la pcr genome dna set  (TaKaRa)

Journal: bioRxiv

Article Title: Heteroplasmy variability in individuals with biparentally inherited mitochondrial DNA

doi: 10.1101/2020.02.26.939405

Figure Lengend Snippet: Tissue-related variation in heteroplasmy levels for maternal (H1a1) and paternal (R0a1) haplogroups in Patient II-4 of Family A. ( A ) Pedigree of Family A. The black-filled symbols indicate the four family members (II-1, II-3, II-4, and III-6) that show biparental mtDNA transmission. The diagonal-filled symbols indicate the three family members (IV-1, IV-2, and IV-3) who carry a high number and level of mtDNA heteroplasmies which underwent normal maternal transmission. ( B ) Variable heteroplasmy levels detected by PCR-NGS in blood, saliva, hair follicle (HF), urine, sperm, and fibroblast (FB) samples collected from Patient II-4. ( C ) Heteroplasmy drift over time increases the proportion of the paternal haplogroup in primary fibroblast cells derived from Patient II-4. ( D, E ) Single cell-derived DNA samples from Patient II-4 were sequenced to measure cell-to-cell variability in heteroplasmy levels. Sanger sequencing for single-sperm samples ( D ) and PCR-NGS for colonies derived from individual primary fibroblast cells ( E ) show marked differences in heteroplasmy levels, even for cells derived from the same tissue.

Article Snippet: For Method 2 (used for Family E), the forward and reverse primers used for long-range PCR included: mt16426F (CCGCACAAGAGTGCTACTCTCCTC) and mt16425R (GATATTGATTTCACGGAGGATGGTG).

Techniques: Transmission Assay, Polymerase Chain Reaction, Next-Generation Sequencing, Derivative Assay, Sequencing

Journal: Nature Communications

Article Title: PICH promotes sister chromatid disjunction and co-operates with topoisomerase II in mitosis

doi: 10.1038/ncomms9962

Figure Lengend Snippet: Generation and validation of PICH −/− cells. ( a ) Conservation of the chicken and human PICH proteins. The defined domains, designated TPR, SNF2, HELICc and PFD, are abbreviations for Tetratricopeptide repeat, sucrose non-fermenting, helicase superfamily c-terminal domain and PICH family domain, respectively. Conservation is defined as the % of amino-acid positions that are identical or from the same functional group, and is depicted as a series of peaks aligned along the PICH sequence. Data were extracted from the NCBI database. ( b ) The PICH gene targeting strategy at the chicken PICH locus. The black boxes represent the PICH exons and the PICH homology regions flanking the Bsr or Puro resistance genes in the targeting vectors. Positions of the 5′ and 3′ validation Southern blotting probes are shown in pink. The size and position of probed DNA that would be expected in an unmodified or a targeted PICH locus after digestion with Spe I (blue) or Bam HI (orange) are shown. ( c ) Southern blots probing the 5′ end and 3′ end of PICH to confirm insertion of the Puro and Bsr genes in genomic DNA digested with either Spe 1 or Bam H1. ( d ) Positions of positive (1–2) and negative (3–4) control primers at the Gd PICH locus. ( e ) The gene knockout was validated by PCR with primer sets 1–4 on isolated genomic DNA from cells of the indicated genotypes.

Article Snippet: The 5′ arm of the targeting vectors was amplified with SH-chPICH-10 and SH-chPICH-33 from DT-40 genomic DNA using a LA-PCR set (Takara).

Techniques: Functional Assay, Sequencing, Southern Blot, Gene Knockout, Polymerase Chain Reaction, Isolation

Journal: Molecular Genetics & Genomic Medicine

Article Title: Spinal muscular atrophy caused by a novel Alu‐mediated deletion of exons 2a‐5 in SMN1 undetectable with routine genetic testing, et al. Spinal muscular atrophy caused by a novel Alu‐mediated deletion of exons 2a‐5 in SMN1 undetectable with routine genetic testing

doi: 10.1002/mgg3.1238

Figure Lengend Snippet: Identification of SMN1 variants. (a) qPCR analysis of four retrotransposon‐free SMN genomic regions in the intron 1 (I1), in the exon 3–intron 3 junction (E3I3), in the intron 5–exon 6 junction (I5E6), and ~1 kb downstream from exon 8 (+1 kb). Compared with four copies of SMN genes that are present in controls, we found that the patient has three copies at the I1, I5E6, and +1 kb loci and two copies at the E3I3 loci. The mother has three copies through the I1 to I5E6 loci and two copies at the +1 kb loci. The father has three copies only at the I5E6 loci. (b) Schematic representation of SMN1/2 exon (E)/intron (I) structure. Positions of sequence differences between SMN1 and SMN2 are represented by black vertical bars. The black triangles denote sequence‐specific variants in exons 7, 8 targeted by MLPA probes in routine testing. Locations of Alus in the breakpoint candidate regions in the intron 1 and 5, including the causal AluSp in the intron 1 and AluSq in the intron 5 indicated by vertical text, and primers binding sites for Alu PCR indicated by black arrowheads are shown below the scheme of the SMN structure. Position of the PCR4 spanning exons 5–8 that showed absence of SMN1 sequence‐specific variants indicating disruption of both SMN1 alleles in the patient is represented by yellow box. Range of the paternal deletion of exons 2a‐5 is represented by red box. (c) DNA sequence trace of the Alu PCR, Alu_259_4A, showing a double sequence caused by presence of AluSq wt in intron 5 together with a sequence originating from the intron 1 AluSp . Red arrows indicate the addition of AluSp ‐specific sequence in an Alu PCR product. (d) PCR genotyping of the SMN1Δ(2a‐5) variant showed presence of the deletion‐spanning amplification product in the patient (P) and father (F), but not in mother (M) and control (C). (e) DNA sequence trace of the breakpoint junction‐specific PCR and detail of the Δ2a‐5 breakpoint junction show the new Alu ‐ Alu chimeric element originating from the recombination between the AluSp in the intron 1 and AluSq in the intron 5. A breakpoint microhomology of the AluSp and AluSq is marked with a black box. (f) Schematic representation of SMN1 and SMN2 in the family members. Pink‐marked boxes represent maternal alleles (M) and blue boxes paternal alleles (F). The red crosses denote identified deletions and the dashed vertical lines denote loci of the qPCR (I1, E3I3, I5E6, and +1 kb) and MLPA (exon 7‐E7, exon 8‐E8) probes used for deletion mapping. The black junctions on the box terminals indicate a cis configuration of SMN1 and SMN2 alleles. The model shows (a) a whole deletion of one SMN1 allele in the patient (P) inherited from her mother and detected by the combination of the qPCR and MLPA; (b) a deletion of the second SMN1 allele in the patient inherited from her father and detected by the E3I3 qPCR and transcript analysis (Figure 1a ); and (c) deletion of one copy of one SMN2 allele in the mother detected by the MLPA and the + 1kb qPCR

Article Snippet: 2.6 Long‐range PCR Long‐range PCR was performed using four primer pairs amplifying both SMN genes (NG_008691.1, NG_008728.1) in four overlapping PCR products (PCR1‐PCR4, Table ).

Techniques: Real-time Polymerase Chain Reaction, Sequencing, Multiplex Ligation-dependent Probe Amplification, Binding Assay, Polymerase Chain Reaction, Variant Assay, Amplification