lenti x qrt pcr titration kit  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Lenti X qRT PCR Titration Kit
    Description:
    The Lenti X qRT PCR Titration Kit provides a fast and simple method for measuring lentivirus titer The kit uses a quick RNA purification step before quantifying the number of lentiviral genome copies using real time PCR
    Catalog Number:
    631235
    Price:
    None
    Size:
    200 Rxns
    Category:
    qRT PCR Titration kits Lentivirus Viral transduction Gene function
    Buy from Supplier


    Structured Review

    TaKaRa lenti x qrt pcr titration kit
    Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by <t>qRT-PCR</t> and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
    The Lenti X qRT PCR Titration Kit provides a fast and simple method for measuring lentivirus titer The kit uses a quick RNA purification step before quantifying the number of lentiviral genome copies using real time PCR
    https://www.bioz.com/result/lenti x qrt pcr titration kit/product/TaKaRa
    Average 90 stars, based on 104 article reviews
    Price from $9.99 to $1999.99
    lenti x qrt pcr titration kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Characterization of miR-122-independent propagation of HCV"

    Article Title: Characterization of miR-122-independent propagation of HCV

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006374

    Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
    Figure Legend Snippet: Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

    Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

    G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
    Figure Legend Snippet: G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

    Techniques Used: Infection, Immunoprecipitation, Quantitative RT-PCR, Standard Deviation

    Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
    Figure Legend Snippet: Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

    Techniques Used: Derivative Assay, Staining, Transduction, Expressing, Electroporation, Quantitative RT-PCR, Clone Assay, Immunoprecipitation, Standard Deviation

    miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
    Figure Legend Snippet: miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

    Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

    2) Product Images from "High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis"

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05766-5

    Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p
    Figure Legend Snippet: Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p

    Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction, Construct

    Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p
    Figure Legend Snippet: Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p

    Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction

    Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p
    Figure Legend Snippet: Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p

    Techniques Used: Knock-Out, Quantitative RT-PCR, Expressing, Mouse Assay

    3) Product Images from "High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis"

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05766-5

    Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p
    Figure Legend Snippet: Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p

    Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction, Construct

    Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p
    Figure Legend Snippet: Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p

    Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction

    Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p
    Figure Legend Snippet: Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p

    Techniques Used: Knock-Out, Quantitative RT-PCR, Expressing, Mouse Assay

    4) Product Images from "Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity"

    Article Title: Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    Journal: Scientific Reports

    doi: 10.1038/srep31022

    Inhibition of DNMTs restores the expression of Bdnf exon IV and VI transcripts in primary cortical neurons. ( A ) DIV 5 cortical neurons were infected with Htt lentivirus. RNA was harvested 5 days later and subjected to qRT-PCR for total Bdnf (coding exon IX) using β-actin and 18S rRNA as reference genes. Htt-72Q decreased the expression of total Bdnf transcripts (Mann-Whitney U test, * P = 0.008 vs. Htt-25Q, n = 5). ( B ) Cortical neurons transduced as in ( A ) were cultured with recombinant BDNF (50 ng/ml) and subjected to MTS assay at DIV 14. BDNF increased the viability of Htt-72Q-expressing neurons (ANOVA, *P
    Figure Legend Snippet: Inhibition of DNMTs restores the expression of Bdnf exon IV and VI transcripts in primary cortical neurons. ( A ) DIV 5 cortical neurons were infected with Htt lentivirus. RNA was harvested 5 days later and subjected to qRT-PCR for total Bdnf (coding exon IX) using β-actin and 18S rRNA as reference genes. Htt-72Q decreased the expression of total Bdnf transcripts (Mann-Whitney U test, * P = 0.008 vs. Htt-25Q, n = 5). ( B ) Cortical neurons transduced as in ( A ) were cultured with recombinant BDNF (50 ng/ml) and subjected to MTS assay at DIV 14. BDNF increased the viability of Htt-72Q-expressing neurons (ANOVA, *P

    Techniques Used: Inhibition, Expressing, Infection, Quantitative RT-PCR, MANN-WHITNEY, Cell Culture, Recombinant, MTS Assay

    DNMT inhibitors reactivate striatal gene expression in mutant Htt-expressing primary neurons and R6/2 HD mouse brain in vivo . ( A ) DIV 5 mouse primary striatal neurons were infected with lentivirus expressing Htt-25Q or Htt-72Q exon1 fragment; 5 days later, RNA was prepared and subjected to qRT-PCR analysis. β-actin and Hprt were used as reference genes. Decitabine restored the expression of downregulated genes in mutant Htt-expressing striatal neurons (ANOVA, *P
    Figure Legend Snippet: DNMT inhibitors reactivate striatal gene expression in mutant Htt-expressing primary neurons and R6/2 HD mouse brain in vivo . ( A ) DIV 5 mouse primary striatal neurons were infected with lentivirus expressing Htt-25Q or Htt-72Q exon1 fragment; 5 days later, RNA was prepared and subjected to qRT-PCR analysis. β-actin and Hprt were used as reference genes. Decitabine restored the expression of downregulated genes in mutant Htt-expressing striatal neurons (ANOVA, *P

    Techniques Used: Expressing, Mutagenesis, In Vivo, Infection, Quantitative RT-PCR

    5) Product Images from "The role of Twist1 in mutant huntingtin–induced transcriptional alterations and neurotoxicity"

    Article Title: The role of Twist1 in mutant huntingtin–induced transcriptional alterations and neurotoxicity

