Structured Review

Addgene inc lenticrisprv2
GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2/product/Addgene inc
Average 96 stars, based on 79 article reviews
Price from $9.99 to $1999.99
lenticrisprv2 - by Bioz Stars, 2020-05
96/100 stars

Images

1) Product Images from "Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions"

Article Title: Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA119.009372

GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
Figure Legend Snippet: GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

Techniques Used: Knock-In, CRISPR, Transduction, Transfection, Plasmid Preparation, Selection, Marker, Non-Homologous End Joining, Knock-Out, Western Blot

2) Product Images from "Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens"

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens

Journal: Nature

doi: 10.1038/nature18631

Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.
Figure Legend Snippet: Analysis of HCV host factor knockout cell lines (a) Genotyping of CRISPR-induced KO Huh7.5.1 cells by Sanger sequencing showing the mutated locus and the WT reference. CRISPR/Cas9 induces mutations close to the PAM site resulting in frameshifts. CD81 and ELAVL1 KO cell lines are subclones whereas others are populations of cells mutagenized with lentiCRISPRv2. (b) Immunoblots of CRISPR-induced KO cells.

Techniques Used: Knock-Out, CRISPR, Sequencing, Western Blot

3) Product Images from "SZT2 Dictates GATOR Control of mTORC1 Signaling"

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling

Journal: Nature

doi: 10.1038/nature21378

The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.
Figure Legend Snippet: The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.

Techniques Used: Transfection

4) Product Images from "SZT2 Dictates GATOR Control of mTORC1 Signaling"

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling

Journal: Nature

doi: 10.1038/nature21378

The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.
Figure Legend Snippet: The roles of GATOR2 components in SZT2 regulation of mTORC1 signaling a – c , Cells were deprived of amino acids for 1 h and stimulated with amino acids for 10 min when indicated. Total cell lysates were analyzed by immunoblotting. d , Control or SZT2-deficient cells were transfected with LentiCrisprV2 plasmids targeting GFP or SEH1L, selected with puromycin, and analyzed as in ( a ). Data ( a – d ) are representatives of three independent experiments.

Techniques Used: Transfection

5) Product Images from "Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9"

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9

Journal: Nature biotechnology

doi: 10.1038/nbt.3437

Comparative performance of the Avana library. ( a ) Distribution of Rule Set 1 scores across libraries. The box represents the 25 th , 50 th , and 75 th percentiles, whiskers show 5 th and 95 th percentiles. (b ) Comparison of the FDR-corrected q-values determined by STARS for the top 100 ranked genes in the vemurafenib resistance assay in A375 cells. ( c ) Validation of individual sgRNAs for vemurafenib resistance in a competition assay in A375 cells. Horizontal bars represent the average of the individual sgRNAs for each gene. Previously-validated genes are labeled in blue. ETP = early time point. ( d ) Subsampling analysis of the Avana library. We first identified genes that passed at different FDR thresholds with STARS when all six subpools were analyzed (first number in legend), the average number of retained genes that score at different FDR thresholds following removal of subpools (second number in legend). LG = lentiGuide; LC = lentiCRISPRv2. ( e ) ROC-AUC analysis of individual sgRNAs targeting core essential genes in dropout screens in A375 cells. AUC values are indicated in parentheses.
Figure Legend Snippet: Comparative performance of the Avana library. ( a ) Distribution of Rule Set 1 scores across libraries. The box represents the 25 th , 50 th , and 75 th percentiles, whiskers show 5 th and 95 th percentiles. (b ) Comparison of the FDR-corrected q-values determined by STARS for the top 100 ranked genes in the vemurafenib resistance assay in A375 cells. ( c ) Validation of individual sgRNAs for vemurafenib resistance in a competition assay in A375 cells. Horizontal bars represent the average of the individual sgRNAs for each gene. Previously-validated genes are labeled in blue. ETP = early time point. ( d ) Subsampling analysis of the Avana library. We first identified genes that passed at different FDR thresholds with STARS when all six subpools were analyzed (first number in legend), the average number of retained genes that score at different FDR thresholds following removal of subpools (second number in legend). LG = lentiGuide; LC = lentiCRISPRv2. ( e ) ROC-AUC analysis of individual sgRNAs targeting core essential genes in dropout screens in A375 cells. AUC values are indicated in parentheses.

