l threonine  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Millipore l threonine
    L Threonine, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l threonine/product/Millipore
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    l threonine - by Bioz Stars, 2020-01
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rapid generation of long tandem DNA repeat arrays by homologous recombination in yeast to study their function in mammalian genomes
    Article Snippet: A highly transformable Saccharomyces cerevisiae strain VL6-48 (MAT alpha, his3-D 200, trp1-D1, ura3-52, lys2, ade2-101, met14, psi+cir 0 ) that has HIS3 and TRP1 deleted is used as a host for recombinational cloning experiments. .. MegaX DH10B™ T1R Electrocomp™ Cells (Invitrogen, cat. no. C6400-03) Bacto yeast extract (Fisher Scientific Ltd., cat. no. DF0886-17-0) Bacto peptone (Fisher Scientific Ltd., cat. no. DF0118-17-0) Bacto tryptone (Fisher Scientific Ltd., cat. no. DF0123-07-5) Bacto Agar (Fisher Scientific Ltd., cat. no. DF0145-17-0) D-Glucose (Sigma Chemical Co. Ltd., cat. no. G5250-1 KG) Yeast Nitrogen Base w/o Amino Acids (BD-Diagnostic Systems, cat. no. 291920) Adenine hemisulfate (Sigma-Aldrich, cat. no. A-3159) Uracil (Sigma-Aldrich, cat. no U075) L-Arginine-HCl (Sigma-Aldrich, cat. no. A4881) L-Aspartic acid (Sigma-Aldrich, cat. no. A93100) L-Glutamic acid (Sigma-Aldrich, cat. no. 128430) L-Histidine-HCl (Sigma-Aldrich, cat. no. 1515668) L-Isoleucine (Sigma-Aldrich, cat. no. 151718) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine-HCl (Sigma-Aldrich, cat. no. L5501) L-Methionine (Sigma-Aldrich, cat. no. M9625) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Serine (Sigma-Aldrich, cat. no S4500) L-Threonine (Sigma-Aldrich, cat. no T8625) L-Tryptophan (Sigma-Aldrich, cat. no T0254) L-Tyrosine (Sigma-Aldrich, cat. no T3754) L-Valine (Sigma-Aldrich, cat. no V0500) Yeast drop-out supplements for synthetic medium lacking histidine (Sigma-Aldrich, cat. no. Y-1751-20G) SORB-His plates, SD-His plates, and TOP agar-His (Teknova, Inc.) ( http://www.teknova.com ) Sorbitol (Sigma-Aldrich, cat. no. S1876-5 KG) Polyethylene glycol 8000 (PEG) (Sigma-Aldrich, cat. no. 89510-1 KG-F) 14 M beta-mercaptoethanol (ME) (Sigma-Aldrich, cat. no. M3148-100 ML) CAUTION It is highly toxic on contact with skin and is harmful if inhaled or swallowed.

    Amplification:

    Article Title: Genetic manipulation of Leishmania donovani threonyl tRNA synthetase facilitates its exploration as a potential therapeutic target
    Article Snippet: The template for tRNAThr was amplified from genomic DNA by using a forward primer with T7 promoter sequence (5’ TAATACGACTCACTATAGGGGCCGCTTAGCACAGTGG 3’) and reverse primer with CCA sequence (5’ TGGAGGCCACTCCGAGAATTGAA 3’). .. Aminoacylation assays were performed in aminoacylation buffer (30 mM Hepes, pH 7.5, 150 mM NaCl, 30 mM KCl and 40 mM MgCl2 ) with 1 mM DTT, 200 μM ATP, 2 U/mL inorganic pyrophosphatase (PPiase; Sigma), 10 mM L-threonine (Sigma), 8 μM tRNAThr and 0.4 μM rLd ThrRS.

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Recovery:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Synthesized:

    Article Title: Genetic manipulation of Leishmania donovani threonyl tRNA synthetase facilitates its exploration as a potential therapeutic target
    Article Snippet: The synthesized tRNAThr was refolded at 70°C for 10 min, followed by the addition of 10 mM magnesium chloride and slow cooling at RT. .. Aminoacylation assays were performed in aminoacylation buffer (30 mM Hepes, pH 7.5, 150 mM NaCl, 30 mM KCl and 40 mM MgCl2 ) with 1 mM DTT, 200 μM ATP, 2 U/mL inorganic pyrophosphatase (PPiase; Sigma), 10 mM L-threonine (Sigma), 8 μM tRNAThr and 0.4 μM rLd ThrRS.

    Enzyme Activity Assay:

    Article Title: Genetic manipulation of Leishmania donovani threonyl tRNA synthetase facilitates its exploration as a potential therapeutic target
    Article Snippet: Paragraph title: Enzyme activity assay ... Aminoacylation assays were performed in aminoacylation buffer (30 mM Hepes, pH 7.5, 150 mM NaCl, 30 mM KCl and 40 mM MgCl2 ) with 1 mM DTT, 200 μM ATP, 2 U/mL inorganic pyrophosphatase (PPiase; Sigma), 10 mM L-threonine (Sigma), 8 μM tRNAThr and 0.4 μM rLd ThrRS.

    Adsorption:

    Article Title:
    Article Snippet: For high pH imaging, adsorption and imaging of Tau fibrils were done in 10 m m Tris, 150 m m KCl adjusted to pH 9. .. When mentioned, HOPG was coated by poly- l -lysine, l -glutamate, or l -threonine (Sigma) using adsorption buffer containing 0.1% of the respective amino acid. .. To cross-link fibrils adsorbed to mica, they were first adsorbed to mica, then incubated for 30–60 s in adsorption buffer containing 0.5% glutaraldehyde, and subsequently washed several times with imaging buffer.