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA117.001211

    Twist1 knockdown protects neurons from mutant Htt–induced toxicity in primary cortical neurons. A , DIV 5 cortical neurons were transduced with Htt- or control (vector)-expressing lentivirus. Five days later, RNA was prepared and subjected to qRT-PCR using β- actin and Hprt as reference genes. Twist1 was up-regulated by Htt-72Q expression (ANOVA; *, p = 0.0083 compared with Htt-25Q, n = 3). B , qRT-PCR was performed using RNA prepared as in A. Pou4f1 was up-regulated by Htt-72Q expression (ANOVA; *, p
    Figure Legend Snippet: Twist1 knockdown protects neurons from mutant Htt–induced toxicity in primary cortical neurons. A , DIV 5 cortical neurons were transduced with Htt- or control (vector)-expressing lentivirus. Five days later, RNA was prepared and subjected to qRT-PCR using β- actin and Hprt as reference genes. Twist1 was up-regulated by Htt-72Q expression (ANOVA; *, p = 0.0083 compared with Htt-25Q, n = 3). B , qRT-PCR was performed using RNA prepared as in A. Pou4f1 was up-regulated by Htt-72Q expression (ANOVA; *, p

    Techniques Used: Mutagenesis, Transduction, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Increased Twist1 gene expression in mouse models of HD. A , qRT-PCR analysis was performed using RNA prepared from 6-week-old R6/2 HD and control WT mouse forebrains ( n = 6 (3 males, 3 females)/group). β- actin and Hprt were used as reference genes. Twist1 RNA was up-regulated in R6/2 compared with WT mice (unpaired t tests; *, p = 0.0043). Egr3 and Bdnf (exon IX, protein coding) RNAs were down-regulated in R6/2 compared with WT mice (unpaired t tests; *, p = 0.0013 for Egr3 ; *, p = 0.022 for Bdnf ). B and C , qRT-PCR analysis was performed using RNA prepared from 33-week-old zQ175 heterozygous ( Het ), homozygous ( Homo ), and control WT mouse cortex ( B ) and striatum ( C ) ( n = 6 (3 males and 3 females) for zQ175 heterozygous and homozygous; n = 7 (4 males and 3 females) for WT). Twist1 RNA was up-regulated in the cortex and striatum of zQ175 mice compared with those of WT (ANOVA; *, p = 0.0001 in B ; *, p = 0.0007 in C ). Egr3 and Bdnf (exon IX, protein coding) RNAs were down-regulated in the cortex of zQ175 compared with WT mice (ANOVA; *, p = 0.042; #, p = 0.011 for Egr3 ; *, p = 0.047 for Bdnf ) ( B ). Drd2 mRNA was down-regulated in zQ175 striatum compared with WT control (ANOVA; *, p = 0.014) ( C ). A trend toward decreased expression of Ppp1r1b in zQ175 mice (zQ175 homozygous compared with WT; p = 0.063) ( C ). D , immunoblot analysis ( IB ) was performed using forebrain lysates prepared from 9-week-old R6/2 HD and control WT mice ( n = 6 (3 males, 3 females)/group). Twist1 band intensity was quantified by densitometry (ImageJ) and normalized to that of GAPDH. Twist1 protein expression was increased in R6/2 compared with WT mice (unpaired t tests; *, p
    Figure Legend Snippet: Increased Twist1 gene expression in mouse models of HD. A , qRT-PCR analysis was performed using RNA prepared from 6-week-old R6/2 HD and control WT mouse forebrains ( n = 6 (3 males, 3 females)/group). β- actin and Hprt were used as reference genes. Twist1 RNA was up-regulated in R6/2 compared with WT mice (unpaired t tests; *, p = 0.0043). Egr3 and Bdnf (exon IX, protein coding) RNAs were down-regulated in R6/2 compared with WT mice (unpaired t tests; *, p = 0.0013 for Egr3 ; *, p = 0.022 for Bdnf ). B and C , qRT-PCR analysis was performed using RNA prepared from 33-week-old zQ175 heterozygous ( Het ), homozygous ( Homo ), and control WT mouse cortex ( B ) and striatum ( C ) ( n = 6 (3 males and 3 females) for zQ175 heterozygous and homozygous; n = 7 (4 males and 3 females) for WT). Twist1 RNA was up-regulated in the cortex and striatum of zQ175 mice compared with those of WT (ANOVA; *, p = 0.0001 in B ; *, p = 0.0007 in C ). Egr3 and Bdnf (exon IX, protein coding) RNAs were down-regulated in the cortex of zQ175 compared with WT mice (ANOVA; *, p = 0.042; #, p = 0.011 for Egr3 ; *, p = 0.047 for Bdnf ) ( B ). Drd2 mRNA was down-regulated in zQ175 striatum compared with WT control (ANOVA; *, p = 0.014) ( C ). A trend toward decreased expression of Ppp1r1b in zQ175 mice (zQ175 homozygous compared with WT; p = 0.063) ( C ). D , immunoblot analysis ( IB ) was performed using forebrain lysates prepared from 9-week-old R6/2 HD and control WT mice ( n = 6 (3 males, 3 females)/group). Twist1 band intensity was quantified by densitometry (ImageJ) and normalized to that of GAPDH. Twist1 protein expression was increased in R6/2 compared with WT mice (unpaired t tests; *, p

    Techniques Used: Expressing, Quantitative RT-PCR, Mouse Assay

    6) Product Images from "Transduction of Human Primitive Repopulating Hematopoietic Cells With Lentiviral Vectors Pseudotyped With Various Envelope Proteins"

    Article Title: Transduction of Human Primitive Repopulating Hematopoietic Cells With Lentiviral Vectors Pseudotyped With Various Envelope Proteins

    Journal: Molecular Therapy

    doi: 10.1038/mt.2010.48

    Genome concentrations and transducing titers of various pesudotypes on HeLa cells. ( a ) Comparison of the relative vector genome concentration, as determined by qRT-PCR of medium containing vector particles pseudotyped with various envelope proteins as
    Figure Legend Snippet: Genome concentrations and transducing titers of various pesudotypes on HeLa cells. ( a ) Comparison of the relative vector genome concentration, as determined by qRT-PCR of medium containing vector particles pseudotyped with various envelope proteins as

