l glutamine  (Lonza)


Bioz Verified Symbol Lonza is a verified supplier
Bioz Manufacturer Symbol Lonza manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    RPMI 1640 Medium without L Glutamine
    Description:
    RPMI 1640 without L Glutamine 1L
    Catalog Number:
    12-167q
    Price:
    None
    Category:
    Culture Media and Reagents
    Buy from Supplier


    Structured Review

    Lonza l glutamine
    RPMI 1640 without L Glutamine 1L
    https://www.bioz.com/result/l glutamine/product/Lonza
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l glutamine - by Bioz Stars, 2021-03
    86/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: Analysis of the association of chronic spontaneous urticaria with interlekin-4, -10, transforming growth factor-β1, interferon-γ, interleukin-17A and -23 by autologous serum skin test
    Article Snippet: .. The pellets were cultured in RPMI-1640 (BE12-167F, Lonza) medium containing 1% L-glutamine (BE17-605E, Lonza), 10% fetal bovine serum (S-0113, Biochrom) and 1% penicillin/streptomycin (DE17-602E, Lonza). ..

    Article Title: SMC5/6 acts jointly with Fanconi anemia factors to support DNA repair and genome stability
    Article Snippet: TK6 cells expressing TIR1 are a gift from Shunichi Takeda at Kyoto University. .. TK6 cells were cultured in RPMI 1640 (Cat. No. BE12‐167F, Lonza), horse serum 5% (Cat. No. 16050‐122, Life Technologies), l‐glutamine 2 mM (Cat. No. X0550, Microtech or Euroclone, Cat No. LOBE17605F), sodium pyruvate 1.8 mM (Cat. No. L0642, Microtech), and P/S (Cat. No. L0022, Microtech or Euroclone, Cat. No. ECB3001L), at 37°C. .. Genotoxic treatments were performed using mitomycin C (MMC, Cat. No. M0503, Sigma‐Aldrich), cisplatin (CDDP, Cat. No. P4394, Sigma‐Aldrich), hydroxyurea (HU, Cat. No. 400046, Sigma‐Aldrich), aphidicolin (APH, Cat. No. A0781, Sigma‐Aldrich), or formaldehyde (Cat. No. F8775, Sigma‐Aldrich) at the indicated concentrations and time periods for chronic and acute treatments.

    Article Title: Similarities and differences between helminth parasites and cancer cell lines in shaping human monocytes: Insights into parallel mechanisms of immune evasion
    Article Snippet: In vitro exposure of monocytes to cancer cell lines and live mf CMFDA labeled cancer cell lines (MDA, OVCAR and U87) were cultured for 24 hours prior to co-culture with monocytes. .. Human monocytes were cultured at 50 × 106 per 6-well plate in serum-free media RPMI 1640 medium supplemented with 20 mM glutamine (Lonza) P/S for 2 h, after which the medium was removed and the adherent cells were harvested. .. Monocytes were then either cultured alone or exposed to live mf (50,000 per million cells to reflect physiologically relevant concentrations), or to three different CMFDA labeled cancer cell lines at a 1:2 (cancer cell lines: monocytes) ratio for 48hrs.

    Article Title: Cysteine allows ovarian cancer cells to adapt to hypoxia and to escape from carboplatin cytotoxicity
    Article Snippet: ES2, OVCAR3 and OVCAR8 cell lines were cultured in DMEM (41965–039, Gibco, Life Technologies) supplemented with 1% FBS (S 0615, Merck), 1% antibiotic-antimycotic (AA) (P06–07300, PAN Biotech). .. A2780 parental and A2780 cisR cells were cultured in RPMI 1640 (BE12-167F, Lonza) supplemented with 0.58 g/L of L-glutamine, 1% FBS (S 0615, Merck) and 1% antibiotic-antimycotic (AA) (P06-07300, PAN Biotech). .. Cells were exposed to 0.4 mM L-Cysteine (102839, Merck) and/or exposed to hypoxia-induced conditions with 0.1 mM cobalt chloride (C8661, Sigma-Aldrich).

    Article Title: Identification of karanjin isolated from the Indian beech tree as a potent CYP1 enzyme inhibitor with cellular efficacy via screening of a natural product repository screening of a natural product repository †IIIM Publication number IIIM/2024/2017. ‡Electronic supplementary information (ESI) available: Experimental details and screening o
    Article Snippet: The plasmid pcDNA3.1/CYP1A1 was used along with the empty plasmid pcDNA3.1 (which contained no CYP1A1 gene) for transfection of adherent human kidney HEK293 cells. .. HEK293 cells were cultured in RPMI1640 without l -glutamine (Lonza, BE12-167F) supplemented with 4 mM l -glutamine (Invitrogen, 25030024), 10% heat-inactivated foetal bovine serum (FBS; Sigma, F6178), 1% non-essential amino acids (Sigma, M7145) and 1% penicillin–streptomycin solution (Invitrogen, 15140-122). .. Transfected and non-transfected cells (∼1 × 103 ) were seeded in a 96-well plate with different concentrations of benzo[ a ]pyrene B[ a ]P, in triplicate.