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Incubation:

    Article Title: Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant
    Article Snippet: For isolation of plasmid DNA and protoplast preparation, seed culture media containing trypticase soy broth (TSB, Oxoid, UK) supplemented with 0.5% (w/v) maltose (Merck, Germany) was inoculated with spore stocks of S. clavuligerus and incubated at 28°C on a rotary shaker (220 rpm) in baffled flasks for 48–60 h. Five ml of this seed culture were inoculated into 50 ml of 2:3 (v/v) mixture of TSB and yeast extract-malt extract medium (YEME, ) supplemented with 0.3% (v/v) glycine (Merck) and 3 mM MgCl2 and incubated at 28°C for 24 h. In the case of plasmid containing cultures, ampicillin (100 µg ml−1 for E. coli , Sigma), or thiostrepton (50 µg ml−1 for S. clavuligerus , Sigma) was added to the medium. .. For cephamycin C assay, the cultures were grown in TSB or a modified chemically defined medium (mCDM) which was prepared as in Malmberg et al. with some modifications; the amount of L-asparagine (Sigma) was increased from 2 g l−1 to 4 g l−1 and 10 g l−1 glycerol was replaced with 25 g l−1 sucrose (Merck). mCDM was supplemented with L-methionine (Sigma) and L-threonine (50 mg l−1 each; Sigma) for growth of S. clavuligerus AK39, S. clavuligerus BA39 and S. clavuligerus BAV.

    Expressing:

    Article Title: Analysis of Ubiquitinated Proteome by Quantitative Mass Spectrometry
    Article Snippet: Two yeast strains: one strain expressing only wild type His-tagged ubiquitin, and the other expressing His-tagged K11R ubiquitin ( ). .. Amino acid cocktail (no Lys/Arg, 100 X): L-tryptophan (2 g/liter), L-histidine (2 g/liter), L-methionine (2 g/liter), L-tyrosine (3 g/liter), L-leucine (10 g/liter), L-isoleucine (3 g/liter), L-phenylalanine (5 g/liter), L-glutamic acid (10 g/liter), L-aspartic acid (10 g/liter), L-valine (15 g/liter), L-threonine (20 g/liter), and L-serine (40 g/liter) (all from Sigma).

    Modification:

    Article Title: The regulation of autophagy differentially affects Trypanosoma cruzi metacyclogenesis
    Article Snippet: Modified TAU medium (TAU-AAG) was prepared with TAU medium supplemented with 50 mM sodium glutamate (Sigma), 10 mM L-proline (Tetrahedron), 2 mM sodium aspartate (Sigma), and 10 mM glucose (Biopack). .. SDM79 medium, which contains only traces of polyamines, was prepared with 8.4 g/l 199 TC 45 medium (Sigma), 8 ml/l MEM amino acids 50x (Gibco), s/c L-glutamine (Carbiochem), 6 ml/l MEM Non-essential amino acids 100x (Gibco), 1 g/l glucose, 8 g/l HEPES (Carbiochem), 5 g/l MOPS (Carbiochem), 2 g/l NaHCO3 (Biopack), 100 mg/l sodium pyruvate (Sigma), 200 mg/l L-alanine (Tetrahedron), 100 mg/l L-arginine (Sigma), 300 mg/l L-glutamine (Sigma), 70 mg/l L-methionine (Sigma), 80 mg/l L-phenylalanine (Sigma), 600 mg/l L-proline (Sigma), 60 mg/l L-serine (Tetrahedrum), 160 mg/l L-taurine (Sigma), 350 mg/l L-threonine (Sigma), 100 mg/l L-tyrosine (Sigma), 10 mg/l adenosine (Sigma), 10 mg/l guanosine (Sigma), 50 mg/l glucosamine-HCl (Sigma), 4 mg/l folic acid (Sigma), (pH 7,3).

    Article Title: Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida. Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida
    Article Snippet: Modified M9 minimal medium containing 5 g L−1 of glucose as carbon source (Abril, Michan, Timmis, & Ramos, ) was used for all assays. .. The chemicals used for toxicity screening included sodium acetate (Sigma, S8750), n ‐butanol (Sigma, 281549), 3‐hydroxy‐γ‐butyrolactone (TCI Chemicals, H0939), 1,4‐butanediol (Merck, 801534), furfural (Sigma, 185914), itaconic acid (Sigma, I29204), levulinic acid (Sigma, L2009), succinic acid (Sigma, S9512), L‐threonine (Sigma, T8441), p ‐coumaric acid (TCI Chemicals, C0393), and octanoic acid (Sigma, O3907).

    Article Title: Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant
    Article Snippet: For antibiotic selection, Streptomyces colonies were plated on trypticase soy agar (TSA) supplemented with 8 µg ml−1 thiostrepton. .. For cephamycin C assay, the cultures were grown in TSB or a modified chemically defined medium (mCDM) which was prepared as in Malmberg et al. with some modifications; the amount of L-asparagine (Sigma) was increased from 2 g l−1 to 4 g l−1 and 10 g l−1 glycerol was replaced with 25 g l−1 sucrose (Merck). mCDM was supplemented with L-methionine (Sigma) and L-threonine (50 mg l−1 each; Sigma) for growth of S. clavuligerus AK39, S. clavuligerus BA39 and S. clavuligerus BAV. .. Seed cultures were grown in 50 ml of TSB until mid-log phase and centrifuged at 3,200 rpm for 10 min at 4°C.

    High Performance Liquid Chromatography:

    Article Title: Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation
    Article Snippet: Different amounts of l -tryptophan (T-0254; Sigma) and l -threonine (T-8625; Sigma) were added to NGM medium before autoclaving. .. Different amounts of l -tryptophan (T-0254; Sigma) and l -threonine (T-8625; Sigma) were added to NGM medium before autoclaving.

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Cell Culture:

    Article Title: Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida. Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida
    Article Snippet: Cells were routinely cultured in LB medium or on LB agar plates according to standard protocols (Sambrook & Russel, ). .. The chemicals used for toxicity screening included sodium acetate (Sigma, S8750), n ‐butanol (Sigma, 281549), 3‐hydroxy‐γ‐butyrolactone (TCI Chemicals, H0939), 1,4‐butanediol (Merck, 801534), furfural (Sigma, 185914), itaconic acid (Sigma, I29204), levulinic acid (Sigma, L2009), succinic acid (Sigma, S9512), L‐threonine (Sigma, T8441), p ‐coumaric acid (TCI Chemicals, C0393), and octanoic acid (Sigma, O3907).

    other:

    Article Title: Histidine is selectively required for the growth of Myc‐dependent dedifferentiation tumours in the Drosophila CNS
    Article Snippet: Chemically defined diet has the following composition: L‐Alanine (5.612 mM, Sigma‐Aldrich A7627), L‐Arginine (4.592 mM, Sigma‐Aldrich A5006), L‐Aspartic Acid (3.756 mM, Sigma‐Aldrich A9249), L‐Cysteine (4.127 mM, Sigma‐Aldrich C7352), L‐Glutamic Acid (36.702 mM, Sigma‐Aldrich G1251), Glycine (6.661 mM, Sigma‐Aldrich V900144), L‐Histidine (6.445 mM, Sigma‐Aldrich H8125), L‐Isoleucine (22.869 mM, Sigma‐Aldrich I2752), L‐Leucine (15.247 mM, Sigma‐Aldrich L8000), L‐Lysine HCl (12.997 mM, Sigma‐Aldrich 23128), L‐Methionine (5.362 mM, Sigma‐Aldrich M9625), L‐Phenylalanine (7.8 mM, Sigma‐Aldrich P2126), L‐Proline (4.343 mM, Sigma‐Aldrich P0380), L‐serine (4.758 mM, Sigma‐Aldrich S4500), L‐Threonine (16.790 mM, Sigma‐Aldrich T8625), L‐Tryptophan (2.448 mM, Sigma‐Aldrich T0254), L‐Tyrosine (2.760 mM, Sigma‐Aldrich I2752) and L‐Valine (23.901 mM, Sigma‐Aldrich V0500).

    Article Title: Addition of Carbohydrate or Alanine to an Essential Amino Acid Mixture Does Not Enhance Human Skeletal Muscle Protein Anabolism
    Article Snippet: All solutions (EAA, EAA+ALA, EAA+CHO) contained the same 10 g EAAs mixed in a noncaloric, noncaffeinated, carbonated beverage (500 mL) as previously reported ( , ): l -histidine (1.1 g), l -isoleucine (1.0 g), l -leucine (1.85 g), l -lysine (1.55 g), l -methionine (0.3 g), l -phenylalanine (1.55 g), l -threonine (1.45 g), and l -valine (1.2 g) (Sigma-Aldrich).

    Article Title: Genome-wide Escherichia coli stress response and improved tolerance towards industrially relevant chemicals
    Article Snippet: Biological triplicates were performed for all conditions and the employed chemicals were sodium acetate (Sigma, S8750), butanol (Sigma, 281549), 3-hydroxy-butyrolactone (TCI Chemicals, H0939), 1,4-butanediol (Merck, 801534), decanoic acid (Sigma, W236403), furfural (Sigma, 185914), geraniol (TCI Chemicals G0027), itaconic acid (Sigma, I29204), levulinic acid (Sigma, L2009), l -serine (Sigma, S4311), succinic acid (Sigma, S9512) and l -threonine (Sigma, T8441).

    Article Title: Differential expression of small RNAs under chemical stress and fed-batch fermentation in E. coli
    Article Snippet: The employed chemicals were sodium acetate (Sigma, S8750), butanol (Sigma, 281549), 3-hydroxy-butyrolactone (TCI Chemicals, H0939), 1,4-butanediol (Merck, 801534), decanoic acid (Sigma, W236403), furfural (Sigma, 185914), geraniol (TCI Chemicals G0027), itaconic acid (Sigma, I29204), levulinic acid (Sigma, L2009), L-serine (Sigma, S4311), succinic acid (Sigma, S9512) and L-threonine (Sigma, T8441).

    Article Title: Expanded Cellular Amino Acid Pools Containing Phosphoserine, Phosphothreonine, and Phosphotyrosine
    Article Snippet: Baker), 1 mL of 1 M MgSO4 , 4 mL of 50% d -glucose, 88 mL of 2 mM l -tyrosine (Sigma-Aldrich 93829), 38 mL of 30 mM l -aspartic acid (Sigma-Aldrich A9256), 17 mL of 30 mM l -glutamic acid (Sigma-Aldrich G1251) and 10 mL of 20% pure amino acid mix [50 mL water, 0.44 g l -alanine (Sigma-Aldrich A7627), 0.21 g l -arginine (Sigma-Aldrich A5131), 0.06 g l -cysteine (Sigma-Aldrich C7880), 0.11 g l -glycine (American Bioanalytical AB00730), 0.11 g l -histidine (Sigma-Aldrich H8000), 0.27 g l -isoleucine (Sigma-Aldrich I2752), 0.46 g l -leucine (Sigma-Aldrich L8000), 0.57 g l -lysine (Sigma-Aldrich L5626), 0.12 g l -methionine (Sigma-Aldrich M9625), 0.19 g l -phenylalanine (Sigma-Aldrich P2126), 0.57 g l -proline (Sigma-Aldrich P-0380), 0.21 g l -serine (Sigma-Aldrich S4500), 0.05 g l -threonine (Sigma-Aldrich 89179), 0.34 g l -valine (Sigma-Aldrich V0500)] was added.

    Article Title: Large-scale Phenotypic Profiling of Gene Deletion Mutants in Candida glabrata
    Article Snippet: C. glabrata strain (ATCC2001, clinical isolates) Sterile water (double distilled) Bacto™ peptone (BD Biosciences, catalog number: 211820) Bacto™ yeast extract (BD Biosciences, catalog number: 212720) Bacto™ agar (BD Biosciences, catalog number: 214030) Difco™ yeast nitrogen base (YNB) (BD Biosciences, catalog number: 233520) Glucose (Merck KGaA, catalog number: 108337) Adenine (Sigma-Aldrich, catalog number: A8626) L-arginine (Sigma-Aldrich, catalog number: A5006) L-tyrosine (Sigma-Aldrich, catalog number: T3754) L-isoleucine (Sigma-Aldrich, catalog number: I2752) L-phenylalanine (Sigma-Aldrich, catalog number: P2126) L-glutamic acid (Sigma-Aldrich, catalog number: G1251) L-aspartic acid (Sigma-Aldrich, catalog number: A9256) L-threonine (Sigma-Aldrich, catalog number: T8625) L-serine (Sigma-Aldrich, catalog number: S4500) L-valine (Sigma-Aldrich, catalog number: V0500) L-methionine (Sigma-Aldrich, catalog number: M9625) Glycerol (Sigma-Aldrich, catalog number: G5516) YPD media (see ) Solid YPD media (see ) 2x YPD media (see ) SC media (see ) Solid SC media (see ) Amino acid mix (see ) 15% glycerol solution (see )