    Techniques Used: Plasmid Preparation, Concentration Assay, Quantitative RT-PCR

    7) Product Images from "Photoreceptor protection via blockade of BET epigenetic readers in a murine model of inherited retinal degeneration"

    Article Title: Photoreceptor protection via blockade of BET epigenetic readers in a murine model of inherited retinal degeneration

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-016-0775-4

    JQ1 pre-treatment inhibits N9 microglial cell inflammation, proliferation, and migration. N9 microglial cells were pre-incubated with vehicle (DMSO), JQ1 (0.5 μM), RVX208 (30 μM), or Olinone (30 μM) for 12 h followed by stimulation with LPS (1 μg/ml) for another 2 h, and then subjected to qRT-PCR ( a ) for determination of inflammatory cytokine expression. Proliferation assay ( b , BrdU ELISA) and migration assay ( c , Transwell) were performed after incubation for additional 24 h. Quantification: mean ± SEM; n = 3 experiments; * P
    Figure Legend Snippet: JQ1 pre-treatment inhibits N9 microglial cell inflammation, proliferation, and migration. N9 microglial cells were pre-incubated with vehicle (DMSO), JQ1 (0.5 μM), RVX208 (30 μM), or Olinone (30 μM) for 12 h followed by stimulation with LPS (1 μg/ml) for another 2 h, and then subjected to qRT-PCR ( a ) for determination of inflammatory cytokine expression. Proliferation assay ( b , BrdU ELISA) and migration assay ( c , Transwell) were performed after incubation for additional 24 h. Quantification: mean ± SEM; n = 3 experiments; * P

    Techniques Used: Migration, Incubation, Quantitative RT-PCR, Expressing, Proliferation Assay, Enzyme-linked Immunosorbent Assay

    BET2 knockdown in N9 microglial cells inhibits inflammatory cytokine expression. N9 cells were infected with lentivirus expressing BET2 or BET4 siRNAs for 3 days and then GFP-positive (infected) cells were purified by flow sorting and cultured for 2–3 days. The cells were either used for Western blotting or stimulated with LPS (1 μg/ml) for 2 h and then subjected to qRT-PCR. a , b Western blots showing BET protein knockdown. Quantification: mean ± SEM; n = 3 experiments; * P
    Figure Legend Snippet: BET2 knockdown in N9 microglial cells inhibits inflammatory cytokine expression. N9 cells were infected with lentivirus expressing BET2 or BET4 siRNAs for 3 days and then GFP-positive (infected) cells were purified by flow sorting and cultured for 2–3 days. The cells were either used for Western blotting or stimulated with LPS (1 μg/ml) for 2 h and then subjected to qRT-PCR. a , b Western blots showing BET protein knockdown. Quantification: mean ± SEM; n = 3 experiments; * P

    Techniques Used: Expressing, Infection, Purification, Flow Cytometry, Cell Culture, Western Blot, Quantitative RT-PCR

    JQ1 treatment inhibits microglial expression of inflammatory cytokines in the rd10 retina. Intravitreal injection of JQ1 (or vehicle) was performed at PN14, as described in Fig. 1 . Retinas were collected at PN24. a Homogenates were prepared from retinas (3 groups, total 12 mice) and used for qRT-PCR. Quantification: normalization to GAPDH mRNA; mean ± SEM; n = 3 independent homogenation/qRT-PCR experiments; * P
    Figure Legend Snippet: JQ1 treatment inhibits microglial expression of inflammatory cytokines in the rd10 retina. Intravitreal injection of JQ1 (or vehicle) was performed at PN14, as described in Fig. 1 . Retinas were collected at PN24. a Homogenates were prepared from retinas (3 groups, total 12 mice) and used for qRT-PCR. Quantification: normalization to GAPDH mRNA; mean ± SEM; n = 3 independent homogenation/qRT-PCR experiments; * P

    Techniques Used: Expressing, Injection, Mouse Assay, Quantitative RT-PCR

    8) Product Images from "MicroRNA-Mediated Transformation by the Kaposi's Sarcoma-Associated Herpesvirus Kaposin Locus"

    Article Title: MicroRNA-Mediated Transformation by the Kaposi's Sarcoma-Associated Herpesvirus Kaposin Locus

    Journal: Journal of Virology

    doi: 10.1128/JVI.03317-14

    Continued transgene expression is required to maintain transformed status. (A) Schematic outlining the experimental setup used for secondary focus formation assays. (B) TaqMan qRT-PCR confirms loss of miR-K10a/+1 expression after withdrawal (−)
    Figure Legend Snippet: Continued transgene expression is required to maintain transformed status. (A) Schematic outlining the experimental setup used for secondary focus formation assays. (B) TaqMan qRT-PCR confirms loss of miR-K10a/+1 expression after withdrawal (−)

    Techniques Used: Expressing, Transformation Assay, Quantitative RT-PCR

    Inhibition of KapA expression does not affect the transformed phenotype in WT-transformed NIH 3T3 cells. (A) Western blotting confirms reduction of KapA expression (Flag) in cells expressing a KapA-directed sh-miR (shKap). (B) TaqMan qRT-PCR shows that
    Figure Legend Snippet: Inhibition of KapA expression does not affect the transformed phenotype in WT-transformed NIH 3T3 cells. (A) Western blotting confirms reduction of KapA expression (Flag) in cells expressing a KapA-directed sh-miR (shKap). (B) TaqMan qRT-PCR shows that

    Techniques Used: Inhibition, Expressing, Transformation Assay, Western Blot, Quantitative RT-PCR

    9) Product Images from "A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients"