    Western Blot:

    Article Title: The Coup-TFII orphan nuclear receptor is an activator of the γ-globin gene.
    Article Snippet: Supplementary Figure 8 Putative Coup-TFII consensus sequences within the LCR Coup-TFII consensus found within the HS2, HS3 and HS4 core regions as identified by JASPAR software (3). .. Supplementary Table 1: Reagents and antibodies Reagents / Antibodies Cat No: Manufacturer Note RPMI Medium 1640 BE12-167F Lonza Phosphate-buffered saline (PBS) ECB4004L Euroclone Fetal Bovine Serum (FBS) F7524 Sigma-Aldrich L-glutamine ECB3000D Euroclone Penicillin-Streptomycin ECB3001D Euroclone Puromycin P8833 Sigma Formaldehyde F8775 Sigma Luminata Western HRP substrate WBLUR0500 Millipore TRI REAGENT AM9738 Applied Biosystems DNaseI (Rnase free) M6101 Promega High Capacity cDNA RT Kit 4368814 Applied Biosystems Anti-Sox6 (Rabbit) ab30455 Abcam Anti-Coup-TFII (Mouse) H7147 Abcam Anti-human γ globin sc-21756 SantaCruz Anti-human β globin sc-21757 SantaCruz Anti-BCL11A-XL NB-600-261 Novus Biologicals Anti-U2AF U4758 Sigma Anti-β-actin sc-130656 SantaCruz Anti-IgG (Rabbit) sc-2027X SantaCruz for ChIP Anti-IgG (Mouse) sc-2025 SantaCruz for ChIP Anti-Coup-TFII sc-271940 X SantaCruz for ChIP Anti-Sox6 AB5805 Millipore for ChIP StemPro®-34 SFM 10639-011 GIBCO Erythropoietin (Epo) PR-402 Jena Bioscience Dexamethasone D4902 Sigma-Aldrich Stem Cell Factor 250-03 Peprotech Anti-mouse (PE) conjugated CD71 113807 Biolegend Anti-mouse (FITC) conjugated Ter119 116205 Biolegend Anti-mouse (APC) conjugated CD117 105811 Biolegend Anti-mouse (PE Cy5) conjugated Ter119 116210 Biolegend Anti-mouse(PE Cy7) CD41 133915 Biolegend Anti-mouse (APC Cy7) CD16/32 101327 Biolegend Anti-human (APC) conjugated CD271 (NGFR) 345108 Biolegend Anti human (PE) conjugated CD271 (NGFR) 345106 Biolegend Anti-human (APC) conjugated CD235ab (GpA) 306607 Biolegend Anti human (PE) conjugated CD71 334105 Biolegend Mouse PE selection kit 18514 Stem Cells Technology Anti mouse globins antibodies were a kind gift from Dr. J. Palis .. Supplementary Table 2: List of Primers Primers used for RTqPCR (human genes) Gene F/R Sequence (5'-3') GAPDH F ACGGATTTGGTCGTATTGGG R TGATTTTGGAGGGATCTCGC α-globin F GAGGCCCTGGAGAGGATGTTCC R ACAGCGCGTTGGGCATGTCGTC β-globin F TACATTTGCTTCTGACACAAC R ACAGATCCCCAAAGGAC γ-globin F CTTCAAGCTCCTGGGAAATGT R GCAGAATAAAGCCTATCCTTGAAAG ε-globin F GCCTGTGGAGCAAGATGAAT R GCGGGCTTGAGGTTGT COUP-TFII F TTGACTCAGCCCGAGTACAGC R AAAGCTTTCCGAATCTCGTC Primers used for RTqPCR (mouse genes) Gene F/R Sequence (5'-3') Gapdh F TGTGTCCGTCGTGGATCTGA R CCTGCTTCACCACCTTCTTGA Hba-x F ACCATGGGTCTCAGCAGTTG R ACAGGAGCTTGAAGTTGACC Hbb-y F GGAGAGTCCATTAAGAATCTAGACAA R CTGTGAATTCATTGCCGAAGTGAC Hba-a1 F CTACCCCCAGACGAAGACCTA R CTTAACCGCATCCCCTACGG Hbb-bh1 F TGGACAACCTCAAGGAGACC R ACCTCTGGGGTGAATTCCTT Hbb-b1/b2 F ATGGCCTGAATCACTTGGAC R ACGATCATATTGCCCAGGAG Coup-TFII F TCCAAGAGCAAGTGGAGAAG R CTTCCAAAGCACACTGGGAC Primers used for Chromatin Immuno Precipitation (human sequences) Gene F/R Sequence (5'-3') HS2 LCR F CCATAGTCCAAGCATGAGCA R CTGGGGACCCAGATAGGAGT HS3 LCR F GGCAAGTGCCTTGACTCCTA R TCTTCTGGAACTTGCCTGCT HS4 LCR F TGGCATCTAGCGCAATGACTT R GGGCAAGCCATCTCATAGCTG γ-promoter F AAACGGTCCCTGGCTAAACT R GCTGAAGGGTGCTTCCTTTT sgRNAs sequences used for Coup-TFII CRISPR/Cas9-mediated knock-out sgRNA Sequence (5'-3') Addgene HG GeCKOv2 libA_39900 CCCAACCAGCCGACGAGATT Addgene HG GeCKOv2 libA_39901 TATATCCGGACAGGTACGAG