    Article Title: Quantitative Analysis of Triple Mutant Genetic Interactions
    Article Snippet: Yeast extract : Becton, Dickinson and Company #212720 Peptone : Becton, Dickinson and Company #211820 Difco Agar : Becton, Dickinson and Company #214510 Dextrose (D-glucose) : Fisher #D16-3 Yeast nitrogen base without amino acids and without ammonium sulfate:Becton, Dickinson and Company #233520 CSM-Ura drop-out mix : Sunrise Science #1004-100 Yeast nitrogen base without amino acids : Becton, Dickinsonand Company #291920 Geneticin (G418) : Gibco #11811-031 Hygromycin B (HPH) : Invitrogen #10687-010 L-Canavanine sulfate salt (CAN) : Sigma #C9758 S-(2-Aminoethyl)-L-cysteine hydrochloride (S-AEC) : Sigma#A2636 Adenine hemisulfate salt : Sigma #A9126 Alanine: Sigma #A7627 Asparagine : Sigma #A0884 Aspartic acid : Sigma #A9256 Cysteine : Sigma #W326305 Glutamine : Sigma #G3202 Glutamic acid, monosodium salt hydrate : Sigma #G1626 Glycine : Sigma #219517 Inositol : Sigma #I5125 Isoleucine : Sigma #I2752 Leucine : Sigma #L8000 Methionine : Sigma #M9625 4-aminobenzoic acid : Sigma #A9878 Phenylalanine : Sigma #P2126 Proline : Sigma #P0380 Serine : Sigma #S4500 Threonine : Sigma #T8625 Tryptophan : Sigma #T0254 Tyrosine : Sigma #T3754 Uracil : Sigma #U0750 Valine : Sigma #V0500

    Imaging:

    Article Title:
    Article Snippet: For high pH imaging, adsorption and imaging of Tau fibrils were done in 10 m m Tris, 150 m m KCl adjusted to pH 9. .. When mentioned, HOPG was coated by poly- l -lysine, l -glutamate, or l -threonine (Sigma) using adsorption buffer containing 0.1% of the respective amino acid.

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Fluorescence:

    Article Title: High-throughput microfluidics to control and measure signaling dynamics in single yeast cells
    Article Snippet: Paragraph title: Low fluorescence medium (LFM) ... Please see “Reagents Setup” below for a recipe describing how to make and store LFM. (D)-Glucose (e.g. item C8270 from Sigma-Aldrich) × salt stock solution: Ammonium sulfate ((NH4 )2 SO4 ; e.g. item A4418 from Sigma-Aldrich) Potassium phosphate monobasic (KH2 PO4 ; e.g. item P5655 from Sigma-Aldrich) Magnesium sulfate heptahydrate (MgSO4 ·7H2 O; e.g. item 230391 from Sigma-Aldrich) Sodium chloride (NaCl; e.g. item 793566 from Sigma-Aldrich) Calcium chloride dihydrate (CaCl2 ·2H2 O; e.g. item C5080 from Sigma-Aldrich) 1000× trace elements stock solution: Boric acid (H3 BO3 ; e.g. item B6768 from Sigma-Aldrich) Copper(II) sulfate (CuSO4 ; e.g. item C1297 from Sigma-Aldrich) Potassium iodide (KI; e.g. item 793582 from Sigma-Aldrich) Iron(III) chloride (FeCl3 ; e.g. item 157740 from Sigma-Aldrich) Manganese(II) sulfate (MnSO4 ; e.g. item M7634 from Sigma-Aldrich) Sodium molybdate dihydrate (Na2 MoO4 ·2H2 O; e.g. item M1003 from Sigma-Aldrich) Zinc sulfate (ZnSO4 ; e.g. item Z0251 from Sigma-Aldrich) 1000× vitamin stock solution: Biotin (e.g. item B4501 from Sigma-Aldrich) Calcium pantothenate (D-pantothenic acid hemicalcium salt; e.g. item C8731 from Sigma-Aldrich) myo -inositol (e.g. item I5125 from Sigma-Aldrich) Niacin/nicotinic acid (e.g. item N0761 from Sigma-Aldrich) p -Aminobenzoic acid (4-aminobenzoic acid; e.g. item 100536 from Sigma-Aldrich) Pyridoxine hydrochloride (e.g. item P9755 from Sigma-Aldrich) Thiamine hydrochloride (e.g. item T4625 from Sigma-Aldrich) 10× amino acid stock solution: Adenine (e.g. item A8626 from Sigma-Aldrich) L-Arginine (e.g. item A5006 from Sigma-Aldrich) L-Histidine (e.g. item H8000 from Sigma-Aldrich) L-Isoleucine (e.g. item I2752 from Sigma-Aldrich) L-Leucine (e.g. item L8000 from Sigma-Aldrich) L-Lysine (e.g. item L5501 from Sigma-Aldrich) L-Methionine (e.g. item M9625 from Sigma-Aldrich) L-Phenylalanine (e.g. item P2126 from Sigma-Aldrich) L-Threonine (e.g. item T8625 from Sigma-Aldrich) L-Tryptophan (e.g. item T0254 from Sigma-Aldrich) L-Tyrosine (e.g. item T3754 from Sigma-Aldrich) Uracil (e.g. item U0750 from Sigma-Aldrich) L-Valine (e.g. item V0500 from Sigma-Aldrich) Nalgene Rapid-Flow sterile filter storage bottles (item 455-1000 from Thermo Scientific)

    Isolation:

    Article Title: Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant
    Article Snippet: For isolation of plasmid DNA and protoplast preparation, seed culture media containing trypticase soy broth (TSB, Oxoid, UK) supplemented with 0.5% (w/v) maltose (Merck, Germany) was inoculated with spore stocks of S. clavuligerus and incubated at 28°C on a rotary shaker (220 rpm) in baffled flasks for 48–60 h. Five ml of this seed culture were inoculated into 50 ml of 2:3 (v/v) mixture of TSB and yeast extract-malt extract medium (YEME, ) supplemented with 0.3% (v/v) glycine (Merck) and 3 mM MgCl2 and incubated at 28°C for 24 h. In the case of plasmid containing cultures, ampicillin (100 µg ml−1 for E. coli , Sigma), or thiostrepton (50 µg ml−1 for S. clavuligerus , Sigma) was added to the medium. .. For cephamycin C assay, the cultures were grown in TSB or a modified chemically defined medium (mCDM) which was prepared as in Malmberg et al. with some modifications; the amount of L-asparagine (Sigma) was increased from 2 g l−1 to 4 g l−1 and 10 g l−1 glycerol was replaced with 25 g l−1 sucrose (Merck). mCDM was supplemented with L-methionine (Sigma) and L-threonine (50 mg l−1 each; Sigma) for growth of S. clavuligerus AK39, S. clavuligerus BA39 and S. clavuligerus BAV.