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients

    Journal: eLife

    doi: 10.7554/eLife.13073

    Transduction and RNAi efficiency of two human Nav1.1 lenti-shRNA clones. ( A ) Evaluating the transduction efficiency of the lentiviral particles were tested in HEK293T cells based on the expression of the tRFP reporter. Scale bars, 20 microns. ( B ) The RNAi efficiency of lenti-shRNA1 and lenti-shRNA2 relative to a non-silencing clone was determined by first transducing HEK293T cells with the lentiviral clones and next expressing the human Na v 1.1 cDNA via transfection. Na v 1.1 mRNAs were quantified with qRT-PCR. By ANOVA and post hoc Sidak’s multiple comparisons, p = 0.003 for the comparison between control and shRNA1; p = 0.002 for the comparison between control and shRNA2. DOI: http://dx.doi.org/10.7554/eLife.13073.034
    Figure Legend Snippet: Transduction and RNAi efficiency of two human Nav1.1 lenti-shRNA clones. ( A ) Evaluating the transduction efficiency of the lentiviral particles were tested in HEK293T cells based on the expression of the tRFP reporter. Scale bars, 20 microns. ( B ) The RNAi efficiency of lenti-shRNA1 and lenti-shRNA2 relative to a non-silencing clone was determined by first transducing HEK293T cells with the lentiviral clones and next expressing the human Na v 1.1 cDNA via transfection. Na v 1.1 mRNAs were quantified with qRT-PCR. By ANOVA and post hoc Sidak’s multiple comparisons, p = 0.003 for the comparison between control and shRNA1; p = 0.002 for the comparison between control and shRNA2. DOI: http://dx.doi.org/10.7554/eLife.13073.034

    Techniques Used: Transduction, shRNA, Clone Assay, Expressing, Transfection, Quantitative RT-PCR

    10) Product Images from "A Sendai Virus-Based Cytoplasmic RNA Vector as a Novel Platform for Long-Term Expression of MicroRNAs"

    Article Title: A Sendai Virus-Based Cytoplasmic RNA Vector as a Novel Platform for Long-Term Expression of MicroRNAs

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1016/j.omtm.2019.10.012

    SeVdp Vector-Mediated miRNA Expression (A) Genome structure of the SeVdp vectors. NP , P , and L genes are indispensable for the replication of the viral genome and mRNA synthesis. The P gene contains multiple open reading frames encoding P, C, and V proteins. The SeVdp genome encodes Bs r , EGFP, and murine miRNA as transgenes. (B) Expression of miR-124 in HCT116 cells infected with either SeVdp-Ctrl or SeVdp-124; miR-124 levels were determined by qRT-PCR; the level in SeVdp-Ctrl-infected cells was set to 1.0. **p
    Figure Legend Snippet: SeVdp Vector-Mediated miRNA Expression (A) Genome structure of the SeVdp vectors. NP , P , and L genes are indispensable for the replication of the viral genome and mRNA synthesis. The P gene contains multiple open reading frames encoding P, C, and V proteins. The SeVdp genome encodes Bs r , EGFP, and murine miRNA as transgenes. (B) Expression of miR-124 in HCT116 cells infected with either SeVdp-Ctrl or SeVdp-124; miR-124 levels were determined by qRT-PCR; the level in SeVdp-Ctrl-infected cells was set to 1.0. **p

    Techniques Used: Plasmid Preparation, Expressing, Infection, Quantitative RT-PCR

    The SeVdp Vector as a Platform for Expressing Functional miRNAs (A) miRNA expression in various human cells infected with SeVdp-Ctrl or SeVdp-124. miR-124 levels were determined by qRT-PCR; the level in SeVdp-Ctrl-infected cells was set to 1.0. **p
    Figure Legend Snippet: The SeVdp Vector as a Platform for Expressing Functional miRNAs (A) miRNA expression in various human cells infected with SeVdp-Ctrl or SeVdp-124. miR-124 levels were determined by qRT-PCR; the level in SeVdp-Ctrl-infected cells was set to 1.0. **p

    Techniques Used: Plasmid Preparation, Expressing, Functional Assay, Infection, Quantitative RT-PCR

    Related Articles

    Transduction:

    Article Title: Ex-vivo expansion of nonhuman primate CD34+ cells by stem cell factor Sall4B
    Article Snippet: Lentivirus titer was determined with the Lenti-X™ qRT-PCR Titration Kit (Clontech) according to the manufacturer’s instructions. .. The lentivirus was aliquoted and stored at –80 °C until use for transduction.

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech). .. Viral titers were optimized for transduction of MH-S cells to generate stable acat-1 -/- cells.

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments. .. Two different mouse embryonic stem cell clones (A03, H03) carrying targeted gene knockout alleles were received from EUCOMM international knockout mouse consortium.

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: Paragraph title: 2.4. Lentivirus Production and Transduction ... The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech).

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients
    Article Snippet: Paragraph title: Lentivirus preparation and neuronal transduction ... Viral supernatants were concentrated using Lenti-X Concentrator (Clontech, Mountain View, California) and viral titers were determined with a Lenti-X qRT-PCR Titration Kit (Clontech).

    Clone Assay:

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Oligonucleotides were synthesized (IDT, Coralville, IA, USA), annealed, and cloned into the lentiCRISPRv2 plasmid (a gift from Feng Zhang, Addgene # 52961, Cambridge, MA, USA) [ ], at the BsmBI restriction site to generate plentiCRISPRv2-acat-1 . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    Luciferase:

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. Infectivity of the pseudotype viruses was assessed by the expression of luciferase as determined by a Bright-Glo Luciferase assay system (Promega), following a protocol provided by the manufacturer and expressed in relative light units (RLU).

    Synthesized:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. We transfected 50 nM synthesized oligonucleotides into 293FT cells with FuGENE HD Transfection Reagent (Roche Diagnostics, Basel, Switzerland).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. We transfected 50 nM synthesized oligonucleotides into 293FT cells with FuGENE HD Transfection Reagent (Roche Diagnostics, Basel, Switzerland). pCDH/lenti/GFP-treated cells were used as controls.

