-CR1, or 155-CR2 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) DNA sequencing of five representative 155-CR1 and 155-CR2 infected MV4-11 clones (C1-C5). 155 represents the WT sequence. Arrow indicates predicted cleavage site of Cas9. Red box identifies the mutated region, with dashed lines indicating deleted nucleotides. (G) Competitive growth curve of EV (GFP+), 155-CR1 (GFP+), or 155-CR2 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S2 Table .

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: Identification of individual microRNAs, including miR-155, that regulate MV4-11 cell line growth. (A) Western blots of Ago2 and Drosha using cellular extract from Ago2-CR1, Drosha-CR1, and EV infected MV4-11 cell lines with actin serving as load control. (B) Growth curve for Ago2-CR1 and Drosha-CR1 infected MV4-11 cells compared to EV control. (C) Log2 Fold Change of each conserved microRNA gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. Represents combined data from three independently performed lentiCRISPRv2 library infections. (D) Schematic of miR-155 hairpin sequence as annotated in miRBase and sgRNA design of two independent miR-155-targeting lentiCRISPRv2 constructs (155-CR1, 155-CR2). (E) Expression levels of miR-155 in MV4-11 cells infected with EV control, 155-CR1, or 155-CR2 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) DNA sequencing of five representative 155-CR1 and 155-CR2 infected MV4-11 clones (C1-C5). 155 represents the WT sequence. Arrow indicates predicted cleavage site of Cas9. Red box identifies the mutated region, with dashed lines indicating deleted nucleotides. (G) Competitive growth curve of EV (GFP+), 155-CR1 (GFP+), or 155-CR2 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S2 Table .

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: Western Blot, Infection, Sequencing, Construct, Expressing, Real-time Polymerase Chain Reaction, DNA Sequencing, Clone Assay

    Anti-correlation functional profiling identifies relevant miRNA-target interactions, including miR-150 repression of p53, that regulate MV4-11 cell line growth. (A) Heat map indicating representative oncogenes whose loss leads to decreased cell growth according to Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and functionally anti-correlated miRNAs that are predicted to target each oncogene. Grey boxes indicate that the miRNA is not predicted to bind the 3’UTR of the oncogene (NT = Not targeted). (B) Heat map indicating representative TSGs whose loss lead to increased cell growth according to our Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and miRNAs predicted to target each TSG whose growth anti-correlated in library. Grey boxes indicates that the miRNA is not predicted to bind the 3’UTR of TSG (NT = Not targeted). (C) Schematic showing miR-150 targeting of the p53 3’UTR. (D) Schematic of the miR-150 hairpin sequence as annotated in miRBase and sgRNA design of the miR-150-targeting lentiCRISPRv2 construct (150-CR1). (E) Expression level of miR-150 in MV4-11 cells infected with EV control or 150-CR1 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) Western blot of p53 in p53-CR1, 150-CR1, and EV control infected MV4-11 cell lines with actin serving as load control. (G) Competitive growth curve of EV (GFP+), p53-CR1 (GFP+), or 150-CR1 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). (A, B) Only expressed protein-coding genes and microRNAs with p-values

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: Anti-correlation functional profiling identifies relevant miRNA-target interactions, including miR-150 repression of p53, that regulate MV4-11 cell line growth. (A) Heat map indicating representative oncogenes whose loss leads to decreased cell growth according to Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and functionally anti-correlated miRNAs that are predicted to target each oncogene. Grey boxes indicate that the miRNA is not predicted to bind the 3’UTR of the oncogene (NT = Not targeted). (B) Heat map indicating representative TSGs whose loss lead to increased cell growth according to our Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and miRNAs predicted to target each TSG whose growth anti-correlated in library. Grey boxes indicates that the miRNA is not predicted to bind the 3’UTR of TSG (NT = Not targeted). (C) Schematic showing miR-150 targeting of the p53 3’UTR. (D) Schematic of the miR-150 hairpin sequence as annotated in miRBase and sgRNA design of the miR-150-targeting lentiCRISPRv2 construct (150-CR1). (E) Expression level of miR-150 in MV4-11 cells infected with EV control or 150-CR1 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) Western blot of p53 in p53-CR1, 150-CR1, and EV control infected MV4-11 cell lines with actin serving as load control. (G) Competitive growth curve of EV (GFP+), p53-CR1 (GFP+), or 150-CR1 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). (A, B) Only expressed protein-coding genes and microRNAs with p-values

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: Functional Assay, Sequencing, Construct, Expressing, Infection, Real-time Polymerase Chain Reaction, Western Blot

    Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Journal:

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Article Snippet: LentiCRISPRv2 vector from Addgene (#52961) was digested with BsmBI and ligated with annealed oligonucleotides (ABCB1-sg1 and ABCB1-sg1; ).

    Techniques: CRISPR, Plasmid Preparation

    Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Journal:

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Article Snippet: LentiCRISPRv2 vector from Addgene (#52961) was digested with BsmBI and ligated with annealed oligonucleotides (ABCB1-sg1 and ABCB1-sg1; ).

    Techniques: Knock-Out, CRISPR, Transduction, Expressing, Western Blot

    Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.

    Journal: Nature Communications

    Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells

    doi: 10.1038/ncomms14686

    Figure Lengend Snippet: Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.

    Article Snippet: LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org.

    Techniques: Expressing, Purification, FACS, Staining, Construct, Cell Culture, Infection, Polymerase Chain Reaction

    Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.

    Journal: Nature

    Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens

    doi: 10.1038/nature18631

    Figure Lengend Snippet: Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.

    Article Snippet: To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin.

    Techniques: Knock-Out, CRISPR, Gene Knockout, Sequencing, Western Blot