l aspartic acid  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Millipore l aspartic acid
    L Aspartic Acid, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l aspartic acid/product/Millipore
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    l aspartic acid - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rapid generation of long tandem DNA repeat arrays by homologous recombination in yeast to study their function in mammalian genomes
    Article Snippet: Reagents A highly transformable Saccharomyces cerevisiae strain VL6-48 (MAT alpha, his3-D 200, trp1-D1, ura3-52, lys2, ade2-101, met14, psi+cir 0 ) that has HIS3 and TRP1 deleted is used as a host for recombinational cloning experiments. .. MegaX DH10B™ T1R Electrocomp™ Cells (Invitrogen, cat. no. C6400-03) Bacto yeast extract (Fisher Scientific Ltd., cat. no. DF0886-17-0) Bacto peptone (Fisher Scientific Ltd., cat. no. DF0118-17-0) Bacto tryptone (Fisher Scientific Ltd., cat. no. DF0123-07-5) Bacto Agar (Fisher Scientific Ltd., cat. no. DF0145-17-0) D-Glucose (Sigma Chemical Co. Ltd., cat. no. G5250-1 KG) Yeast Nitrogen Base w/o Amino Acids (BD-Diagnostic Systems, cat. no. 291920) Adenine hemisulfate (Sigma-Aldrich, cat. no. A-3159) Uracil (Sigma-Aldrich, cat. no U075) L-Arginine-HCl (Sigma-Aldrich, cat. no. A4881) L-Aspartic acid (Sigma-Aldrich, cat. no. A93100) L-Glutamic acid (Sigma-Aldrich, cat. no. 128430) L-Histidine-HCl (Sigma-Aldrich, cat. no. 1515668) L-Isoleucine (Sigma-Aldrich, cat. no. 151718) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine-HCl (Sigma-Aldrich, cat. no. L5501) L-Methionine (Sigma-Aldrich, cat. no. M9625) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Serine (Sigma-Aldrich, cat. no S4500) L-Threonine (Sigma-Aldrich, cat. no T8625) L-Tryptophan (Sigma-Aldrich, cat. no T0254) L-Tyrosine (Sigma-Aldrich, cat. no T3754) L-Valine (Sigma-Aldrich, cat. no V0500) Yeast drop-out supplements for synthetic medium lacking histidine (Sigma-Aldrich, cat. no. Y-1751-20G) SORB-His plates, SD-His plates, and TOP agar-His (Teknova, Inc.) ( http://www.teknova.com ) Sorbitol (Sigma-Aldrich, cat. no. S1876-5 KG) Polyethylene glycol 8000 (PEG) (Sigma-Aldrich, cat. no. 89510-1 KG-F) 14 M beta-mercaptoethanol (ME) (Sigma-Aldrich, cat. no. M3148-100 ML) CAUTION It is highly toxic on contact with skin and is harmful if inhaled or swallowed.

    Amplification:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Proton NMR:

    Article Title: Polyaspartamide Vesicle induced by Metallic Nanoparticles
    Article Snippet: Briefly, L-aspartic acid (0.188 mol; Sigma Aldrich) and phosphoric acid (9.4 mmol; Fisher Scientific) were refluxed in a solvent consisting of mesitylene and sulfolane at a mass ratio of 7:3, while purging N2 . .. The molecular structure of the product was confirmed by 1 H-NMR analysis.

    Synthesized:

    Article Title: Polyaspartamide Vesicle induced by Metallic Nanoparticles
    Article Snippet: Polysuccinimide (PSI) was synthesized by acid-catalyzed polycondensation of aspartic acid. .. Briefly, L-aspartic acid (0.188 mol; Sigma Aldrich) and phosphoric acid (9.4 mmol; Fisher Scientific) were refluxed in a solvent consisting of mesitylene and sulfolane at a mass ratio of 7:3, while purging N2 .

    Blocking Assay:

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. Adsorption of taurine antiserum with Asp-G-BSA or Glu-G-BSA did not block staining with the secondary antibody.