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Oligonucleotides were synthesized (IDT, Coralville, IA, USA), annealed, and cloned into the lentiCRISPRv2 plasmid (a gift from Feng Zhang, Addgene # 52961, Cambridge, MA, USA) [ ], at the BsmBI restriction site to generate plentiCRISPRv2-acat-1 . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    Focus Forming Assay:

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: Infectivity of HCV was determined by focus-forming assay and expressed in focus-forming units (FFU) [ ]. .. The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA).

    Construct:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: Paragraph title: Lentiviral vector construct ... The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and trafficking
    Article Snippet: Briefly, 7.8 μg of PAC1R-SmBiT-pQM512B, β-arrestin1-LgBiT-pQM512B or LgBiT-β-arrestin2-pQM512B were transfected with 23.1 μg mixed shuttle constructs to Lenti-X 293T cells (Clontech, Mountain View, CA, USA) in 15 cm dishes using polyethylenimine (Polysciences, Warrington, PA, USA). .. The titer of the lentiviral vector solution was estimated by Lenti-X qRT-PCR Titration Kit (Clontech).

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: To knockout c-Myc and β-catenin in human cancer cell lines, we constructed gRNAs in LentiCRISPRv2 vector (addgene #52961 and #83480) as described previously and tested their knockout efficiency in MiaPaCa2 cells by western blot. .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: Paragraph title: Lentiviral vector construct ... The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Incubation:

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: We added the DNA-FuGENE complex directly to each dish and incubated the cells in a CO2 incubator at 37°C overnight. .. The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech).

    Cell Culture:

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: To investigate the HLF cells and hMSCs with miR-520d-5p expression, we harvested viral particles produced in the medium cultured 293FT cells, the cells were centrifuged at 170,000 x g (120 min, 4 °C). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Expressing:

    Article Title: Efficient Differentiation of Embryonic Stem Cells into Hepatic Cells In Vitro Using a Feeder-Free Basement Membrane Substratum
    Article Snippet: Gene silencing Expression arrest control shRNA (Open Biosystems, #RHS4080) or Itgb1 shRNA (Open Biosystems, #RMM3981-97055034) lentiviral vectors carrying puromycin-resistance genes were used for Itgb1 -knockdown assays. .. Titers of virus were determined using a Lenti-X-qRT-PCR titration kit (Clonetech).

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. Infectivity of the pseudotype viruses was assessed by the expression of luciferase as determined by a Bright-Glo Luciferase assay system (Promega), following a protocol provided by the manufacturer and expressed in relative light units (RLU).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: To investigate the HLF cells and hMSCs with miR-520d-5p expression, we harvested viral particles produced in the medium cultured 293FT cells, the cells were centrifuged at 170,000 x g (120 min, 4 °C). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Western Blot:

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: To knockout c-Myc and β-catenin in human cancer cell lines, we constructed gRNAs in LentiCRISPRv2 vector (addgene #52961 and #83480) as described previously and tested their knockout efficiency in MiaPaCa2 cells by western blot. .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Over Expression:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: Lentiviral vector construct To examine the effects of miR-520d-5p overexpression, we transfected pMIRNA1-miR-520d-5p/GFP (20 μg; System Biosciences, Mountain View, CA, USA) or the mock vector pCDH (20 μg) into 293FT and HLF cells (5 × 106 cells/10 cm culture dish). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: Lentiviral vector construct To examine the effects of miR-520d-5p overexpression, we transfected pMIRNA1-miR-520d-5p/GFP (20 μg; System Biosciences, Mountain View, CA, USA) or the mock vector pCDH (20 μg) into 293FT and HLF cells (5 × 106 cells/10 cm culture dish). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Derivative Assay:

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. The vesicular stomatitis virus (VSV) variant NCP12.1, derived from the Indiana strain, was provided by M. Whitt.

    Transfection:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: To investigate the effects of miR-520d-5p silencing, we transfected pRNATinH1.4/Lenti-520d-5p (20 μg; Genscript, Piscataway, NJ, USA) or the mock vector pRNATinH1.4/Lenti (20 μg) into HLF cells. .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and trafficking
    Article Snippet: Briefly, 7.8 μg of PAC1R-SmBiT-pQM512B, β-arrestin1-LgBiT-pQM512B or LgBiT-β-arrestin2-pQM512B were transfected with 23.1 μg mixed shuttle constructs to Lenti-X 293T cells (Clontech, Mountain View, CA, USA) in 15 cm dishes using polyethylenimine (Polysciences, Warrington, PA, USA). .. The titer of the lentiviral vector solution was estimated by Lenti-X qRT-PCR Titration Kit (Clontech).

    Article Title: Efficient Differentiation of Embryonic Stem Cells into Hepatic Cells In Vitro Using a Feeder-Free Basement Membrane Substratum
    Article Snippet: After overnight culture, the cells were transfected with lentiviral vectors and ViraPower Lentiviral Packaging Mix (Invitrogen) using FuGENE6 Transfection Reagent (Roche Diagnostics) for 24 hours, and viral supernatants were collected. .. Titers of virus were determined using a Lenti-X-qRT-PCR titration kit (Clonetech).

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: .. The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    Article Title: Ex-vivo expansion of nonhuman primate CD34+ cells by stem cell factor Sall4B
    Article Snippet: Sodium pyruvate and sodium butyrate that were added to the media after DNA transfection significantly improved the lentivirus yield. .. Lentivirus titer was determined with the Lenti-X™ qRT-PCR Titration Kit (Clontech) according to the manufacturer’s instructions.