Techniques Used: Competitive Binding Assay, Labeling

6) Product Images from "Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors"

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors

Journal: eLife

doi: 10.7554/eLife.15104

Hormone receptors in melanocytes. ( A ) Relative gene expression of classical hormone receptors in MCF7 cells and melanocytes, as determined by qRT-PCR. Ct values were normalized to actin, and set relative to the expression of androgen receptor (AR) in MCF7 cells. ( B ) Average RPKM values for classical and nonclassical estrogen and progesterone receptor transcripts in human melanocytes, by convention, RPKM values > 1 indicate the gene is expressed. ( C ) Expression of GPER and PAQR7 displayed as 1/Ct value. ( D ) Relative expression of GPER and PAQR7 transcripts in melanocytes, fibroblasts, and keratinocytes, as determined by qRT-PCR, displayed relative to the expression level in melanocytes. ( E ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting GPER. ( F ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting PAQR7. ( G ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or GPER. Cells were treated with either vehicle or estrogen. ( H ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or PAQR7. Cells were treated with either vehicle or progesterone. Error bars denote +/- s.d., *p
Figure Legend Snippet: Hormone receptors in melanocytes. ( A ) Relative gene expression of classical hormone receptors in MCF7 cells and melanocytes, as determined by qRT-PCR. Ct values were normalized to actin, and set relative to the expression of androgen receptor (AR) in MCF7 cells. ( B ) Average RPKM values for classical and nonclassical estrogen and progesterone receptor transcripts in human melanocytes, by convention, RPKM values > 1 indicate the gene is expressed. ( C ) Expression of GPER and PAQR7 displayed as 1/Ct value. ( D ) Relative expression of GPER and PAQR7 transcripts in melanocytes, fibroblasts, and keratinocytes, as determined by qRT-PCR, displayed relative to the expression level in melanocytes. ( E ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting GPER. ( F ) qRT-PCR showing mRNA knockdown efficiency of the two hairpins targeting PAQR7. ( G ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or GPER. Cells were treated with either vehicle or estrogen. ( H ) Melanin content of melanocytes transduced with LentiCRISPRV2 with guide RNA targeting GFP or PAQR7. Cells were treated with either vehicle or progesterone. Error bars denote +/- s.d., *p

Techniques Used: Expressing, Quantitative RT-PCR, Transduction

7) Product Images from "Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells"

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells

Journal: Nature Communications

doi: 10.1038/ncomms14686

Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.
Figure Legend Snippet: Oncogenic KRAS expression and tumour suppressor inactivation immortalizes purified primary human duct cells. ( a ) Schematic diagram summarizing experimental procedures. ( b ) FACS histogram of the dissociated human adult pancreas stained with antibody specific for CD133. Results are representative of three independent experiments. ( c ) Schematics of lentiviral constructs used and sgRNA sequences for the construction of lentiCRISPRv2. ( d ) Representative images of spheres cultured for 27 days from CD133 + ductal cells infected with combinations of lentiviruses (CTRL- NeoR , Control- NeoR alone; KRAS- NeoR , KRAS- NeoR alone; CTRLmix, Control- NeoR and lentiCRISPRv2-Control; KCST, KRAS- NeoR plus lentiCRISPRv2 against CDKN2A#1, SMAD4#1 and TP53#2). ( e ) Genomic DNA PCR for confirming the presence of lentiviral transgenes in uninfected (S1; Supplementary Table 1 ) and infected (S1 KCST) spheres. bp=base pair. ( f ) Relative mRNA expression level of oncogenic KRAS transgene (left) and the transgene plus endogenous KRAS (right); n =2. ( g ) Indel efficiency of each indicated genomic locus assessed by TIDE analysis, ( h ) Quantification of the total cell number in each cell passage of CD133 + cells infected with indicated combinations of lentiviruses. Data are presented as fold increase over day 1. ( i ) Representative stereoscopic and haematoxylin and eosin (H E) staining images of S1 KCST spheres after 52 days in culture. Error bars=s.d., scale bars, 200 μm.