    Article Title: Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy
    Article Snippet: Paragraph title: 2.4. Preparation of cultured cells for serial block face scanning electron microscopy ... First, prepare an aspartic acid stock solution by dissolving 0.998 g of L-aspartic acid (Sigma-Aldrich) in 250 ml of ddH2 O. (Note: the aspartic acid will dissolve more quickly if the pH is raised to 3.8.

    Article Title: Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa
    Article Snippet: .. The spectral—sensitivity and intensity—response functions of zebrafish cones were isolated by blocking photoreceptor synapses using 20 mM L-aspartic acid (Sigma-Aldrich), which eliminates signals from inner retinal neurons [ ]. .. To isolate the b2 response of ON-bipolar cells post-synaptic to zebrafish cones [ ], the MEM perfusate contained 50μm CNQX (Tocris), which blocks cone AMPA/kainate synapses onto hyperpolarizing OFF-bipolar cells.

    Adsorption:

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. After adsorption of taurine antiserum with Tau-G-BSA (10-4 M, concentration with respect to the amino acid) there was no labeling after secondary antibody treatment.

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Incubation:

    Article Title: Differentiation but not ALS mutations in FUS rewires motor neuron metabolism
    Article Snippet: .. The next day, cells were incubated en bloc with Walton’s lead aspartate (0.02 M lead nitrate (Electron Microscopy Services #17900) in 0.03 M sodium aspartate (Sigma #11189), pH 5.5)) for 30 min at 60 °C in dark. ..

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Sections were incubated overnight with aspartate antiserum (1:500) or taurine antiserum (1:500) at 20°C. .. Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA).

    Article Title: Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy
    Article Snippet: At the end of the first osmium tetroxide incubation described in step 1 (before adding the TCH), wash cells with ddH2 O at room temperature 5 x 2 minutes. .. First, prepare an aspartic acid stock solution by dissolving 0.998 g of L-aspartic acid (Sigma-Aldrich) in 250 ml of ddH2 O. (Note: the aspartic acid will dissolve more quickly if the pH is raised to 3.8.

    Article Title: Brain activity regulates loose coupling between mitochondrial and cytosolic Ca2+ transients
    Article Snippet: .. On the third day, the M1 cortex samples were washed with ddH2 O at RT and then incubated in the lead aspartate solution, which contains 0.033 g lead nitrate (Sigma) in 5 ml 0.03 M aspartic acid (Sigma, pH 5.0), at 50 °C for 2 h. The brain sections were dehydrated through a graded ethanol series (50%, 70%, 80%, 90%, 100%, 10 min each) and pure acetone. ..

    Modification:

    Article Title: Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa
    Article Snippet: ERG responses were recorded in-vitro from perfused larval eyes using modified patch electrodes (3 μm tip) inserted through the cornea into the ocular vitreous. .. The spectral—sensitivity and intensity—response functions of zebrafish cones were isolated by blocking photoreceptor synapses using 20 mM L-aspartic acid (Sigma-Aldrich), which eliminates signals from inner retinal neurons [ ].

    Crystallization Assay:

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: Paragraph title: Crystallization, X-ray Data Collection, and Refinement ... Prior to data collection, crystals were soaked for 5 min in 0.1 M HEPES, pH 7.5 and 24% of PEG MME 2000 solution containing either 10 mM l -aspartic acid (Sigma A6683) or 5 mM l -glutamic acid (Sigma 128420).

    Electron Microscopy:

    Article Title: Differentiation but not ALS mutations in FUS rewires motor neuron metabolism
    Article Snippet: .. The next day, cells were incubated en bloc with Walton’s lead aspartate (0.02 M lead nitrate (Electron Microscopy Services #17900) in 0.03 M sodium aspartate (Sigma #11189), pH 5.5)) for 30 min at 60 °C in dark. ..

    Article Title: Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy
    Article Snippet: Paragraph title: 2.4. Preparation of cultured cells for serial block face scanning electron microscopy ... First, prepare an aspartic acid stock solution by dissolving 0.998 g of L-aspartic acid (Sigma-Aldrich) in 250 ml of ddH2 O. (Note: the aspartic acid will dissolve more quickly if the pH is raised to 3.8.