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: Viruses pHH-JFH1-E2p7NS2mt was transfected into Huh7.5.1 cells, and the culture supernatants were collected after serial passages. .. The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: Lentiviral vector construct To examine the effects of miR-520d-5p overexpression, we transfected pMIRNA1-miR-520d-5p/GFP (20 μg; System Biosciences, Mountain View, CA, USA) or the mock vector pCDH (20 μg) into 293FT and HLF cells (5 × 106 cells/10 cm culture dish). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Lentiviral supernatant was collected 2 and 3 days after transfection, filtered through a 0.45 μm filter and concentrated with Lenti-X Concentrator (Clonetech, Heidelberg, Germany). .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments.

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients
    Article Snippet: A third group of lentiviruses encoding TRE-mCherry-T2A-Nav 1.1-F383S, TRE-mCherry-T2A-Nav 1.1-F383S-S1328P, or EF1α-rtTA were prepared by transfecting HEK293N cells and harvesting viral supernatants 36 hr after transfection. .. Viral supernatants were concentrated using Lenti-X Concentrator (Clontech, Mountain View, California) and viral titers were determined with a Lenti-X qRT-PCR Titration Kit (Clontech).

    Infection:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: To estimate HIV-1 RNA copy numbers, 1 × 105 MDMs were infected with NL-ADA, NL-ADA-R(−), NL-ADA-IN-D64A, or NL-ADA-IN-D64A-R(−) (20 ng p24) for 2 h, then washed with medium four times. .. HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: Selective targeting of KRAS oncogenic alleles by CRISPR/Cas9 inhibits proliferation of cancer cells
    Article Snippet: The lentiviral titrations were carried out using a Lenti-X™ qRT-PCR Titration Kit (Clontech, USA). .. For all lentiviruses used in this study, HEK293T cells were used as a standard to measure plaque forming unit (PFU), and were used to determine the multiplicity of infection as 1.

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech). .. We plated 2 × 104 of the target P1 hBMSCs per well in a 24-well plate 24 h prior to viral infection.

    Generated:

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. 520d-5p-transfected hMSCs were generated by the lentiviral transfection of 520d-5p to hMSCs after the differentiation induction from iPSCs to hMSCs using hPSC-Derived MSC differentiation system and reagents (Veritas Corporation, Tokyo, Japan).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    In Vivo:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments. .. Two different mouse embryonic stem cell clones (A03, H03) carrying targeted gene knockout alleles were received from EUCOMM international knockout mouse consortium.

    Isolation:

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech). .. Viral titers were optimized for transduction of MH-S cells to generate stable acat-1 -/- cells.

    Titration:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and trafficking
    Article Snippet: .. The titer of the lentiviral vector solution was estimated by Lenti-X qRT-PCR Titration Kit (Clontech). .. HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum.

    Article Title: Efficient Differentiation of Embryonic Stem Cells into Hepatic Cells In Vitro Using a Feeder-Free Basement Membrane Substratum
    Article Snippet: .. Titers of virus were determined using a Lenti-X-qRT-PCR titration kit (Clonetech). ..

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: .. The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    Article Title: Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency
    Article Snippet: .. Titration of lentivirus was determined through the use of the Lenti-X qRT-PCR Titration kit (Clontech). .. Lentivirus treatment An infrarenal aorto-caval AVF was created in WT mice as described above.

    Article Title: Ex-vivo expansion of nonhuman primate CD34+ cells by stem cell factor Sall4B
    Article Snippet: .. Lentivirus titer was determined with the Lenti-X™ qRT-PCR Titration Kit (Clontech) according to the manufacturer’s instructions. .. The lentivirus was aliquoted and stored at –80 °C until use for transduction.

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech). .. To generate stable pools, the cells infected with lentivirus containing scrambled gRNA, c-Myc gRNA, or β-catenin gRNA were selected with antibiotics (puromycin or blasticidin) for 5 days before pooling together and SB treatments.

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: .. The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. The vesicular stomatitis virus (VSV) variant NCP12.1, derived from the Indiana strain, was provided by M. Whitt.

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: .. HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa). ..

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech). .. Viral titers were optimized for transduction of MH-S cells to generate stable acat-1 -/- cells.

    Article Title: Selective targeting of KRAS oncogenic alleles by CRISPR/Cas9 inhibits proliferation of cancer cells
    Article Snippet: .. The lentiviral titrations were carried out using a Lenti-X™ qRT-PCR Titration Kit (Clontech, USA). .. For all lentiviruses used in this study, HEK293T cells were used as a standard to measure plaque forming unit (PFU), and were used to determine the multiplicity of infection as 1.

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments. .. Two different mouse embryonic stem cell clones (A03, H03) carrying targeted gene knockout alleles were received from EUCOMM international knockout mouse consortium.

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: .. The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech). .. We plated 2 × 104 of the target P1 hBMSCs per well in a 24-well plate 24 h prior to viral infection.

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients
    Article Snippet: .. Viral supernatants were concentrated using Lenti-X Concentrator (Clontech, Mountain View, California) and viral titers were determined with a Lenti-X qRT-PCR Titration Kit (Clontech). .. NgN2-mediated neural differentiation of hESC line H9 H9 hESCs with stably integrated doxycycline-inducible Ngn2 and the tet-transactivator were maintained in mTESR medium on matrigel.

    Sequencing:

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: The most efficient gRNA vector was selected for knocking out c-Myc (gRNA sequence: CTGCTCGCCCTCCTACGTTG) and β-catenin (gRNA sequence: TCCCACTAATGTCCAGCGTT) in all cell lines (see Table in the Supplementary Information). .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Generating acat-1 -/- MH-S cell line The guide RNA sequence 5′TCGCGTCTCCATGGCTGCCC3 ′ to mouse acat-1 was selected using the optimized CRISPR design site crispr.mit.edu . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    shRNA:

    Article Title: Efficient Differentiation of Embryonic Stem Cells into Hepatic Cells In Vitro Using a Feeder-Free Basement Membrane Substratum
    Article Snippet: Gene silencing Expression arrest control shRNA (Open Biosystems, #RHS4080) or Itgb1 shRNA (Open Biosystems, #RMM3981-97055034) lentiviral vectors carrying puromycin-resistance genes were used for Itgb1 -knockdown assays. .. Titers of virus were determined using a Lenti-X-qRT-PCR titration kit (Clonetech).