    Labeling:

    Article Title: Analysis of Ubiquitinated Proteome by Quantitative Mass Spectrometry
    Article Snippet: Paragraph title: 2.1 Yeast differential labeling by light or heavy amino acids ... Amino acid cocktail (no Lys/Arg, 100 X): L-tryptophan (2 g/liter), L-histidine (2 g/liter), L-methionine (2 g/liter), L-tyrosine (3 g/liter), L-leucine (10 g/liter), L-isoleucine (3 g/liter), L-phenylalanine (5 g/liter), L-glutamic acid (10 g/liter), L-aspartic acid (10 g/liter), L-valine (15 g/liter), L-threonine (20 g/liter), and L-serine (40 g/liter) (all from Sigma).

    Mouse Assay:

    Article Title: L-Threonine Supplementation During Colitis Onset Delays Disease Recovery
    Article Snippet: Mice were divided into DSS (control), DSS with L -Threonine (DSS + Thr) and DSS followed by L -Threonine administration at day 8 (DSS + Thr D8), as shown in Figure . .. L -Threonine [Thr; Sigma–Aldrich; 0.166% (w/v) corresponding to 250 mg/Kg/day] was given in the drinking water ad libitum .

    Sequencing:

    Article Title: Genetic manipulation of Leishmania donovani threonyl tRNA synthetase facilitates its exploration as a potential therapeutic target
    Article Snippet: The template for tRNAThr was amplified from genomic DNA by using a forward primer with T7 promoter sequence (5’ TAATACGACTCACTATAGGGGCCGCTTAGCACAGTGG 3’) and reverse primer with CCA sequence (5’ TGGAGGCCACTCCGAGAATTGAA 3’). .. Aminoacylation assays were performed in aminoacylation buffer (30 mM Hepes, pH 7.5, 150 mM NaCl, 30 mM KCl and 40 mM MgCl2 ) with 1 mM DTT, 200 μM ATP, 2 U/mL inorganic pyrophosphatase (PPiase; Sigma), 10 mM L-threonine (Sigma), 8 μM tRNAThr and 0.4 μM rLd ThrRS.

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Plasmid Preparation:

    Article Title: Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida. Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida
    Article Snippet: E. coli DH5α and E. coli DH5α‐Pir were used for plasmid maintenance and were grown in LB medium at 37°C. .. The chemicals used for toxicity screening included sodium acetate (Sigma, S8750), n ‐butanol (Sigma, 281549), 3‐hydroxy‐γ‐butyrolactone (TCI Chemicals, H0939), 1,4‐butanediol (Merck, 801534), furfural (Sigma, 185914), itaconic acid (Sigma, I29204), levulinic acid (Sigma, L2009), succinic acid (Sigma, S9512), L‐threonine (Sigma, T8441), p ‐coumaric acid (TCI Chemicals, C0393), and octanoic acid (Sigma, O3907).

    Article Title: Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant
    Article Snippet: For isolation of plasmid DNA and protoplast preparation, seed culture media containing trypticase soy broth (TSB, Oxoid, UK) supplemented with 0.5% (w/v) maltose (Merck, Germany) was inoculated with spore stocks of S. clavuligerus and incubated at 28°C on a rotary shaker (220 rpm) in baffled flasks for 48–60 h. Five ml of this seed culture were inoculated into 50 ml of 2:3 (v/v) mixture of TSB and yeast extract-malt extract medium (YEME, ) supplemented with 0.3% (v/v) glycine (Merck) and 3 mM MgCl2 and incubated at 28°C for 24 h. In the case of plasmid containing cultures, ampicillin (100 µg ml−1 for E. coli , Sigma), or thiostrepton (50 µg ml−1 for S. clavuligerus , Sigma) was added to the medium. .. For cephamycin C assay, the cultures were grown in TSB or a modified chemically defined medium (mCDM) which was prepared as in Malmberg et al. with some modifications; the amount of L-asparagine (Sigma) was increased from 2 g l−1 to 4 g l−1 and 10 g l−1 glycerol was replaced with 25 g l−1 sucrose (Merck). mCDM was supplemented with L-methionine (Sigma) and L-threonine (50 mg l−1 each; Sigma) for growth of S. clavuligerus AK39, S. clavuligerus BA39 and S. clavuligerus BAV.

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Selection:

    Article Title: Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant
    Article Snippet: For antibiotic selection, Streptomyces colonies were plated on trypticase soy agar (TSA) supplemented with 8 µg ml−1 thiostrepton. .. For cephamycin C assay, the cultures were grown in TSB or a modified chemically defined medium (mCDM) which was prepared as in Malmberg et al. with some modifications; the amount of L-asparagine (Sigma) was increased from 2 g l−1 to 4 g l−1 and 10 g l−1 glycerol was replaced with 25 g l−1 sucrose (Merck). mCDM was supplemented with L-methionine (Sigma) and L-threonine (50 mg l−1 each; Sigma) for growth of S. clavuligerus AK39, S. clavuligerus BA39 and S. clavuligerus BAV.

    In Vitro:

    Article Title: Genetic manipulation of Leishmania donovani threonyl tRNA synthetase facilitates its exploration as a potential therapeutic target
    Article Snippet: The substrate tRNAThr was in vitro synthesized by using MEGAScript in-vitro transcription kit. .. Aminoacylation assays were performed in aminoacylation buffer (30 mM Hepes, pH 7.5, 150 mM NaCl, 30 mM KCl and 40 mM MgCl2 ) with 1 mM DTT, 200 μM ATP, 2 U/mL inorganic pyrophosphatase (PPiase; Sigma), 10 mM L-threonine (Sigma), 8 μM tRNAThr and 0.4 μM rLd ThrRS.