    Article Title: Brain activity regulates loose coupling between mitochondrial and cytosolic Ca2+ transients
    Article Snippet: Paragraph title: Electron microscopy (EM) sample preparation ... On the third day, the M1 cortex samples were washed with ddH2 O at RT and then incubated in the lead aspartate solution, which contains 0.033 g lead nitrate (Sigma) in 5 ml 0.03 M aspartic acid (Sigma, pH 5.0), at 50 °C for 2 h. The brain sections were dehydrated through a graded ethanol series (50%, 70%, 80%, 90%, 100%, 10 min each) and pure acetone.

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Immunolabeling:

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: .. Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. After adsorption of taurine antiserum with Tau-G-BSA (10-4 M, concentration with respect to the amino acid) there was no labeling after secondary antibody treatment.

    Cell Culture:

    Article Title: Plasma Membrane Factor XIIIA Transglutaminase Activity Regulates Osteoblast Matrix Secretion and Deposition by Affecting Microtubule Dynamics
    Article Snippet: Paragraph title: Cell culture and treatments ... Medium was supplemented with 10% fetal Bovine Serum (FBS) (PAA Laboratories Inc; Canada), 1% Penicillin-Streptomycin (Invitrogen), 1% L-Glutamine (Invitrogen), and 0.225 mM L-Aspartic acid (Sigma).

    Article Title: Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy
    Article Snippet: Paragraph title: 2.4. Preparation of cultured cells for serial block face scanning electron microscopy ... First, prepare an aspartic acid stock solution by dissolving 0.998 g of L-aspartic acid (Sigma-Aldrich) in 250 ml of ddH2 O. (Note: the aspartic acid will dissolve more quickly if the pH is raised to 3.8.

    Generated:

    Article Title: Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa
    Article Snippet: Zebrafish electroretinograms (ERG) are the sum of light evoked extracellular field potentials generated by the aggregate of retinal cells, summing the extracellular limbs of current loops set in motion by light stimulation of all retinal cells. .. The spectral—sensitivity and intensity—response functions of zebrafish cones were isolated by blocking photoreceptor synapses using 20 mM L-aspartic acid (Sigma-Aldrich), which eliminates signals from inner retinal neurons [ ].

    Article Title: Polyaspartamide Vesicle induced by Metallic Nanoparticles
    Article Snippet: Briefly, L-aspartic acid (0.188 mol; Sigma Aldrich) and phosphoric acid (9.4 mmol; Fisher Scientific) were refluxed in a solvent consisting of mesitylene and sulfolane at a mass ratio of 7:3, while purging N2 . .. Water generated during the reaction was continuously removed using a Dean-stark trap with a reflux condenser.

    Transmission Assay:

    Article Title: Differentiation but not ALS mutations in FUS rewires motor neuron metabolism
    Article Snippet: Paragraph title: Transmission electron microscopy ... The next day, cells were incubated en bloc with Walton’s lead aspartate (0.02 M lead nitrate (Electron Microscopy Services #17900) in 0.03 M sodium aspartate (Sigma #11189), pH 5.5)) for 30 min at 60 °C in dark.

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Immunostaining:

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. Aspartate immunostaining was undiminished after incubation of the antiserum with Tau-G-BSA (10-4 M), and Glu-G-BSA (10-4 ), whereas adsorption of aspartate antiserum with 10-4 M Asp-G-BSA abolished immunostaining.

    Immunofluorescence:

    Article Title: Plasma Membrane Factor XIIIA Transglutaminase Activity Regulates Osteoblast Matrix Secretion and Deposition by Affecting Microtubule Dynamics
    Article Snippet: Cell culture and treatments MC3T3-E1 pre-osteoblast cells (subclone 14) (a generous gift from Dr. Renny T. Franceschi from the University of Michigan, School of Dentistry) were plated at an initial density of 50,000 cells/cm2 for all experiments, except for immunofluorescence microscopy (IFM) where the initial density was 25,000 cells/cm2 . .. Medium was supplemented with 10% fetal Bovine Serum (FBS) (PAA Laboratories Inc; Canada), 1% Penicillin-Streptomycin (Invitrogen), 1% L-Glutamine (Invitrogen), and 0.225 mM L-Aspartic acid (Sigma).

