Structured Review

TaKaRa kpn i
Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total <t>DNA</t> either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P
Kpn I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kpn i/product/TaKaRa
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
kpn i - by Bioz Stars, 2019-12
99/100 stars

Images

1) Product Images from "Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit"

Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit

Journal: Scientific Reports

doi: 10.1038/srep41851

Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total DNA either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P
Figure Legend Snippet: Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total DNA either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P

Techniques Used: Infection, Transfection, Mutagenesis, Expressing, Southern Blot, Plasmid Preparation, Real-time Polymerase Chain Reaction

2) Product Images from "Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo"

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo

Journal:

doi: 10.3748/wjg.v10.i19.2874

Detection of the recombinant plasmid pVAX-sEN using Eco R I and Kpn I digestion. A: Marker15000; B: pVAX1 digested by Eco R I; C: Recombinant plasmid pVAX-sEN digested by Eco R I; D: Recombinant plasmid pVAX-sEN digested by Eco R I and Kpn I.
Figure Legend Snippet: Detection of the recombinant plasmid pVAX-sEN using Eco R I and Kpn I digestion. A: Marker15000; B: pVAX1 digested by Eco R I; C: Recombinant plasmid pVAX-sEN digested by Eco R I; D: Recombinant plasmid pVAX-sEN digested by Eco R I and Kpn I.

Techniques Used: Recombinant, Plasmid Preparation

3) Product Images from "Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition"

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition

Journal: Plant Molecular Biology Reporter / Ispmb

doi: 10.1007/s11105-015-0948-9

Kanamycin-resistant shoots, GUS histochemical detection, and PCR analysis. a WT shoots. b Kanamycin-resistant shoots. Black arrows show epiphyllous shoots. c WT shoots. d GUS-positive shoots and leaves. e PCR analysis of transgenic Asakura-sanshoo plants. M DL2000 DNA marker, WT DNA from non-transgenic plant, P plasmid, 1–5 transgenic lines. f Southern blotting analysis. P pBin-Ex-Hipt plasmid; WT genomic DNA from non-transgenic plant; Y1 , Y17 , Y5 , and Y16 genomic DNA from transgenic lines. Genomic DNA from all lines and plasmid DNA were digested with Eco RI and Kpn I
Figure Legend Snippet: Kanamycin-resistant shoots, GUS histochemical detection, and PCR analysis. a WT shoots. b Kanamycin-resistant shoots. Black arrows show epiphyllous shoots. c WT shoots. d GUS-positive shoots and leaves. e PCR analysis of transgenic Asakura-sanshoo plants. M DL2000 DNA marker, WT DNA from non-transgenic plant, P plasmid, 1–5 transgenic lines. f Southern blotting analysis. P pBin-Ex-Hipt plasmid; WT genomic DNA from non-transgenic plant; Y1 , Y17 , Y5 , and Y16 genomic DNA from transgenic lines. Genomic DNA from all lines and plasmid DNA were digested with Eco RI and Kpn I

Techniques Used: Polymerase Chain Reaction, Transgenic Assay, Marker, Plasmid Preparation, Southern Blot

4) Product Images from "Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification"

Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification

Journal: PLoS ONE

doi: 10.1371/journal.pone.0111094

LAMP detection of the Bcos5 gene in B. cinerea and digestion of positive LAMP products. (a) LAMP for detection of B. cinerea using HNB as a visual indicator. The reaction becomes sky blue if the Bcos5 gene is present but remains violet if the gene is absent; (b) Agarose gel electrophoresis of LAMP products. The positive reaction is manifested as a ladder-like pattern on the 3.0% agarose gel. In (a) and (b), the positive reaction (with target DNA) is labeled “1″, and the negative reaction (without target DNA) is labeled “2″; (c), LAMP products were digested with Kpn I, and two fragments (153 bp, 49 bp) were observed by 3.0% agarose gel. M = 100-bp ladder, 1, LAMP products without digestion; 2, LAMP products digested by Kpn I.
Figure Legend Snippet: LAMP detection of the Bcos5 gene in B. cinerea and digestion of positive LAMP products. (a) LAMP for detection of B. cinerea using HNB as a visual indicator. The reaction becomes sky blue if the Bcos5 gene is present but remains violet if the gene is absent; (b) Agarose gel electrophoresis of LAMP products. The positive reaction is manifested as a ladder-like pattern on the 3.0% agarose gel. In (a) and (b), the positive reaction (with target DNA) is labeled “1″, and the negative reaction (without target DNA) is labeled “2″; (c), LAMP products were digested with Kpn I, and two fragments (153 bp, 49 bp) were observed by 3.0% agarose gel. M = 100-bp ladder, 1, LAMP products without digestion; 2, LAMP products digested by Kpn I.