    Chromatin Immunoprecipitation:

    Article Title: The Coup-TFII orphan nuclear receptor is an activator of the γ-globin gene.
    Article Snippet: Supplementary Figure 8 Putative Coup-TFII consensus sequences within the LCR Coup-TFII consensus found within the HS2, HS3 and HS4 core regions as identified by JASPAR software (3). .. Supplementary Table 1: Reagents and antibodies Reagents / Antibodies Cat No: Manufacturer Note RPMI Medium 1640 BE12-167F Lonza Phosphate-buffered saline (PBS) ECB4004L Euroclone Fetal Bovine Serum (FBS) F7524 Sigma-Aldrich L-glutamine ECB3000D Euroclone Penicillin-Streptomycin ECB3001D Euroclone Puromycin P8833 Sigma Formaldehyde F8775 Sigma Luminata Western HRP substrate WBLUR0500 Millipore TRI REAGENT AM9738 Applied Biosystems DNaseI (Rnase free) M6101 Promega High Capacity cDNA RT Kit 4368814 Applied Biosystems Anti-Sox6 (Rabbit) ab30455 Abcam Anti-Coup-TFII (Mouse) H7147 Abcam Anti-human γ globin sc-21756 SantaCruz Anti-human β globin sc-21757 SantaCruz Anti-BCL11A-XL NB-600-261 Novus Biologicals Anti-U2AF U4758 Sigma Anti-β-actin sc-130656 SantaCruz Anti-IgG (Rabbit) sc-2027X SantaCruz for ChIP Anti-IgG (Mouse) sc-2025 SantaCruz for ChIP Anti-Coup-TFII sc-271940 X SantaCruz for ChIP Anti-Sox6 AB5805 Millipore for ChIP StemPro®-34 SFM 10639-011 GIBCO Erythropoietin (Epo) PR-402 Jena Bioscience Dexamethasone D4902 Sigma-Aldrich Stem Cell Factor 250-03 Peprotech Anti-mouse (PE) conjugated CD71 113807 Biolegend Anti-mouse (FITC) conjugated Ter119 116205 Biolegend Anti-mouse (APC) conjugated CD117 105811 Biolegend Anti-mouse (PE Cy5) conjugated Ter119 116210 Biolegend Anti-mouse(PE Cy7) CD41 133915 Biolegend Anti-mouse (APC Cy7) CD16/32 101327 Biolegend Anti-human (APC) conjugated CD271 (NGFR) 345108 Biolegend Anti human (PE) conjugated CD271 (NGFR) 345106 Biolegend Anti-human (APC) conjugated CD235ab (GpA) 306607 Biolegend Anti human (PE) conjugated CD71 334105 Biolegend Mouse PE selection kit 18514 Stem Cells Technology Anti mouse globins antibodies were a kind gift from Dr. J. Palis .. Supplementary Table 2: List of Primers Primers used for RTqPCR (human genes) Gene F/R Sequence (5'-3') GAPDH F ACGGATTTGGTCGTATTGGG R TGATTTTGGAGGGATCTCGC α-globin F GAGGCCCTGGAGAGGATGTTCC R ACAGCGCGTTGGGCATGTCGTC β-globin F TACATTTGCTTCTGACACAAC R ACAGATCCCCAAAGGAC γ-globin F CTTCAAGCTCCTGGGAAATGT R GCAGAATAAAGCCTATCCTTGAAAG ε-globin F GCCTGTGGAGCAAGATGAAT R GCGGGCTTGAGGTTGT COUP-TFII F TTGACTCAGCCCGAGTACAGC R AAAGCTTTCCGAATCTCGTC Primers used for RTqPCR (mouse genes) Gene F/R Sequence (5'-3') Gapdh F TGTGTCCGTCGTGGATCTGA R CCTGCTTCACCACCTTCTTGA Hba-x F ACCATGGGTCTCAGCAGTTG R ACAGGAGCTTGAAGTTGACC Hbb-y F GGAGAGTCCATTAAGAATCTAGACAA R CTGTGAATTCATTGCCGAAGTGAC Hba-a1 F CTACCCCCAGACGAAGACCTA R CTTAACCGCATCCCCTACGG Hbb-bh1 F TGGACAACCTCAAGGAGACC R ACCTCTGGGGTGAATTCCTT Hbb-b1/b2 F ATGGCCTGAATCACTTGGAC R ACGATCATATTGCCCAGGAG Coup-TFII F TCCAAGAGCAAGTGGAGAAG R CTTCCAAAGCACACTGGGAC Primers used for Chromatin Immuno Precipitation (human sequences) Gene F/R Sequence (5'-3') HS2 LCR F CCATAGTCCAAGCATGAGCA R CTGGGGACCCAGATAGGAGT HS3 LCR F GGCAAGTGCCTTGACTCCTA R TCTTCTGGAACTTGCCTGCT HS4 LCR F TGGCATCTAGCGCAATGACTT R GGGCAAGCCATCTCATAGCTG γ-promoter F AAACGGTCCCTGGCTAAACT R GCTGAAGGGTGCTTCCTTTT sgRNAs sequences used for Coup-TFII CRISPR/Cas9-mediated knock-out sgRNA Sequence (5'-3') Addgene HG GeCKOv2 libA_39900 CCCAACCAGCCGACGAGATT Addgene HG GeCKOv2 libA_39901 TATATCCGGACAGGTACGAG