    In Vivo:

    Article Title: High Resolution NMR Spectroscopy of Rat Brain In Vivo Through Indirect Zero-Quantum-Coherence Detection
    Article Snippet: .. All in vitro experiments were performed on a 18 mm diameter glass sphere filled with 100 mM aspartic acid (Sigma-Aldrich, St. Louis, MO) in water (pH = 7.1) at ambient temperature (circa 16 °C). shows the NMR pulse sequence used in all in vitro and in vivo experiments, as well as all simulations. ..

    Isolation:

    Article Title: Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa
    Article Snippet: .. The spectral—sensitivity and intensity—response functions of zebrafish cones were isolated by blocking photoreceptor synapses using 20 mM L-aspartic acid (Sigma-Aldrich), which eliminates signals from inner retinal neurons [ ]. .. To isolate the b2 response of ON-bipolar cells post-synaptic to zebrafish cones [ ], the MEM perfusate contained 50μm CNQX (Tocris), which blocks cone AMPA/kainate synapses onto hyperpolarizing OFF-bipolar cells.

    Reflux:

    Article Title: Polyaspartamide Vesicle induced by Metallic Nanoparticles
    Article Snippet: Briefly, L-aspartic acid (0.188 mol; Sigma Aldrich) and phosphoric acid (9.4 mmol; Fisher Scientific) were refluxed in a solvent consisting of mesitylene and sulfolane at a mass ratio of 7:3, while purging N2 . .. Water generated during the reaction was continuously removed using a Dean-stark trap with a reflux condenser.

    Labeling:

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. After adsorption of taurine antiserum with Tau-G-BSA (10-4 M, concentration with respect to the amino acid) there was no labeling after secondary antibody treatment.

    Purification:

    Article Title: Atomically isolated nickel species anchored on graphitized carbon for efficient hydrogen evolution electrocatalysis
    Article Snippet: Chemicals Nickel (II) carbonate basic hydrate (48–50% Ni, Fluka), L-aspartic acid (98%, Sigma-Aldrich), 4,4′-bipyridyl (98%, Alfa Aesar), Nafion-117 solution (5 wt. .. % in a mixture of lower aliphatic alcohols and water) (Sigma-Aldrich), sulphuric acid (98%, Merck) and HCl (32%, RCI labscan) were used as received without any further purification.

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: High Resolution NMR Spectroscopy of Rat Brain In Vivo Through Indirect Zero-Quantum-Coherence Detection
    Article Snippet: .. All in vitro experiments were performed on a 18 mm diameter glass sphere filled with 100 mM aspartic acid (Sigma-Aldrich, St. Louis, MO) in water (pH = 7.1) at ambient temperature (circa 16 °C). shows the NMR pulse sequence used in all in vitro and in vivo experiments, as well as all simulations. ..

    Microscopy:

    Article Title: Plasma Membrane Factor XIIIA Transglutaminase Activity Regulates Osteoblast Matrix Secretion and Deposition by Affecting Microtubule Dynamics
    Article Snippet: Cell culture and treatments MC3T3-E1 pre-osteoblast cells (subclone 14) (a generous gift from Dr. Renny T. Franceschi from the University of Michigan, School of Dentistry) were plated at an initial density of 50,000 cells/cm2 for all experiments, except for immunofluorescence microscopy (IFM) where the initial density was 25,000 cells/cm2 . .. Medium was supplemented with 10% fetal Bovine Serum (FBS) (PAA Laboratories Inc; Canada), 1% Penicillin-Streptomycin (Invitrogen), 1% L-Glutamine (Invitrogen), and 0.225 mM L-Aspartic acid (Sigma).

    Article Title: Differentiation but not ALS mutations in FUS rewires motor neuron metabolism
    Article Snippet: The next day, cells were incubated en bloc with Walton’s lead aspartate (0.02 M lead nitrate (Electron Microscopy Services #17900) in 0.03 M sodium aspartate (Sigma #11189), pH 5.5)) for 30 min at 60 °C in dark. .. Once the BEEM-capsules were removed, blocks were trimmed and 70 nm sections cutted using a Leica Ultracut S. Sections were collected on slot grids and imaged with a JEOL JEM-1400 Transmission Electron Microscope operated at 80 kV at ×10.000 magnification.