    Quantitative RT-PCR:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and trafficking
    Article Snippet: .. The titer of the lentiviral vector solution was estimated by Lenti-X qRT-PCR Titration Kit (Clontech). .. HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum.

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: .. The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech). .. Viral RNA was isolated from this supernatant (viral load = 115,000 copies/ml) and subjected to one-step RT-PCR and sequenced using the same protocol that was used to sequence patient samples.

    Article Title: Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency
    Article Snippet: .. Titration of lentivirus was determined through the use of the Lenti-X qRT-PCR Titration kit (Clontech). .. Lentivirus treatment An infrarenal aorto-caval AVF was created in WT mice as described above.

    Article Title: Ex-vivo expansion of nonhuman primate CD34+ cells by stem cell factor Sall4B
    Article Snippet: .. Lentivirus titer was determined with the Lenti-X™ qRT-PCR Titration Kit (Clontech) according to the manufacturer’s instructions. .. The lentivirus was aliquoted and stored at –80 °C until use for transduction.

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech). .. To generate stable pools, the cells infected with lentivirus containing scrambled gRNA, c-Myc gRNA, or β-catenin gRNA were selected with antibiotics (puromycin or blasticidin) for 5 days before pooling together and SB treatments.

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: .. The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. The vesicular stomatitis virus (VSV) variant NCP12.1, derived from the Indiana strain, was provided by M. Whitt.

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: .. HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa). ..

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). .. For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish.

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech). .. Viral titers were optimized for transduction of MH-S cells to generate stable acat-1 -/- cells.

    Article Title: Selective targeting of KRAS oncogenic alleles by CRISPR/Cas9 inhibits proliferation of cancer cells
    Article Snippet: .. The lentiviral titrations were carried out using a Lenti-X™ qRT-PCR Titration Kit (Clontech, USA). .. For all lentiviruses used in this study, HEK293T cells were used as a standard to measure plaque forming unit (PFU), and were used to determine the multiplicity of infection as 1.

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments. .. Two different mouse embryonic stem cell clones (A03, H03) carrying targeted gene knockout alleles were received from EUCOMM international knockout mouse consortium.

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: .. The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech). .. We plated 2 × 104 of the target P1 hBMSCs per well in a 24-well plate 24 h prior to viral infection.

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients
    Article Snippet: .. Viral supernatants were concentrated using Lenti-X Concentrator (Clontech, Mountain View, California) and viral titers were determined with a Lenti-X qRT-PCR Titration Kit (Clontech). .. NgN2-mediated neural differentiation of hESC line H9 H9 hESCs with stably integrated doxycycline-inducible Ngn2 and the tet-transactivator were maintained in mTESR medium on matrigel.

    Cotransfection:

    Article Title: Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency
    Article Snippet: After co-transfection, the cells remained in a 37 °C, 5% CO2 incubator for 48 hr. .. Titration of lentivirus was determined through the use of the Lenti-X qRT-PCR Titration kit (Clontech).

    CRISPR:

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Generating acat-1 -/- MH-S cell line The guide RNA sequence 5′TCGCGTCTCCATGGCTGCCC3 ′ to mouse acat-1 was selected using the optimized CRISPR design site crispr.mit.edu . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    IA:

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Oligonucleotides were synthesized (IDT, Coralville, IA, USA), annealed, and cloned into the lentiCRISPRv2 plasmid (a gift from Feng Zhang, Addgene # 52961, Cambridge, MA, USA) [ ], at the BsmBI restriction site to generate plentiCRISPRv2-acat-1 . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    Purification:

    Article Title: Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency
    Article Snippet: Paragraph title: Production and purification of lentivirus ... Titration of lentivirus was determined through the use of the Lenti-X qRT-PCR Titration kit (Clontech).

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: .. HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa). ..

    Plasmid Preparation:

    Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process
    Article Snippet: Paragraph title: Lentiviral vector construct ... The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and trafficking
    Article Snippet: .. The titer of the lentiviral vector solution was estimated by Lenti-X qRT-PCR Titration Kit (Clontech). .. HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum.

    Article Title: Cross-clade simultaneous HIV drug resistance genotyping for reverse transcriptase, protease, and integrase inhibitor mutations by Illumina MiSeq
    Article Snippet: To produce a clonal viral stock to assess error associated with our method, the pHXBnPLAP-IRES-N+ (HXBn) plasmid was transfected into 239 T packaging cells using the Xfect Transfection Reagent (Clontech). .. The supernatant was collected two days after transfection to limit virus production to a single round and the virus was quantitated using the Lenti-X qRT-PCR titration kit (Clontech).

    Article Title: Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency
    Article Snippet: Early passage HEK 293 T cells (ATCC) were co-transfected with WT-Eph-B4-HA-pLenti-III or Y774F-HA-Eph-B4-HA-pLenti-III, an envelope vector, pMD2.g, and packaging vector, psPAX2 (Addgene). .. Titration of lentivirus was determined through the use of the Lenti-X qRT-PCR Titration kit (Clontech).

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: Paragraph title: Vector constructions and lentivirus production ... Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: Paragraph title: Lentiviral vector construct ... The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Oligonucleotides were synthesized (IDT, Coralville, IA, USA), annealed, and cloned into the lentiCRISPRv2 plasmid (a gift from Feng Zhang, Addgene # 52961, Cambridge, MA, USA) [ ], at the BsmBI restriction site to generate plentiCRISPRv2-acat-1 . .. Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech).