    Selection:

    Article Title: The Coup-TFII orphan nuclear receptor is an activator of the γ-globin gene.
    Article Snippet: Supplementary Figure 8 Putative Coup-TFII consensus sequences within the LCR Coup-TFII consensus found within the HS2, HS3 and HS4 core regions as identified by JASPAR software (3). .. Supplementary Table 1: Reagents and antibodies Reagents / Antibodies Cat No: Manufacturer Note RPMI Medium 1640 BE12-167F Lonza Phosphate-buffered saline (PBS) ECB4004L Euroclone Fetal Bovine Serum (FBS) F7524 Sigma-Aldrich L-glutamine ECB3000D Euroclone Penicillin-Streptomycin ECB3001D Euroclone Puromycin P8833 Sigma Formaldehyde F8775 Sigma Luminata Western HRP substrate WBLUR0500 Millipore TRI REAGENT AM9738 Applied Biosystems DNaseI (Rnase free) M6101 Promega High Capacity cDNA RT Kit 4368814 Applied Biosystems Anti-Sox6 (Rabbit) ab30455 Abcam Anti-Coup-TFII (Mouse) H7147 Abcam Anti-human γ globin sc-21756 SantaCruz Anti-human β globin sc-21757 SantaCruz Anti-BCL11A-XL NB-600-261 Novus Biologicals Anti-U2AF U4758 Sigma Anti-β-actin sc-130656 SantaCruz Anti-IgG (Rabbit) sc-2027X SantaCruz for ChIP Anti-IgG (Mouse) sc-2025 SantaCruz for ChIP Anti-Coup-TFII sc-271940 X SantaCruz for ChIP Anti-Sox6 AB5805 Millipore for ChIP StemPro®-34 SFM 10639-011 GIBCO Erythropoietin (Epo) PR-402 Jena Bioscience Dexamethasone D4902 Sigma-Aldrich Stem Cell Factor 250-03 Peprotech Anti-mouse (PE) conjugated CD71 113807 Biolegend Anti-mouse (FITC) conjugated Ter119 116205 Biolegend Anti-mouse (APC) conjugated CD117 105811 Biolegend Anti-mouse (PE Cy5) conjugated Ter119 116210 Biolegend Anti-mouse(PE Cy7) CD41 133915 Biolegend Anti-mouse (APC Cy7) CD16/32 101327 Biolegend Anti-human (APC) conjugated CD271 (NGFR) 345108 Biolegend Anti human (PE) conjugated CD271 (NGFR) 345106 Biolegend Anti-human (APC) conjugated CD235ab (GpA) 306607 Biolegend Anti human (PE) conjugated CD71 334105 Biolegend Mouse PE selection kit 18514 Stem Cells Technology Anti mouse globins antibodies were a kind gift from Dr. J. Palis .. Supplementary Table 2: List of Primers Primers used for RTqPCR (human genes) Gene F/R Sequence (5'-3') GAPDH F ACGGATTTGGTCGTATTGGG R TGATTTTGGAGGGATCTCGC α-globin F GAGGCCCTGGAGAGGATGTTCC R ACAGCGCGTTGGGCATGTCGTC β-globin F TACATTTGCTTCTGACACAAC R ACAGATCCCCAAAGGAC γ-globin F CTTCAAGCTCCTGGGAAATGT R GCAGAATAAAGCCTATCCTTGAAAG ε-globin F GCCTGTGGAGCAAGATGAAT R GCGGGCTTGAGGTTGT COUP-TFII F TTGACTCAGCCCGAGTACAGC R AAAGCTTTCCGAATCTCGTC Primers used for RTqPCR (mouse