    Mouse Assay:

    Article Title: Brain activity regulates loose coupling between mitochondrial and cytosolic Ca2+ transients
    Article Snippet: Briefly, deeply anesthetized mice were perfused with 0.9% saline, followed by 4% paraformaldehyde (PFA, Sigma) and 2.5% glutaraldehyde (GA, Sigma) in PBS. .. On the third day, the M1 cortex samples were washed with ddH2 O at RT and then incubated in the lead aspartate solution, which contains 0.033 g lead nitrate (Sigma) in 5 ml 0.03 M aspartic acid (Sigma, pH 5.0), at 50 °C for 2 h. The brain sections were dehydrated through a graded ethanol series (50%, 70%, 80%, 90%, 100%, 10 min each) and pure acetone.

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Sample Prep:

    Article Title: Brain activity regulates loose coupling between mitochondrial and cytosolic Ca2+ transients
    Article Snippet: Paragraph title: Electron microscopy (EM) sample preparation ... On the third day, the M1 cortex samples were washed with ddH2 O at RT and then incubated in the lead aspartate solution, which contains 0.033 g lead nitrate (Sigma) in 5 ml 0.03 M aspartic acid (Sigma, pH 5.0), at 50 °C for 2 h. The brain sections were dehydrated through a graded ethanol series (50%, 70%, 80%, 90%, 100%, 10 min each) and pure acetone.

    In Vitro:

    Article Title: Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa
    Article Snippet: ERG responses were recorded in-vitro from perfused larval eyes using modified patch electrodes (3 μm tip) inserted through the cornea into the ocular vitreous. .. The spectral—sensitivity and intensity—response functions of zebrafish cones were isolated by blocking photoreceptor synapses using 20 mM L-aspartic acid (Sigma-Aldrich), which eliminates signals from inner retinal neurons [ ].

    Article Title: High Resolution NMR Spectroscopy of Rat Brain In Vivo Through Indirect Zero-Quantum-Coherence Detection
    Article Snippet: .. All in vitro experiments were performed on a 18 mm diameter glass sphere filled with 100 mM aspartic acid (Sigma-Aldrich, St. Louis, MO) in water (pH = 7.1) at ambient temperature (circa 16 °C). shows the NMR pulse sequence used in all in vitro and in vivo experiments, as well as all simulations. ..

    Nuclear Magnetic Resonance:

    Article Title: High Resolution NMR Spectroscopy of Rat Brain In Vivo Through Indirect Zero-Quantum-Coherence Detection
    Article Snippet: .. All in vitro experiments were performed on a 18 mm diameter glass sphere filled with 100 mM aspartic acid (Sigma-Aldrich, St. Louis, MO) in water (pH = 7.1) at ambient temperature (circa 16 °C). shows the NMR pulse sequence used in all in vitro and in vivo experiments, as well as all simulations. ..

    Concentration Assay:

    Article Title: Perfluorosulfonic Acid Membranes Thermally Treated and Modified by Dopants with Proton-Acceptor Properties for Asparaginate and Potassium Ions Determination in Pharmaceuticals
    Article Snippet: .. Materials and Reagents Used MF-4SC (Plastpolymer, St. Petersburg, Russia, dry membrane thickness ~140 μm, ion-exchange capacity (IEC) was 1 mmol/g, equivalent weight was 1200) and Nafion 115 (Aldrich, St. Louis, MO, USA, dry membrane thickness was 130–140 μm, IEC ~0.95 mmol/g, equivalent weight was 1100) membranes obtained by extrusion; a solution of perfluorosulfonic acid polymer in the H+ -form in isopropyl alcohol (MF-4SC, Plastpolymer, St. Petersburg, Russia, concentration was 10.0 wt.%, IEC was ~0.95 mmol/g, equivalent weight was 1100); 3-aminopropyltrimethoxysilane (Fluka, 98%, Buchs, Switzerland); 3-(2-imidazolin-1-yl)propyltriethoxysilane (Fluka, 98%, Buchs, Switzerland); aqueous ammonia (Himmed, > 99%, Moscow, Russia); hydrochloric acid (Himmed, > 99%, Moscow, Russia); sodium chloride (Himmed, > 99%, Moscow, Russia); potassium hydroxide (Ecohim, standard-titer, Moscow, Russia); aspartic acid (2-aminobutanedioic acid, Sigma-Aldrich, > 99%, St. Louis, MO, USA); Panangin® (Gedeon Richter, Budapest, Hungary, concentrate for preparation of infusion solution); deionized water (resistance was 18.2 MΩ). ..