Techniques Used: Expressing, Purification, FACS, Staining, Construct, Cell Culture, Infection, Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma
Article Snippet: .. CRISPR/Cas9 plasmids were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) and are designed to confer resistance to puromycin, hygromycin B, G418 or blasticidin S. These were created by first destroying the Mlu I restriction site of lentiCRISPRv2 at nucleotide position 231 by Mlu I digestion followed by Klenow end-filling and re-ligation to create lentiCRISPRv2 puro, then cloning P2A-antibiotic resistance cassettes between the Mlu I and Bam HI restriction sites of lentiCRISPRv2 puro. .. The P2A sequence was from lentiCRISPRv2, the hygromycin resistance gene cassette from pF CAG luc hygro, the neomycin resistance gene cassette from pF CAG luc IRES neo, and the blasticidin resistance gene cassette from pcDNA6TR (Invitrogen).

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin.

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: .. To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). ..

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2. .. To insert a FLAG tag into this site via homologous recombination, we generated a double-stranded DNA with FLAG coding sequence followed by a GG linker that was flanked on either side by 40 base pairs of sequence surrounding the SZT2 start codon.

Article Title: Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors
Article Snippet: .. Guide RNAs were subsequently cloned into lentiCRISPRv2 (Addgene # 52961) according to the accompanying protocol ( ). ..

Gene Knockout:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: .. To generate gene knockout cell lines, guide RNAs were cloned into LentiCrisprV2 (Addgene #52961). ..

Construct:

Article Title: A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma
Article Snippet: .. CRISPR/Cas9 plasmids were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) and are designed to confer resistance to puromycin, hygromycin B, G418 or blasticidin S. These were created by first destroying the Mlu I restriction site of lentiCRISPRv2 at nucleotide position 231 by Mlu I digestion followed by Klenow end-filling and re-ligation to create lentiCRISPRv2 puro, then cloning P2A-antibiotic resistance cassettes between the Mlu I and Bam HI restriction sites of lentiCRISPRv2 puro. .. The P2A sequence was from lentiCRISPRv2, the hygromycin resistance gene cassette from pF CAG luc hygro, the neomycin resistance gene cassette from pF CAG luc IRES neo, and the blasticidin resistance gene cassette from pcDNA6TR (Invitrogen).

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. All constructs were sequence verified and the primer sequence information is shown in .

Polymerase Chain Reaction:

Article Title: Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9
Article Snippet: .. The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). .. The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin.

CRISPR:

Article Title: A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma
Article Snippet: .. CRISPR/Cas9 plasmids were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) and are designed to confer resistance to puromycin, hygromycin B, G418 or blasticidin S. These were created by first destroying the Mlu I restriction site of lentiCRISPRv2 at nucleotide position 231 by Mlu I digestion followed by Klenow end-filling and re-ligation to create lentiCRISPRv2 puro, then cloning P2A-antibiotic resistance cassettes between the Mlu I and Bam HI restriction sites of lentiCRISPRv2 puro. .. The P2A sequence was from lentiCRISPRv2, the hygromycin resistance gene cassette from pF CAG luc hygro, the neomycin resistance gene cassette from pF CAG luc IRES neo, and the blasticidin resistance gene cassette from pcDNA6TR (Invitrogen).

Knock-In:

Article Title: SZT2 Dictates GATOR Control of mTORC1 Signaling
Article Snippet: .. To generate the knockin allele of SZT2 , a guide RNA targeting the first coding exon of SZT2 (sgSZT2ATG) was cloned into LentiCrisprV2. .. To insert a FLAG tag into this site via homologous recombination, we generated a double-stranded DNA with FLAG coding sequence followed by a GG linker that was flanked on either side by 40 base pairs of sequence surrounding the SZT2 start codon.