    Spectrophotometry:

    Article Title: Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function
    Article Snippet: The medium without mucin was supplemented with tryptone (8 g/l, Oxoid Ltd, Basingstoke, Hampshire, England) and L-threonine (2 mM, Sigma-Aldrich). .. The medium without mucin was supplemented with tryptone (8 g/l, Oxoid Ltd, Basingstoke, Hampshire, England) and L-threonine (2 mM, Sigma-Aldrich).

    Sampling:

    Article Title: Essential Amino Acids Increase MicroRNA-499, -208b, and -23a and Downregulate Myostatin and Myocyte Enhancer Factor 2C mRNA Expression in Human Skeletal Muscle
    Article Snippet: The composition of the EAA mixture was the following: l -histidine (0.8 g), l -isoleucine (0.8 g), l -leucine (3.5 g), l -lysine (1.2 g), l -methionine (3.0 g), l -phenylalanine (1.4 g), l -threonine (1.0 g), and l -valine (1.0 g) (Ajinomoto/Sigma Aldrich). .. The composition of the EAA mixture was the following: l -histidine (0.8 g), l -isoleucine (0.8 g), l -leucine (3.5 g), l -lysine (1.2 g), l -methionine (3.0 g), l -phenylalanine (1.4 g), l -threonine (1.0 g), and l -valine (1.0 g) (Ajinomoto/Sigma Aldrich).

    Concentration Assay:

    Article Title: Analysis of Ubiquitinated Proteome by Quantitative Mass Spectrometry
    Article Snippet: Amino acid cocktail (no Lys/Arg, 100 X): L-tryptophan (2 g/liter), L-histidine (2 g/liter), L-methionine (2 g/liter), L-tyrosine (3 g/liter), L-leucine (10 g/liter), L-isoleucine (3 g/liter), L-phenylalanine (5 g/liter), L-glutamic acid (10 g/liter), L-aspartic acid (10 g/liter), L-valine (15 g/liter), L-threonine (20 g/liter), and L-serine (40 g/liter) (all from Sigma). .. Amino acid cocktail (no Lys/Arg, 100 X): L-tryptophan (2 g/liter), L-histidine (2 g/liter), L-methionine (2 g/liter), L-tyrosine (3 g/liter), L-leucine (10 g/liter), L-isoleucine (3 g/liter), L-phenylalanine (5 g/liter), L-glutamic acid (10 g/liter), L-aspartic acid (10 g/liter), L-valine (15 g/liter), L-threonine (20 g/liter), and L-serine (40 g/liter) (all from Sigma).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Millipore pim3
    Disruption of <t>Pim3</t> function leads to an augmentation in glucose-stimulated insulin secretion but has no effect on total insulin levels. (A) MIN6 cells were infected with adenovirus expressing KD-Pim3 (dashed line, open square) or β-gal (solid
    Pim3, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pim3/product/Millipore
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pim3 - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    89
    Millipore sik2
    Effect of SIK1 and <t>SIK2</t> overexpression on forskolin (Fsk)-induced nuclear levels of phospho-CREB (pCREB), phosphorylated (pTORC2), and dephosphorylated TORC2 (dpTORC2). Cytoplasmic (A and nuclear (C and D) proteins of 4B cells transfected with expression
    Sik2, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sik2/product/Millipore
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sik2 - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    84
    Millipore active aurka
    <t>AURKA</t> regulates <t>V-ATPase</t> activity at the plasma membrane in cultured Caki-2 cells. The rate of extracellular acidification in each set of treatments was measured in a low-buffering capacity solution in the extracellular buffer of cells preincubated in
    Active Aurka, supplied by Millipore, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/active aurka/product/Millipore
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    active aurka - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    Image Search Results


    Disruption of Pim3 function leads to an augmentation in glucose-stimulated insulin secretion but has no effect on total insulin levels. (A) MIN6 cells were infected with adenovirus expressing KD-Pim3 (dashed line, open square) or β-gal (solid

    Journal:

    Article Title: Pim3 negatively regulates glucose-stimulated insulin secretion

    doi: 10.4161/isl.2.5.13058

    Figure Lengend Snippet: Disruption of Pim3 function leads to an augmentation in glucose-stimulated insulin secretion but has no effect on total insulin levels. (A) MIN6 cells were infected with adenovirus expressing KD-Pim3 (dashed line, open square) or β-gal (solid

    Article Snippet: Antigens were detected by affinity-purified rabbit polyclonal antibodies to Pim3 (1:50 dilution), guinea pig anti-glucagon (Millipore, Billerica, MA, 1:400 dilution), and mouse anti-insulin antibodies (Invitrogen, Carlsbad, CA, 1:500 dilution).

    Techniques: Infection, Expressing

    Pim3 directly interacts with SOCS6 and this interaction may mediate its effect on ERK1/2. (A) GST pulldown experiment using MIN6 cell lysates from cells grown in either high (25 mM) or low (0.5 mM) glucose conditions and wt-Pim3-GST, KD-Pim3-GST fusion

    Journal:

    Article Title: Pim3 negatively regulates glucose-stimulated insulin secretion

    doi: 10.4161/isl.2.5.13058

    Figure Lengend Snippet: Pim3 directly interacts with SOCS6 and this interaction may mediate its effect on ERK1/2. (A) GST pulldown experiment using MIN6 cell lysates from cells grown in either high (25 mM) or low (0.5 mM) glucose conditions and wt-Pim3-GST, KD-Pim3-GST fusion

    Article Snippet: Antigens were detected by affinity-purified rabbit polyclonal antibodies to Pim3 (1:50 dilution), guinea pig anti-glucagon (Millipore, Billerica, MA, 1:400 dilution), and mouse anti-insulin antibodies (Invitrogen, Carlsbad, CA, 1:500 dilution).

    Techniques:

    Pim3 is a glucose-responsive gene expressed exclusively in pancreatic β-cells. (A) Microarray analysis of glucose-stimulated MIN6 cells shows relative (to T 0 ) Pim3 transcript abundance at various timepoints after glucose stimulation. Results shown

    Journal:

    Article Title: Pim3 negatively regulates glucose-stimulated insulin secretion

    doi: 10.4161/isl.2.5.13058

    Figure Lengend Snippet: Pim3 is a glucose-responsive gene expressed exclusively in pancreatic β-cells. (A) Microarray analysis of glucose-stimulated MIN6 cells shows relative (to T 0 ) Pim3 transcript abundance at various timepoints after glucose stimulation. Results shown

    Article Snippet: Antigens were detected by affinity-purified rabbit polyclonal antibodies to Pim3 (1:50 dilution), guinea pig anti-glucagon (Millipore, Billerica, MA, 1:400 dilution), and mouse anti-insulin antibodies (Invitrogen, Carlsbad, CA, 1:500 dilution).