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. After adsorption of taurine antiserum with Tau-G-BSA (10-4 M, concentration with respect to the amino acid) there was no labeling after secondary antibody treatment.

    Staining:

    Article Title: Differentiation but not ALS mutations in FUS rewires motor neuron metabolism
    Article Snippet: Next, cells were stained with 1% osmium tetroxide (Electron Microscopy Services #19152) with 1.5% potassium ferrocyanide (Sigma #455989) in ddH2 O for 60 min, subsequently with 0.2% tannic acid (Electron Microscopy Services #21700)) in ddH2 O for 30 min and with 1% osmium tetroxide in ddH2 O for 30 min, followed by overnight incubation in 0.5% uranyl acetate in 25% methanol at 4 °C. .. The next day, cells were incubated en bloc with Walton’s lead aspartate (0.02 M lead nitrate (Electron Microscopy Services #17900) in 0.03 M sodium aspartate (Sigma #11189), pH 5.5)) for 30 min at 60 °C in dark.

    Article Title: Ground plan of the insect mushroom body: functional and evolutionary implications
    Article Snippet: Specificity of immunolabeling was controlled as described by Geffard et al. (1984): taurine (Sigma, T9931), L-aspartic acid (Sigma, A-8949), and L-glutamic acid (Sigma, G-6904) were each conjugated to bovine serum albumin (BSA) by glutaraldehyde (Tau-G-BSA, Asp-G-BSA, Glu-G-BSA). .. Adsorption of taurine antiserum with Asp-G-BSA or Glu-G-BSA did not block staining with the secondary antibody.

    Article Title: Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy
    Article Snippet: The next day, perform en bloc Walton’s lead aspartate staining. .. First, prepare an aspartic acid stock solution by dissolving 0.998 g of L-aspartic acid (Sigma-Aldrich) in 250 ml of ddH2 O. (Note: the aspartic acid will dissolve more quickly if the pH is raised to 3.8.

    Article Title: Brain activity regulates loose coupling between mitochondrial and cytosolic Ca2+ transients
    Article Snippet: The M1 cortex region was dissected and post-fixed in 2% OsO4 (Ted Pella) in 0.15 M sodium cacodylate (Biolink) buffer at room temperature (RT, 22–25 °C) for 90 min. Then the staining buffer was replaced by 2.5% ferrocyanide (Sigma) in 0.15 M sodium cacodylate buffer (pH 7.4) at RT for 1.5 h. The M1 cortex samples were washed with 0.15 M sodium cacodylate buffer and then incubated with filtered thiocarbohydrazide (TCH, Sigma) at 40 °C for 45 min, 2% OsO4 at RT for 1.5 h, and 1% uranyl acetate (Merck) aqueous solution at 4 °C overnight. .. On the third day, the M1 cortex samples were washed with ddH2 O at RT and then incubated in the lead aspartate solution, which contains 0.033 g lead nitrate (Sigma) in 5 ml 0.03 M aspartic acid (Sigma, pH 5.0), at 50 °C for 2 h. The brain sections were dehydrated through a graded ethanol series (50%, 70%, 80%, 90%, 100%, 10 min each) and pure acetone.