genes) Gene F/R Sequence (5'-3') Gapdh F TGTGTCCGTCGTGGATCTGA R CCTGCTTCACCACCTTCTTGA Hba-x F ACCATGGGTCTCAGCAGTTG R ACAGGAGCTTGAAGTTGACC Hbb-y F GGAGAGTCCATTAAGAATCTAGACAA R CTGTGAATTCATTGCCGAAGTGAC Hba-a1 F CTACCCCCAGACGAAGACCTA R CTTAACCGCATCCCCTACGG Hbb-bh1 F TGGACAACCTCAAGGAGACC R ACCTCTGGGGTGAATTCCTT Hbb-b1/b2 F ATGGCCTGAATCACTTGGAC R ACGATCATATTGCCCAGGAG Coup-TFII F TCCAAGAGCAAGTGGAGAAG R CTTCCAAAGCACACTGGGAC Primers used for Chromatin Immuno Precipitation (human sequences) Gene F/R Sequence (5'-3') HS2 LCR F CCATAGTCCAAGCATGAGCA R CTGGGGACCCAGATAGGAGT HS3 LCR F GGCAAGTGCCTTGACTCCTA R TCTTCTGGAACTTGCCTGCT HS4 LCR F TGGCATCTAGCGCAATGACTT R GGGCAAGCCATCTCATAGCTG γ-promoter F AAACGGTCCCTGGCTAAACT R GCTGAAGGGTGCTTCCTTTT sgRNAs sequences used for Coup-TFII CRISPR/Cas9-mediated knock-out sgRNA Sequence (5'-3') Addgene HG GeCKOv2 libA_39900 CCCAACCAGCCGACGAGATT Addgene HG GeCKOv2 libA_39901 TATATCCGGACAGGTACGAG

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Lonza dmem f12
    UC-MSC-derived neurospheres can be generated using one-step induction. (a) UC-MSC-derived neurosphere formation at different timepoints: 2 hours, 4 hours, 6 hours, 8 hours, and 24 hours after induction. (b) Representative phase contrast images (100x) of UC-MSC-derived neurospheres formed under different regimens, including (1) EGF, bFGF only regimen: EGF and bFGF, both at 20 ng/ml; (2) complete NB (neurobasal) medium regimen (EGF and bFGF, both at 20 ng/ml, with N2 and B27 supplements); (3) half regimen: EGF and bFGF, both at 10 ng/ml, with N2 and B27 supplements; (4) EGF only regimen: EGF 20 ng/ml, no bFGF, with N2 and B27 supplements; (5) bFGF only regimen: bFGF 20 ng/ml, no EGF, with N2 and B27 supplements; (6) N2 only regimen: <t>DMEM/F12</t> with N2 supplement only, no EGF nor bFGF; and (7) B27 only regimen: DMEM/F12 with B27 supplement only, no EGF nor bFGF. Enlarged image of the black-boxed region denotes the arbitrary classification of large-, medium-, and small-sized neurospheres. Blue arrows denote irregular cell clumps. (c) Statistical analysis of large-, medium-, and small-sized neurospheres produced under different induction regimens. Neurospheres were scored in 6 random fields under the microscope at 100x magnification. n = 3. ∗∗ p
    Dmem F12, supplied by Lonza, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dmem f12/product/Lonza
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dmem f12 - by Bioz Stars, 2021-03
    93/100 stars
      Buy from Supplier