    Article Title: Selective targeting of KRAS oncogenic alleles by CRISPR/Cas9 inhibits proliferation of cancer cells
    Article Snippet: One day after seeding, the cells were transfected in Gibco™ Opti-MEM™ I Reduced Serum Medium (Life Technologies, USA) using 1 μg of target lentiviral vector (empty lentiCRISPR v2 or lentiCRISPR v2 containing sgKRAS-WT, sgKRAS-G12V, or sgKRAS-G12D), 0.25 μg of pMD2.G (Addgene, USA), 0.75 μg of psPAX2 (Addgene, USA) and 7 μl of Lipofectamine™ 3000 (Life Technologies, USA). .. The lentiviral titrations were carried out using a Lenti-X™ qRT-PCR Titration Kit (Clontech, USA).

    Negative Control:

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: The scramble gRNA (GCACTACCAGAGCTAACTCA) was also inserted into LentiCRISPRv2 vector and served as negative control for all cell lines. .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa). .. To exclude a possibility that detected HIV RNA merely reflect the RNA from carry-over virion, fusion inhibitor ENF, dissolved in phosphate buffer saline PBS, was added from 0 hpi to harvest as a negative control.

    Selection:

    Article Title: Altering lipid droplet homeostasis affects Coxiella burnetii intracellular growth
    Article Snippet: Supernatant was concentrated using the Lenti-X concentrator (Catalog # PT4421-2, Clontech, USA) and viral RNA isolated using Viral RNA isolation kit (Catalog # 740956, Macherey-Nagel, Germany) to determine viral titer using Lenti-X qRT-PCR titration kit (Catalog # PT4006-2, Clontech). .. 1 µg/ml puromycin was used for selection 48 hours post-transduction and continued for 24 hours.

    In Vitro:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments. .. Two different mouse embryonic stem cell clones (A03, H03) carrying targeted gene knockout alleles were received from EUCOMM international knockout mouse consortium.

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: The concentrated supernatant containing lentiviral particles was used directly to determine the titer and to transduce target cells in vitro. .. The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech).

    Knock-Out:

    Article Title: GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors
    Article Snippet: To knockout c-Myc and β-catenin in human cancer cell lines, we constructed gRNAs in LentiCRISPRv2 vector (addgene #52961 and #83480) as described previously and tested their knockout efficiency in MiaPaCa2 cells by western blot. .. Viral RNA genome copies/mL were determined using Lenti-X™ qRT-PCR Titration Kit (TaKaRa/Clontech).

    Produced:

    Article Title: miR-520d-5p can reduce the mutations in hepatoma cancer cells and iPSCs-derivatives
    Article Snippet: To investigate the HLF cells and hMSCs with miR-520d-5p expression, we harvested viral particles produced in the medium cultured 293FT cells, the cells were centrifuged at 170,000 x g (120 min, 4 °C). .. The viral pellets were collected, and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA).

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Lentiviruses were produced using 293 T virus packaging cells upon transfection with a combination of 2nd Generation Packaging System Mix (Abmgood, Richmond, Canada), pLenti-dCas9-TET3CD-sgRNA ( RASAL1 , EYA1 , LRFN2 , KL , Rasal1 , and Kl ), and Lentifectin (Abmgood, Richmond, Canada) according to the manufacture’s protocol. .. Lentivirus titration was determined by the Lenti-X qRT-PCR Titration Kit (Clonetech, Heidelberg, Germany) and 8 μg/ml Polybrene (Sigma- Aldrich, Munich, Germany) was added to the viral solution for the in vivo and in vitro transduction experiments.

    Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients
    Article Snippet: Tests of transduction efficiency showed that the amount of viruses produced from 1 cm2 of 80% confluent HEK293T cells can be used to transduce 400,000 differentiating human neurons. .. Viral supernatants were concentrated using Lenti-X Concentrator (Clontech, Mountain View, California) and viral titers were determined with a Lenti-X qRT-PCR Titration Kit (Clontech).

    Concentration Assay:

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech). .. For each well, 0.5 mL of virus suspension was diluted in growth medium with polybrene at a final concentration of 4 μ g/mL.

    Low Protein Binding:

    Article Title: Dexamethasone Regulates EphA5, a Potential Inhibitory Factor with Osteogenic Capability of Human Bone Marrow Stromal Cells
    Article Snippet: Supernatants were collected 48 h after transfection, filtrated through 0.45 μ m polyethersulfone (PES) low-protein-binding filters (Whatman, NJ, USA), and concentrated 40 times by Lenti-X Concentrator (Clontech) according to the manufacturer's protocols. .. The titer of each batch of lentiviral vectors was assessed using the Lenti-X qRT-PCR titration kit (Clontech).

    Staining:

    Article Title: DNA damage enhances integration of HIV-1 into macrophages by overcoming integrase inhibition
    Article Snippet: Conditioned medium (100 μL) was added to 1 × 104 MAGIC5 cells [ ], and at 48 hpi, cells were stained by X-gal to estimate the number of transduced cells. .. HIV-1 RNA of conditioned medium was purified and subjected to RT-qPCR using the Lenti-X qRT-PCR Titration Kit (TaKaRa).

    Variant Assay:

    Article Title: Characterization of miR-122-independent propagation of HCV
    Article Snippet: The infectious titer of lentivirus was determined by a Lenti-X qRT-PCR Titration Kit (Clontech, Mountain View, CA). .. The vesicular stomatitis virus (VSV) variant NCP12.1, derived from the Indiana strain, was provided by M. Whitt.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa lenti x qrt pcr titration kit
    Lenti X Qrt Pcr Titration Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenti x qrt pcr titration kit/product/TaKaRa
    Average 90 stars, based on 104 article reviews
    Price from $9.99 to $1999.99
    lenti x qrt pcr titration kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results