Plasmid Preparation:

Article Title: Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions
Article Snippet: .. We thank Dr. Feng Zhang for the gift of LentiCRISPRv2 (Addgene plasmid 52961), Dr. Heinrich Leonhardt for the gift of pCANTD-EGFP, Dr. David Sabatini for the gift of pLJM1-EGFP (Addgene plasmid 19319), Dr. Didier Trono for the gift of psPAX2 (Addgene plasmid 12260), and Dr. Xuedong Liu for the gift of VSV-G. .. The following reagents were obtained through the AIDS Reagent Program, Division of AIDS, NIAID, National Institutes of Health: anti-HIV immune globulin (HIVIG) from NABI and National Heart Lung and Blood Institute (Dr. Luiz Barbosa) and TZM-bl cells from Dr. John C. Kappes, Dr. Xiaoyun Wu, and Tranzyme Inc.

Article Title: A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma
Article Snippet: .. CRISPR/Cas9 plasmids were constructed from lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) and are designed to confer resistance to puromycin, hygromycin B, G418 or blasticidin S. These were created by first destroying the Mlu I restriction site of lentiCRISPRv2 at nucleotide position 231 by Mlu I digestion followed by Klenow end-filling and re-ligation to create lentiCRISPRv2 puro, then cloning P2A-antibiotic resistance cassettes between the Mlu I and Bam HI restriction sites of lentiCRISPRv2 puro. .. The P2A sequence was from lentiCRISPRv2, the hygromycin resistance gene cassette from pF CAG luc hygro, the neomycin resistance gene cassette from pF CAG luc IRES neo, and the blasticidin resistance gene cassette from pcDNA6TR (Invitrogen).

Article Title: Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens
Article Snippet: .. To create KO cell lines using lentiCRISPRv2 (Addgene) the following guideRNAs below were cloned into the vector, Huh7.5.1 cells were lentivirally transduced and selected with Puromycin. .. The following guideRNA sequences were used: ANKRD49: AGAAAGGAGTCTCCGCACTG ANKRD49 guide2: ATGAACCGTTACGTCAAACC ANKRD49 guide3: GCCCAAAGAAGCAATCTGCT ANKRD49 guide4: AGAAAGGAGTCTCCGCACTG CD81: GCGCCCAACACCTTCTATGT CLDN1: CGATGGCGCCGATCCATCCC ELAVL1: TTGGGCGGATCATCAACTCG ELAVL1 guide2: TGTGAACTACGTGACCGCGA ELAVL1 guide3: GGGCCTCCGAACCGTCGCGC ELAVL1 guide4: AGAGCGATCAACACGCTGAA EMC1: AGGCCGAATCATGCGTTCCT EMC2: GATTGCCATTCGAAAAGCCC EMC3: GTGCCACCTTCTCCTATGAC EMC4: TGCTTGTCCAAGTAACCGAC FKBPL: GTCAAGAAGATCGTAATCCG FKBPL guide2: GAAGAGCCCGTCCATAGCAT FKBPL guide3: ACAGAGCTAACTATGGGCGT FKBPL guide4: GTTTCGGTAGGAGGGTCTCG FLAD1: ACAGACCATTGAGACCTCCC FLAD1 guide2: CATGCGCATCAACCCACTGC FLAD1 guide3: TACAGGAGTAGGGGTCAGTC FLAD1 guide4: TGTGTCCCTGGGGGTTGAAG MAGT1: GAGCGAACATGGCAGCGCGT MIR-122: GAGTTTCCTTAGCAGAGCTG MMGT1: CAGGCACTTACGCTGCGCAG Non-targeting: GCCCAGACGCCCTAGAATAG OCLN: ACGTAGAGTCCAGTAGCTGC OSTC: TCAGTCATAGAACCGACACT PPIA: GTACCCTTACCACTCAGTCT RFK: TATCATGCATACCTTCAAAG RFK guide2: GGTCAAGTGGTGCGGGGCTT RFK guide3: CTATGGGGAAATCCTCAATG RFK guide4: CCAACCATAGTAAATACCAG RPN2: TCGCTACCACGTGCCAGTTG SRRD: GACTGTTCTCAGTGAGAACG SRRD guide2: GATAGATACCTTTGCAATGT SRRD guide3: ATTGAAGTCCTTAACACCCT SRRD guide4: AACAACTGAAGGCCCCTGTG SSR2: CAATAGCAGGGGGATGCCGA SSR3: GACCCTAGTAAGCACATATT STT3A: GTACTCACGGATCAAACTCA STT3B : TACAGCAAAAGAGTCTACAT ZEB1: TGAAGACAAACTGCATATTG TALENs targeting AUP1 in HAP1 cells were generated as indicated in .