    Techniques: Microarray

    Pim3 -/- mice exhibit increased insulin sensitivity and improved glucose tolerance. Blood glucose (A) and serum insulin levels (B) were determined in freely fed and fasted (overnight) Pim3 -/- (grey bar) and wildtype (black bar) mice. For fed serum insulin:

    Journal:

    Article Title: Pim3 negatively regulates glucose-stimulated insulin secretion

    doi: 10.4161/isl.2.5.13058

    Figure Lengend Snippet: Pim3 -/- mice exhibit increased insulin sensitivity and improved glucose tolerance. Blood glucose (A) and serum insulin levels (B) were determined in freely fed and fasted (overnight) Pim3 -/- (grey bar) and wildtype (black bar) mice. For fed serum insulin:

    Article Snippet: Antigens were detected by affinity-purified rabbit polyclonal antibodies to Pim3 (1:50 dilution), guinea pig anti-glucagon (Millipore, Billerica, MA, 1:400 dilution), and mouse anti-insulin antibodies (Invitrogen, Carlsbad, CA, 1:500 dilution).

    Techniques: Mouse Assay

    Pim3 negatively regulates the ERK1/2 signaling pathway. Isolated islets (40–45 per timepoint) from Pim3 -/- and wildtype mice were treated with 2.8 mM glucose RPMI for 3 hours and stimulated with 16.7 mM glucose RPMI for the times indicated and

    Journal:

    Article Title: Pim3 negatively regulates glucose-stimulated insulin secretion

    doi: 10.4161/isl.2.5.13058

    Figure Lengend Snippet: Pim3 negatively regulates the ERK1/2 signaling pathway. Isolated islets (40–45 per timepoint) from Pim3 -/- and wildtype mice were treated with 2.8 mM glucose RPMI for 3 hours and stimulated with 16.7 mM glucose RPMI for the times indicated and

    Article Snippet: Antigens were detected by affinity-purified rabbit polyclonal antibodies to Pim3 (1:50 dilution), guinea pig anti-glucagon (Millipore, Billerica, MA, 1:400 dilution), and mouse anti-insulin antibodies (Invitrogen, Carlsbad, CA, 1:500 dilution).

    Techniques: Isolation, Mouse Assay

    Effect of SIK1 and SIK2 overexpression on forskolin (Fsk)-induced nuclear levels of phospho-CREB (pCREB), phosphorylated (pTORC2), and dephosphorylated TORC2 (dpTORC2). Cytoplasmic (A and nuclear (C and D) proteins of 4B cells transfected with expression

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Effect of SIK1 and SIK2 overexpression on forskolin (Fsk)-induced nuclear levels of phospho-CREB (pCREB), phosphorylated (pTORC2), and dephosphorylated TORC2 (dpTORC2). Cytoplasmic (A and nuclear (C and D) proteins of 4B cells transfected with expression

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: Over Expression, Transfection, Expressing

    Time course of the effect of forskolin and PMA on SIK1 (A) and SIK2 (B) mRNA levels, measured by qRT-PCR and SIK1 (C) and SIK2 (D) proteins in cytoplasm measured by Western blot in the hypothalamic neuronal cell line, 4B. Western blots for SIK1 were performed

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Time course of the effect of forskolin and PMA on SIK1 (A) and SIK2 (B) mRNA levels, measured by qRT-PCR and SIK1 (C) and SIK2 (D) proteins in cytoplasm measured by Western blot in the hypothalamic neuronal cell line, 4B. Western blots for SIK1 were performed

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: Quantitative RT-PCR, Western Blot

    Effect of SIK1 and SIK2 shRNA blockade on forskolin-induced nuclear translocation of TORC2 and CRH transcription. Images show representative Western blot for TORC2 in cytoplasmic (A) and nuclear proteins (C) of 4B cells transfected 48 h earlier with expression

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Effect of SIK1 and SIK2 shRNA blockade on forskolin-induced nuclear translocation of TORC2 and CRH transcription. Images show representative Western blot for TORC2 in cytoplasmic (A) and nuclear proteins (C) of 4B cells transfected 48 h earlier with expression

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: shRNA, Translocation Assay, Western Blot, Transfection, Expressing

    Time course of the effect of restraint stress on levels of CRH hnRNA (A), SIK1 (B), and SIK2 (C) mRNA in the PVN. Images are representative of data obtained by in situ hybridization in coronal sections of the hypothalamic region at the level of the PVN

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Time course of the effect of restraint stress on levels of CRH hnRNA (A), SIK1 (B), and SIK2 (C) mRNA in the PVN. Images are representative of data obtained by in situ hybridization in coronal sections of the hypothalamic region at the level of the PVN

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: In Situ Hybridization

    Time course of the effect of forskolin on endogenous levels of CRH hnRNA (A), SIK1 mRNA (B), and SIK2 mRNA (C) in primary cultures of hypothalamic neurons. Data points are the mean and se of pooled data from four to seven experiments. *, P

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Time course of the effect of forskolin on endogenous levels of CRH hnRNA (A), SIK1 mRNA (B), and SIK2 mRNA (C) in primary cultures of hypothalamic neurons. Data points are the mean and se of pooled data from four to seven experiments. *, P

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques:

    Effect of SIK1 and SIK2 overexpression on CRH promoter activity in 4B cells cotransfected with SIK1 or SIK2 and a CRH promoter-driven luciferase reporter gene. Twenty-four hours after transfection, cells were treated with forskolin (Fsk) before protein

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Effect of SIK1 and SIK2 overexpression on CRH promoter activity in 4B cells cotransfected with SIK1 or SIK2 and a CRH promoter-driven luciferase reporter gene. Twenty-four hours after transfection, cells were treated with forskolin (Fsk) before protein

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: Over Expression, Activity Assay, Luciferase, Transfection

    Effect of SIK1 and SIK2 shRNA on SIK1 (A and B) and SIK2 (C and D) expression in 4B cells Forty-eight hours after transfection with SIK1 or SIK2 shRNA, cells were incubated with forskolin for up to 3 h before RNA isolation for qRT-PCR. Data points are