    94
    Lonza rpmi 1640
    Allogeneic T cell proliferation and IFN-γ production by stimulation with tolDC vs. antigen-loaded tolDCs. (A) Allogeneic proliferative responses of immature bone marrow-derived dendritic cells (iDCs), control matured bone marrow-derived dendritic cells (cDCs), tolDCs, tolDCs-GAD65, tolDCs-OVA, and tolDC-pept were assessed by coculture of CFSE-labeled splenocytes (6- to 8-week-old C57BL/6 females) with DCs (8-week-old non-obese diabetes females) at 10:1 ratio for 3 and 5 days. Proliferation was measured as CFSE dilution in live CD3 + cells by flow cytometry. Splenocytes cultured alone were used as a control. All experiments were carried out in the serum-supplemented <t>RPMI-1640</t> medium. Data are expressed as mean percentage of CFSElowCD3 + cells ± SEM of four experiments, ** p
    Rpmi 1640, supplied by Lonza, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpmi 1640/product/Lonza
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rpmi 1640 - by Bioz Stars, 2021-03
    94/100 stars
      Buy from Supplier

    93
    Lonza ultramem ites
    Transcript levels of taurine pathway and taurine transporter genes in ZFL cells growing in L15/FBS versus <t>UltraMEM™-ITES</t> (±taurine). Quantitative RT-PCR was performed using cDNA from 10 ng RNA and primers given in Table 2 . qPCR was performed using a 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR green fluorescent label. Reactions included Taqman™ Universal master mix (Bio-Rad, Hercules, CA, USA), 1:100 SYBR green (100 U stock), 5 μM of each primer. Expression levels of zebrafish cysteamine dioxygenase (ADO), cysteine dioxygenase (CDO), cysteine sulfinate decarboxylase (CSAD), taurine transporter protein (TauT) are expressed relative to 60S ribosomal protein L13A transcript levels. Data are presented as the mean ± S.D. ( n = 3 replicates).
    Ultramem Ites, supplied by Lonza, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultramem ites/product/Lonza
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ultramem ites - by Bioz Stars, 2021-03
    93/100 stars
      Buy from Supplier

    Image Search Results


    UC-MSC-derived neurospheres can be generated using one-step induction. (a) UC-MSC-derived neurosphere formation at different timepoints: 2 hours, 4 hours, 6 hours, 8 hours, and 24 hours after induction. (b) Representative phase contrast images (100x) of UC-MSC-derived neurospheres formed under different regimens, including (1) EGF, bFGF only regimen: EGF and bFGF, both at 20 ng/ml; (2) complete NB (neurobasal) medium regimen (EGF and bFGF, both at 20 ng/ml, with N2 and B27 supplements); (3) half regimen: EGF and bFGF, both at 10 ng/ml, with N2 and B27 supplements; (4) EGF only regimen: EGF 20 ng/ml, no bFGF, with N2 and B27 supplements; (5) bFGF only regimen: bFGF 20 ng/ml, no EGF, with N2 and B27 supplements; (6) N2 only regimen: DMEM/F12 with N2 supplement only, no EGF nor bFGF; and (7) B27 only regimen: DMEM/F12 with B27 supplement only, no EGF nor bFGF. Enlarged image of the black-boxed region denotes the arbitrary classification of large-, medium-, and small-sized neurospheres. Blue arrows denote irregular cell clumps. (c) Statistical analysis of large-, medium-, and small-sized neurospheres produced under different induction regimens. Neurospheres were scored in 6 random fields under the microscope at 100x magnification. n = 3. ∗∗ p

    Journal: Stem Cells International

    Article Title: Efficient One-Step Induction of Human Umbilical Cord-Derived Mesenchymal Stem Cells (UC-MSCs) Produces MSC-Derived Neurospheres (MSC-NS) with Unique Transcriptional Profile and Enhanced Neurogenic and Angiogenic Secretomes

    doi: 10.1155/2019/9208173

    Figure Lengend Snippet: UC-MSC-derived neurospheres can be generated using one-step induction. (a) UC-MSC-derived neurosphere formation at different timepoints: 2 hours, 4 hours, 6 hours, 8 hours, and 24 hours after induction. (b) Representative phase contrast images (100x) of UC-MSC-derived neurospheres formed under different regimens, including (1) EGF, bFGF only regimen: EGF and bFGF, both at 20 ng/ml; (2) complete NB (neurobasal) medium regimen (EGF and bFGF, both at 20 ng/ml, with N2 and B27 supplements); (3) half regimen: EGF and bFGF, both at 10 ng/ml, with N2 and B27 supplements; (4) EGF only regimen: EGF 20 ng/ml, no bFGF, with N2 and B27 supplements; (5) bFGF only regimen: bFGF 20 ng/ml, no EGF, with N2 and B27 supplements; (6) N2 only regimen: DMEM/F12 with N2 supplement only, no EGF nor bFGF; and (7) B27 only regimen: DMEM/F12 with B27 supplement only, no EGF nor bFGF. Enlarged image of the black-boxed region denotes the arbitrary classification of large-, medium-, and small-sized neurospheres. Blue arrows denote irregular cell clumps. (c) Statistical analysis of large-, medium-, and small-sized neurospheres produced under different induction regimens. Neurospheres were scored in 6 random fields under the microscope at 100x magnification. n = 3. ∗∗ p