Article Title: Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells
Article Snippet: .. LentiCRISPR reagents were constructed using lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid no. 52961), according to the recommended protocol published in Addgene.org. .. All constructs were sequence verified and the primer sequence information is shown in .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Addgene inc lenticrisprv2 vector
    Generate CRISPR/Cas9 vector to target ABCB1. The map of <t>LentiCRISPRv2</t> vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.
    Lenticrisprv2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 vector/product/Addgene inc
    Average 96 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 vector - by Bioz Stars, 2020-05
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lenticrisprv2
    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
    Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2/product/Addgene inc
    Average 96 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 - by Bioz Stars, 2020-05
    96/100 stars
      Buy from Supplier

    Image Search Results


    Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Journal: American Journal of Translational Research

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Article Snippet: The two targeting sequences from exon 5 and 8 of ABCB1 end with a 5’ NGG3’ PAM (protospacer-adjacent motif) sequence were cloned into LentiCRISPRv2 vector respectively ( ).

    Techniques: CRISPR, Plasmid Preparation

    Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Journal: American Journal of Translational Research

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Article Snippet: The two targeting sequences from exon 5 and 8 of ABCB1 end with a 5’ NGG3’ PAM (protospacer-adjacent motif) sequence were cloned into LentiCRISPRv2 vector respectively ( ).

    Techniques: Knock-Out, CRISPR, Transduction, Expressing, Western Blot

    Inhibiting HIF1α Accumulation Restores Effector Memory Formation in Antigen-Specific T/NIX −/− CD8 + T cells (A) Representative plot showing percentage of Ova-EM formed in vitro from WT and T/NIX −/− splenocytes (treated with vehicle or CAY10585 on day 4). (B) Mean frequency of Ova-EM from (A). (C) Effect of loss of HIF1α on effector memory formation. OT-I WT or OT-I T/NIX −/− cells were transduced with LentiCRISPRv2 expressing sgRNA-HIF1α or sgRNA-control. Ova-EM from all mice within the same experimental group were combined. Each point represents an individual independent experiment. (D) Mean frequency of Ova-EM formed in vitro from WT and T/NIX −/− splenocytes (treated with CAY10585 or CAY10585 and oligomycin). (E and F) IFN-Υ concentration in the spleen (E) and (F) viral titer in the brains of mice 48 h after infection with 10 6 PFU of VSV-Ova. Naive C57/BL6J mice were injected with vehicle or CAY10585-treated WT or T/NIX −/− cells, generated as in (A), followed by infection with VSV-Ova. Data in (A)–(D) are representative of two or more independent experiments (n = 5–8), and data in (E) and (F) are representative of four or five biological replicates per group. Data were analyzed by two-tailed Student’s t test (mean ± SEM). *p

    Journal: Cell reports

    Article Title: NIX-Mediated Mitophagy Promotes Effector Memory Formation in Antigen-Specific CD8+ T Cells