    Hood:

    Article Title: Base-resolution stratification of cancer mutations using functional variomics
    Article Snippet: L-alanine (Sigma-Aldrich, cat. no. A7627) L-arginine (Sigma-Aldrich, cat. no. A5006) L-asparagine (Sigma-Aldrich, cat. no. A8381) L-aspartic acid (Sigma-Aldrich, cat. no. A9256) L-cysteine (Sigma-Aldrich, cat. no. C7352) L-glutamic acid (Sigma-Aldrich, cat. no. G5889) L-glutamine (Sigma-Aldrich, cat. no. G3126) L-histidine (Sigma-Aldrich, cat. no. H8000) L-isoleucine (Sigma-Aldrich, cat. no. I2752) L-leucine (Sigma-Aldrich, cat. no. L8000) L-lysine (Sigma-Aldrich, cat. no. L5626) L-methionine (Sigma-Aldrich, cat. no. M9625) L-phenylalanine (Sigma-Aldrich, cat. no. P2126) L-proline (Sigma-Aldrich, cat. no. P0380) L-serine (Sigma-Aldrich, cat. no. S4500) L-threonine (Sigma-Aldrich, cat. no. T8625) L-tryptophan (Sigma-Aldrich, cat. no. T0254) L-tyrosine (Sigma-Aldrich, cat. no. T3754) L-valine (Sigma-Aldrich, cat. no. V0500) Ammonium sulfate (Sigma-Aldrich, cat. no. A4418) Yeast peptone (Sigma-Aldrich, cat. no. 39396) Yeast extract (EMD Chemicals, cat. no. 1.03753) Yeast Nitrogen Base (without amino acids, without ammonium sulfate) (Sigma-Aldrich, cat. no. 51483) Salmon sperm DNA, 10 mg/ml (Sigma-Aldrich, cat. no. D7656) Cycloheximide (Sigma-Aldrich, cat. no. C7698) Adenine (Sigma-Aldrich, cat. no. A3159) Uracil (Sigma-Aldrich, cat. no. U0750) SOC medium (New England BioLabs, cat. no. B9020S) 3-AT (3-Amino-1,2,4-triazole) (Sigma-Aldrich, cat. no. A8056). .. L-alanine (Sigma-Aldrich, cat. no. A7627) L-arginine (Sigma-Aldrich, cat. no. A5006) L-asparagine (Sigma-Aldrich, cat. no. A8381) L-aspartic acid (Sigma-Aldrich, cat. no. A9256) L-cysteine (Sigma-Aldrich, cat. no. C7352) L-glutamic acid (Sigma-Aldrich, cat. no. G5889) L-glutamine (Sigma-Aldrich, cat. no. G3126) L-histidine (Sigma-Aldrich, cat. no. H8000) L-isoleucine (Sigma-Aldrich, cat. no. I2752) L-leucine (Sigma-Aldrich, cat. no. L8000) L-lysine (Sigma-Aldrich, cat. no. L5626) L-methionine (Sigma-Aldrich, cat. no. M9625) L-phenylalanine (Sigma-Aldrich, cat. no. P2126) L-proline (Sigma-Aldrich, cat. no. P0380) L-serine (Sigma-Aldrich, cat. no. S4500) L-threonine (Sigma-Aldrich, cat. no. T8625) L-tryptophan (Sigma-Aldrich, cat. no. T0254) L-tyrosine (Sigma-Aldrich, cat. no. T3754) L-valine (Sigma-Aldrich, cat. no. V0500) Ammonium sulfate (Sigma-Aldrich, cat. no. A4418) Yeast peptone (Sigma-Aldrich, cat. no. 39396) Yeast extract (EMD Chemicals, cat. no. 1.03753) Yeast Nitrogen Base (without amino acids, without ammonium sulfate) (Sigma-Aldrich, cat. no. 51483) Salmon sperm DNA, 10 mg/ml (Sigma-Aldrich, cat. no. D7656) Cycloheximide (Sigma-Aldrich, cat. no. C7698) Adenine (Sigma-Aldrich, cat. no. A3159) Uracil (Sigma-Aldrich, cat. no. U0750) SOC medium (New England BioLabs, cat. no. B9020S) 3-AT (3-Amino-1,2,4-triazole) (Sigma-Aldrich, cat. no. A8056).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Millipore glycine arginine glycine aspartic acid serine proline rgd peptide
    Glycine Arginine Glycine Aspartic Acid Serine Proline Rgd Peptide, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glycine arginine glycine aspartic acid serine proline rgd peptide/product/Millipore
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    glycine arginine glycine aspartic acid serine proline rgd peptide - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Millipore aspartic acid
    Aspartic Acid, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aspartic acid/product/Millipore
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    aspartic acid - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    83
    Millipore l glutamate l aspartate transporter
    Supporting cell characteristics. (A) Labeling for Sox-9 (red) almost exclusively confined to nuclei (counterstained with DAPI, blue) at the level of those of supporting cells. Nuclei in hair cells (labeled for myosin VIIa, green) do not usually label for Sox-9, but an occasional nucleus in a myosin VIIa–labeled cell showed weak labeling for Sox-9. (Actin labeling in magenta.) (B) Labeling for  l -glutamate/ l -aspartate transporter (GLAST) delineates lateral membranes of supporting cells, extending down to the level of the basement membrane. (C, D) Labeling for connexins. Both CX26 (red in [C]) and CX30 (red in [D]) are present in large plaques around the cell body regions of supporting cells. Smaller labeled puncta are also present in the region close to the junctional complexes at the luminal end of supporting cells (arrows). Scale bars: (A–D) 10 μm.
    L Glutamate L Aspartate Transporter, supplied by Millipore, used in various techniques. Bioz Stars score: 83/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l glutamate l aspartate transporter/product/Millipore
    Average 83 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    l glutamate l aspartate transporter - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    Image Search Results