    Article Snippet: We found that complete neurobasal medium induction which is comprised of DMEM/F12, EGF, bFGF (both at 20 ng/ml), and N2 and B27 supplements led to the most prominent neurosphere production.

    Techniques: Derivative Assay, Generated, Produced, Microscopy

    Allogeneic T cell proliferation and IFN-γ production by stimulation with tolDC vs. antigen-loaded tolDCs. (A) Allogeneic proliferative responses of immature bone marrow-derived dendritic cells (iDCs), control matured bone marrow-derived dendritic cells (cDCs), tolDCs, tolDCs-GAD65, tolDCs-OVA, and tolDC-pept were assessed by coculture of CFSE-labeled splenocytes (6- to 8-week-old C57BL/6 females) with DCs (8-week-old non-obese diabetes females) at 10:1 ratio for 3 and 5 days. Proliferation was measured as CFSE dilution in live CD3 + cells by flow cytometry. Splenocytes cultured alone were used as a control. All experiments were carried out in the serum-supplemented RPMI-1640 medium. Data are expressed as mean percentage of CFSElowCD3 + cells ± SEM of four experiments, ** p

    Journal: Frontiers in Immunology

    Article Title: Antigen Loading (e.g., Glutamic Acid Decarboxylase 65) of Tolerogenic DCs (tolDCs) Reduces Their Capacity to Prevent Diabetes in the Non-Obese Diabetes (NOD)-Severe Combined Immunodeficiency Model of Adoptive Cotransfer of Diabetes As Well As in NOD Mice

    doi: 10.3389/fimmu.2018.00290

    Figure Lengend Snippet: Allogeneic T cell proliferation and IFN-γ production by stimulation with tolDC vs. antigen-loaded tolDCs. (A) Allogeneic proliferative responses of immature bone marrow-derived dendritic cells (iDCs), control matured bone marrow-derived dendritic cells (cDCs), tolDCs, tolDCs-GAD65, tolDCs-OVA, and tolDC-pept were assessed by coculture of CFSE-labeled splenocytes (6- to 8-week-old C57BL/6 females) with DCs (8-week-old non-obese diabetes females) at 10:1 ratio for 3 and 5 days. Proliferation was measured as CFSE dilution in live CD3 + cells by flow cytometry. Splenocytes cultured alone were used as a control. All experiments were carried out in the serum-supplemented RPMI-1640 medium. Data are expressed as mean percentage of CFSElowCD3 + cells ± SEM of four experiments, ** p

    Article Snippet: The fresh isolated cells were subsequently cultured (37°C, 5% CO2 ) in Petri cell-culture dishes (90 mm in diameter) in complete prewarmed l -glutamine containing RPMI-1640 (Lonza, Verviers, Belgium) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco-Life Technologies, Paisley, UK), 100× diluted NEM-Non-essential amino acid (Sigma-Aldrich), 1 µM sodium pyruvate (Sigma-Aldrich), 50 IU/mL penicillin, 50 µg/mL streptomycin, and 50 µM 2-β-mercaptoethanol.

    Techniques: Derivative Assay, Labeling, Flow Cytometry, Cytometry, Cell Culture

    Transcript levels of taurine pathway and taurine transporter genes in ZFL cells growing in L15/FBS versus UltraMEM™-ITES (±taurine). Quantitative RT-PCR was performed using cDNA from 10 ng RNA and primers given in Table 2 . qPCR was performed using a 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR green fluorescent label. Reactions included Taqman™ Universal master mix (Bio-Rad, Hercules, CA, USA), 1:100 SYBR green (100 U stock), 5 μM of each primer. Expression levels of zebrafish cysteamine dioxygenase (ADO), cysteine dioxygenase (CDO), cysteine sulfinate decarboxylase (CSAD), taurine transporter protein (TauT) are expressed relative to 60S ribosomal protein L13A transcript levels. Data are presented as the mean ± S.D. ( n = 3 replicates).