    doi: 10.1016/j.celrep.2019.10.032

    Figure Lengend Snippet: Inhibiting HIF1α Accumulation Restores Effector Memory Formation in Antigen-Specific T/NIX −/− CD8 + T cells (A) Representative plot showing percentage of Ova-EM formed in vitro from WT and T/NIX −/− splenocytes (treated with vehicle or CAY10585 on day 4). (B) Mean frequency of Ova-EM from (A). (C) Effect of loss of HIF1α on effector memory formation. OT-I WT or OT-I T/NIX −/− cells were transduced with LentiCRISPRv2 expressing sgRNA-HIF1α or sgRNA-control. Ova-EM from all mice within the same experimental group were combined. Each point represents an individual independent experiment. (D) Mean frequency of Ova-EM formed in vitro from WT and T/NIX −/− splenocytes (treated with CAY10585 or CAY10585 and oligomycin). (E and F) IFN-Υ concentration in the spleen (E) and (F) viral titer in the brains of mice 48 h after infection with 10 6 PFU of VSV-Ova. Naive C57/BL6J mice were injected with vehicle or CAY10585-treated WT or T/NIX −/− cells, generated as in (A), followed by infection with VSV-Ova. Data in (A)–(D) are representative of two or more independent experiments (n = 5–8), and data in (E) and (F) are representative of four or five biological replicates per group. Data were analyzed by two-tailed Student’s t test (mean ± SEM). *p

    Article Snippet: Oligonucleotides were annealed and cloned into BsmBI-BsmBI sites in LentiCRISPRv2 plasmid (Addgene plasmid #82416).

    Techniques: In Vitro, Transduction, Expressing, Mouse Assay, Concentration Assay, Infection, Injection, Generated, Two Tailed Test

    Elevated HIF1α Alters Mitochondrial Fatty Acid Metabolism during CD8 + T Cell Effector Memory Formation in T/NIX −/− Mice, Leading to Impairment in ATP Synthesis (A) Gene expression of Fasn in Ova-EM 30 days after immunization with 10 4 VSV-Ova. (B and C) Gene expression of T cell metabolic genes (B) and Bckdk (C) in Ova-EM 30 days after VSV-Ova immunization in WT and T/NIX −/− mice. (D) Gene expression of Fasn (left panel) and Bckdk (right panel) in Ova-EM formed in vitro (vehicle or CAY10585 treatment on day 4). (E) Left: representative OCR in Ova-EM in vitro (vehicle or CAY10585 treated OT-I WT and OT-I T/NIX −/− cells). Right: fold change in long-chain fatty acid oxidation-linked OCR from left panel. (F) Fold change in short/branched-chain fatty acid oxidation linked OCR in Ova-EM formed in vitro (vehicle or CAY10585 treated OT-I WT and OT-I T/NIX −/− cells). (G) Effect of loss of ACADSB on effector memory formation in OT-I WT and OT-I T/NIX −/− cells transduced with LentiCRISPRv2 expressing sgRNA-control or sgRNA-ACADSB. (H) Intracellular ATP level in Ova-EM 30 days p.i. in WT and T/NIX −/− mice. (I) Intracellular ATP in Ova-EM formed in vitro (vehicle or CAY10585 treated WT or T/NIX −/− cells). (J) Intracellular ATP in Ova-EM formed in vitro (sgRNA-control or sgRNA-HIF1α transduced OT-I WT or OT-I T/NIX −/− cells). Ova-EM from all mice within the same experimental group in (A)–(F) and (H)–(J) were pooled for analysis. Each point represents an individual independent experiment. Data are representative of two or more independent experiments (n = 4–9). Data were analyzed using two-tailed Student’s t test (mean ± SEM). *p

    Journal: Cell reports

    Article Title: NIX-Mediated Mitophagy Promotes Effector Memory Formation in Antigen-Specific CD8+ T Cells