    Journal:

    Article Title: Salt-Inducible Kinase Is Involved in the Regulation of Corticotropin-Releasing Hormone Transcription in Hypothalamic Neurons in Rats

    doi: 10.1210/en.2011-1404

    Figure Lengend Snippet: Effect of SIK1 and SIK2 shRNA on SIK1 (A and B) and SIK2 (C and D) expression in 4B cells Forty-eight hours after transfection with SIK1 or SIK2 shRNA, cells were incubated with forskolin for up to 3 h before RNA isolation for qRT-PCR. Data points are

    Article Snippet: After the quantification of protein concentration, Western blots were performed as previously described , using 15 μg of protein and antibodies for TORC2 (Calbiochem/EDM Chemicals) at 1:6000 dilution, SIK1 (by H.T.) at 1:1000 dilution, or SIK2 (Millipore, Billerica, MA) at a dilution of 1:1500.

    Techniques: shRNA, Expressing, Transfection, Incubation, Isolation, Quantitative RT-PCR

    AURKA regulates V-ATPase activity at the plasma membrane in cultured Caki-2 cells. The rate of extracellular acidification in each set of treatments was measured in a low-buffering capacity solution in the extracellular buffer of cells preincubated in

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA regulates V-ATPase activity at the plasma membrane in cultured Caki-2 cells. The rate of extracellular acidification in each set of treatments was measured in a low-buffering capacity solution in the extracellular buffer of cells preincubated in

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Activity Assay, Cell Culture

    AURKA activation increases cell surface expression of the V-ATPase in Caki-2 cells. A : representative immunoblots of V-ATPase a4 subunit (ATP6V0A4 in the V-ATPase V 0 integral membrane domain) in whole cell lysates and cell surface biotinylation protein

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA activation increases cell surface expression of the V-ATPase in Caki-2 cells. A : representative immunoblots of V-ATPase a4 subunit (ATP6V0A4 in the V-ATPase V 0 integral membrane domain) in whole cell lysates and cell surface biotinylation protein

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Activation Assay, Expressing, Western Blot

    AURKA and the vacuolar (V)-ATPase in the Caki-2 kidney cancer cell line are coexpressed in cytoplasm and form a complex. A : confocal stacks and X-Z and Y-Z reconstructions of Caki-2 cells immunolabeled for AURKA (red) and the V-ATPase E subunit (green).

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA and the vacuolar (V)-ATPase in the Caki-2 kidney cancer cell line are coexpressed in cytoplasm and form a complex. A : confocal stacks and X-Z and Y-Z reconstructions of Caki-2 cells immunolabeled for AURKA (red) and the V-ATPase E subunit (green).

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Immunolabeling

    AURKA-dependent phosphorylation of the V-ATPase A subunit occurs at Ser-175 in Caki-2 cells. A : typical phosphoscreen image ( top ) revealing the signal of AURKA in the in vivo phosphorylated A subunit compared with the phosphorylation-deficient (S175A)

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA-dependent phosphorylation of the V-ATPase A subunit occurs at Ser-175 in Caki-2 cells. A : typical phosphoscreen image ( top ) revealing the signal of AURKA in the in vivo phosphorylated A subunit compared with the phosphorylation-deficient (S175A)

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: In Vivo

    The phosphorylation-deficient A subunit S175A mutant decreases V-ATPase-dependent extracellular acidification with AURKA activation in Caki-2 cells. A : the mean ± SE rate of extracellular acidification [(final buffer pH − initial buffer

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: The phosphorylation-deficient A subunit S175A mutant decreases V-ATPase-dependent extracellular acidification with AURKA activation in Caki-2 cells. A : the mean ± SE rate of extracellular acidification [(final buffer pH − initial buffer

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Mutagenesis, Activation Assay

    AURKA regulates V-ATPase A subunit expression at the leading edge of Caki-2 cells via Ser-175. A : representative confocal images of wound assays performed on Caki-2 cells transiently transfected with either the WT or S175A mutant A subunit in the absence

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA regulates V-ATPase A subunit expression at the leading edge of Caki-2 cells via Ser-175. A : representative confocal images of wound assays performed on Caki-2 cells transiently transfected with either the WT or S175A mutant A subunit in the absence

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Expressing, Transfection, Mutagenesis

    AURKA activation and V-ATPase Ser-175 phosphorylation increase Caki-2 cell motility. Brightfield images of untransfected Caki-2 cell confluent monolayers at 0 and 4 h postexposure to AURKA activator (anacardic acid, 25 μM) after wounding of the

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA activation and V-ATPase Ser-175 phosphorylation increase Caki-2 cell motility. Brightfield images of untransfected Caki-2 cell confluent monolayers at 0 and 4 h postexposure to AURKA activator (anacardic acid, 25 μM) after wounding of the

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Activation Assay

    AURKA regulates V-ATPase expression at the leading edge of Caki-2 cells. A : representative images of immunolabeling of Caki-2 cells after a wound assay in the absence and presence of the AURKA activator anacardic acid (25 μM) for 4 h. Incubation

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA regulates V-ATPase expression at the leading edge of Caki-2 cells. A : representative images of immunolabeling of Caki-2 cells after a wound assay in the absence and presence of the AURKA activator anacardic acid (25 μM) for 4 h. Incubation

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: Expressing, Immunolabeling, Incubation

    AURKA phosphorylates the V-ATPase A subunit in vitro. A : typical phosphoscreen image ( top ) revealing the signal of AURKA in the in vitro phosphorylated wild-type (WT) A subunit compared with S175A (phosphorylation-deficient) or S175D (phosphomimetic)

    Journal:

    Article Title: Aurora kinase A activates the vacuolar H+-ATPase (V-ATPase) in kidney carcinoma cells

    doi: 10.1152/ajprenal.00061.2016

    Figure Lengend Snippet: AURKA phosphorylates the V-ATPase A subunit in vitro. A : typical phosphoscreen image ( top ) revealing the signal of AURKA in the in vitro phosphorylated wild-type (WT) A subunit compared with S175A (phosphorylation-deficient) or S175D (phosphomimetic)

    Article Snippet: These results also support our findings reported above that active AURKA and the V-ATPase A subunit form a complex in Caki-2 cells.

    Techniques: In Vitro