    Journal: Marine Drugs

    Article Title: Taurine Biosynthesis in a Fish Liver Cell Line (ZFL) Adapted to a Serum-Free Medium

    doi: 10.3390/md15060147

    Figure Lengend Snippet: Transcript levels of taurine pathway and taurine transporter genes in ZFL cells growing in L15/FBS versus UltraMEM™-ITES (±taurine). Quantitative RT-PCR was performed using cDNA from 10 ng RNA and primers given in Table 2 . qPCR was performed using a 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR green fluorescent label. Reactions included Taqman™ Universal master mix (Bio-Rad, Hercules, CA, USA), 1:100 SYBR green (100 U stock), 5 μM of each primer. Expression levels of zebrafish cysteamine dioxygenase (ADO), cysteine dioxygenase (CDO), cysteine sulfinate decarboxylase (CSAD), taurine transporter protein (TauT) are expressed relative to 60S ribosomal protein L13A transcript levels. Data are presented as the mean ± S.D. ( n = 3 replicates).

    Article Snippet: A commercially available serum-free medium, UltraMEM™-ITES (Lonza, Walkersville, MD, USA) was assessed for suitability.

    Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, SYBR Green Assay, Expressing

    Doubling times of adult zebrafish liver cell line (ZFL) cells during adaptation to growth in UltraMEM™-ITES. ZFL cells were exchanged into decreasing percentages of L15-FBS and increasing percentages of UltraMEM™-ITES. Medium substitutions were made every second passage. Cell counts were taken every 2–8 days. Doubling times were calculated for ZFL growing in L15-FBS alone (blue diamonds), in L15-FBS supplemented with a range of UltraMEM™-ITES concentrations (red squares), or in UltraMEM™-ITES, HEPES-KOH supplemented with 2 mM taurine (green triangles).

    Journal: Marine Drugs

    Article Title: Taurine Biosynthesis in a Fish Liver Cell Line (ZFL) Adapted to a Serum-Free Medium

    doi: 10.3390/md15060147

    Figure Lengend Snippet: Doubling times of adult zebrafish liver cell line (ZFL) cells during adaptation to growth in UltraMEM™-ITES. ZFL cells were exchanged into decreasing percentages of L15-FBS and increasing percentages of UltraMEM™-ITES. Medium substitutions were made every second passage. Cell counts were taken every 2–8 days. Doubling times were calculated for ZFL growing in L15-FBS alone (blue diamonds), in L15-FBS supplemented with a range of UltraMEM™-ITES concentrations (red squares), or in UltraMEM™-ITES, HEPES-KOH supplemented with 2 mM taurine (green triangles).

    Article Snippet: A commercially available serum-free medium, UltraMEM™-ITES (Lonza, Walkersville, MD, USA) was assessed for suitability.

    Techniques:

    Effect of methionine concentration in culture medium on response of ZFL cells to taurine. Panel ( A ): UltraMEM™-ITES adapted ZFL cells were grown in L-15/FBS (blue diamonds), or UltraMEM™-ITES supplemented with 0 (red squares) or 2 mM taurine (green triangles). Panel ( B ): UltraMEM™-ITES adapted ZFL cells were grown in L-15/FBS (blue diamonds), or UltraMEM™-ITES/500 supplemented with 0 μM (red squares), 12 μM (green triangles), or 160 μM taurine (pink circles). Cells were counted daily. Fifty percent (50%) of each medium was replaced every other day. Data are presented as the mean ± S.D. ( n = 3 replicates).

    Journal: Marine Drugs

    Article Title: Taurine Biosynthesis in a Fish Liver Cell Line (ZFL) Adapted to a Serum-Free Medium

    doi: 10.3390/md15060147

    Figure Lengend Snippet: Effect of methionine concentration in culture medium on response of ZFL cells to taurine. Panel ( A ): UltraMEM™-ITES adapted ZFL cells were grown in L-15/FBS (blue diamonds), or UltraMEM™-ITES supplemented with 0 (red squares) or 2 mM taurine (green triangles). Panel ( B ): UltraMEM™-ITES adapted ZFL cells were grown in L-15/FBS (blue diamonds), or UltraMEM™-ITES/500 supplemented with 0 μM (red squares), 12 μM (green triangles), or 160 μM taurine (pink circles). Cells were counted daily. Fifty percent (50%) of each medium was replaced every other day. Data are presented as the mean ± S.D. ( n = 3 replicates).

    Article Snippet: A commercially available serum-free medium, UltraMEM™-ITES (Lonza, Walkersville, MD, USA) was assessed for suitability.

    Techniques: Concentration Assay