    doi: 10.1016/j.celrep.2019.10.032

    Figure Lengend Snippet: Elevated HIF1α Alters Mitochondrial Fatty Acid Metabolism during CD8 + T Cell Effector Memory Formation in T/NIX −/− Mice, Leading to Impairment in ATP Synthesis (A) Gene expression of Fasn in Ova-EM 30 days after immunization with 10 4 VSV-Ova. (B and C) Gene expression of T cell metabolic genes (B) and Bckdk (C) in Ova-EM 30 days after VSV-Ova immunization in WT and T/NIX −/− mice. (D) Gene expression of Fasn (left panel) and Bckdk (right panel) in Ova-EM formed in vitro (vehicle or CAY10585 treatment on day 4). (E) Left: representative OCR in Ova-EM in vitro (vehicle or CAY10585 treated OT-I WT and OT-I T/NIX −/− cells). Right: fold change in long-chain fatty acid oxidation-linked OCR from left panel. (F) Fold change in short/branched-chain fatty acid oxidation linked OCR in Ova-EM formed in vitro (vehicle or CAY10585 treated OT-I WT and OT-I T/NIX −/− cells). (G) Effect of loss of ACADSB on effector memory formation in OT-I WT and OT-I T/NIX −/− cells transduced with LentiCRISPRv2 expressing sgRNA-control or sgRNA-ACADSB. (H) Intracellular ATP level in Ova-EM 30 days p.i. in WT and T/NIX −/− mice. (I) Intracellular ATP in Ova-EM formed in vitro (vehicle or CAY10585 treated WT or T/NIX −/− cells). (J) Intracellular ATP in Ova-EM formed in vitro (sgRNA-control or sgRNA-HIF1α transduced OT-I WT or OT-I T/NIX −/− cells). Ova-EM from all mice within the same experimental group in (A)–(F) and (H)–(J) were pooled for analysis. Each point represents an individual independent experiment. Data are representative of two or more independent experiments (n = 4–9). Data were analyzed using two-tailed Student’s t test (mean ± SEM). *p

    Article Snippet: Oligonucleotides were annealed and cloned into BsmBI-BsmBI sites in LentiCRISPRv2 plasmid (Addgene plasmid #82416).

    Techniques: Mouse Assay, Expressing, In Vitro, Transduction, Two Tailed Test

    Generation of the miR-26a-knockout line in HeLa cells using the CRISPR-Cas9 system. ( a ) Two sgRNAs were designed for miR-26a depletion by CRISPR DESIGN ( http://crispr.mit.edu/ ). ( b ) The sequencing results showed that the two sgRNAs were appropriately inserted into the lentiCRISPRv2 vector. ( c ) The sequencing data revealed that a 28-bp deletion in the target site was introduced by the CRISPR-Cas9 system.

    Journal: Scientific Reports

    Article Title: Label-free Quantitative Analysis of Protein Expression Alterations in miR-26a-Knockout HeLa Cells using SWATH-MS Technology

    doi: 10.1038/s41598-018-34904-8

    Figure Lengend Snippet: Generation of the miR-26a-knockout line in HeLa cells using the CRISPR-Cas9 system. ( a ) Two sgRNAs were designed for miR-26a depletion by CRISPR DESIGN ( http://crispr.mit.edu/ ). ( b ) The sequencing results showed that the two sgRNAs were appropriately inserted into the lentiCRISPRv2 vector. ( c ) The sequencing data revealed that a 28-bp deletion in the target site was introduced by the CRISPR-Cas9 system.

    Article Snippet: To produce the lentivirus, HEK 293 T cells seeded in 100-mm plates were cotransfected with 4.0 μg of lentiCRISPRv2 plasmids, 3.0 μg of psPAX2 (Addgene plasmid # 12260), and 1.0 μg of pMD2.G plasmids (Addgene plasmid #12259) using polyethyleneimine (Polysciences Inc., USA), according to the manufacturer’s instructions.

    Techniques: Knock-Out, CRISPR, Sequencing, Plasmid Preparation

    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Journal: The Journal of Biological Chemistry

    Article Title: Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions

    doi: 10.1074/jbc.RA119.009372

    Figure Lengend Snippet: GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Article Snippet: We thank Dr. Feng Zhang for the gift of LentiCRISPRv2 (Addgene plasmid 52961), Dr. Heinrich Leonhardt for the gift of pCANTD-EGFP, Dr. David Sabatini for the gift of pLJM1-EGFP (Addgene plasmid 19319), Dr. Didier Trono for the gift of psPAX2 (Addgene plasmid 12260), and Dr. Xuedong Liu for the gift of VSV-G.

    Techniques: Knock-In, CRISPR, Transduction, Transfection, Plasmid Preparation, Selection, Marker, Non-Homologous End Joining, Knock-Out, Western Blot