    Supporting cell characteristics. (A) Labeling for Sox-9 (red) almost exclusively confined to nuclei (counterstained with DAPI, blue) at the level of those of supporting cells. Nuclei in hair cells (labeled for myosin VIIa, green) do not usually label for Sox-9, but an occasional nucleus in a myosin VIIa–labeled cell showed weak labeling for Sox-9. (Actin labeling in magenta.) (B) Labeling for  l -glutamate/ l -aspartate transporter (GLAST) delineates lateral membranes of supporting cells, extending down to the level of the basement membrane. (C, D) Labeling for connexins. Both CX26 (red in [C]) and CX30 (red in [D]) are present in large plaques around the cell body regions of supporting cells. Smaller labeled puncta are also present in the region close to the junctional complexes at the luminal end of supporting cells (arrows). Scale bars: (A–D) 10 μm.

    Journal: Neurobiology of Aging

    Article Title: Characterizing human vestibular sensory epithelia for experimental studies: new hair bundles on old tissue and implications for therapeutic interventions in ageing

    doi: 10.1016/j.neurobiolaging.2015.02.013

    Figure Lengend Snippet: Supporting cell characteristics. (A) Labeling for Sox-9 (red) almost exclusively confined to nuclei (counterstained with DAPI, blue) at the level of those of supporting cells. Nuclei in hair cells (labeled for myosin VIIa, green) do not usually label for Sox-9, but an occasional nucleus in a myosin VIIa–labeled cell showed weak labeling for Sox-9. (Actin labeling in magenta.) (B) Labeling for l -glutamate/ l -aspartate transporter (GLAST) delineates lateral membranes of supporting cells, extending down to the level of the basement membrane. (C, D) Labeling for connexins. Both CX26 (red in [C]) and CX30 (red in [D]) are present in large plaques around the cell body regions of supporting cells. Smaller labeled puncta are also present in the region close to the junctional complexes at the luminal end of supporting cells (arrows). Scale bars: (A–D) 10 μm.

    Article Snippet: Supporting cells were examined for the expression of proteins using the following antibodies: a rabbit polyclonal against sox-9 (1:100, Millipore); a guinea pig polyclonal against l -glutamate/l -aspartate transporter (GLAST; 1:75, Millipore); a polyclonal against connexin (CX)30 (1:200 Zymed) and a rabbit polyclonal against CX26 (Gap 28H, kind gift Prof WH Evans; these connexin antibodies having previously been tested for specificity in a HeLa cell homologous expression system [ ]); a rabbit polyclonal against the c-terminus of human CX43 (Sigma); a rabbit polyclonal against Kir 4.1 (1:100, Alomone Labs, Jerusalem); and a goat polyclonal (1:200, Abcam, Cambridge, UK) and a rabbit polyclonal (1:200, kind gift from Thomas Jentsch, Berlin) against KCC4.

    Techniques: Labeling