Techniques Used: Agarose Gel Electrophoresis, Labeling

5) Product Images from "Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species"

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species

Journal: Scientific Reports

doi: 10.1038/s41598-017-07084-0

Southern blot analysis to determine TaARG copy number in the common wheat genome. ( A ) Bam HI-digested genomic DNA of CB037; ( B ) Kpn I-digested genomic DNA of CB037. acquisition tools and image processing software package. The photo was acquired by Tanon 5200 software (YPH-bio, Co. Ltd. Beijing, China).
Figure Legend Snippet: Southern blot analysis to determine TaARG copy number in the common wheat genome. ( A ) Bam HI-digested genomic DNA of CB037; ( B ) Kpn I-digested genomic DNA of CB037. acquisition tools and image processing software package. The photo was acquired by Tanon 5200 software (YPH-bio, Co. Ltd. Beijing, China).

Techniques Used: Southern Blot, Software

6) Product Images from "Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter"

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms17010119

Verification of mouse Omi/HtrA2 promoter luciferase expression plasmids. Plasmids were verified by double enzyme digestion with Kpn I and Hind III, which releases a vector fragment and a variable-sized promoter insert. M: DL2000 Marker; 1 : pGL3-239; 2 : pGL3-472; 3 : pGL3-742; 4 : pGL3-931; 5 : pGL3-1298. Luc: luciferase expression plasmids.
Figure Legend Snippet: Verification of mouse Omi/HtrA2 promoter luciferase expression plasmids. Plasmids were verified by double enzyme digestion with Kpn I and Hind III, which releases a vector fragment and a variable-sized promoter insert. M: DL2000 Marker; 1 : pGL3-239; 2 : pGL3-472; 3 : pGL3-742; 4 : pGL3-931; 5 : pGL3-1298. Luc: luciferase expression plasmids.

Techniques Used: Luciferase, Expressing, Plasmid Preparation, Marker

7) Product Images from "Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries"

Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries

Journal: Acta Pharmacologica Sinica

doi: 10.1038/aps.2009.152

AGE and HPLC analysis of purified pGJA-P/VAX(G). (A) AGE after restriction endonuclease digestion. pGJA-P/VAX(G) digested by Kpn I (Lane 1); Xho I (Lane 2); both Xho I and Nhe I (Lane 3); Nhe I (Lane 4). Lane 5 represents the DNA marker λ Hind III. (B)HPLC analysis of purified pGJA-P/VAX(G). Peak 1: open circular topology; Peak 2: supercoiled topology.
Figure Legend Snippet: AGE and HPLC analysis of purified pGJA-P/VAX(G). (A) AGE after restriction endonuclease digestion. pGJA-P/VAX(G) digested by Kpn I (Lane 1); Xho I (Lane 2); both Xho I and Nhe I (Lane 3); Nhe I (Lane 4). Lane 5 represents the DNA marker λ Hind III. (B)HPLC analysis of purified pGJA-P/VAX(G). Peak 1: open circular topology; Peak 2: supercoiled topology.

Techniques Used: High Performance Liquid Chromatography, Purification, Marker

Related Articles

Clone Assay:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Article Snippet: PCR products and pVAX1 were digested by Eco R I and Kpn I (TaKaRa Biotechnology, Dalian) respectively, then purifed and ligased with T4DNA ligase (TaKaRa Biotechnology, Dalian) at room temperature overnight. .. E.coli , DH5α, competent cells were transfected using CaCl2 .

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: The resulting plasmid, which contains LGR5 upstream 1155 bp was named pGL4.12-Lgr5up1155bp. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Kpn I (T4-DNA-Polymerase (Takara) blunted)-Spe I sites of pTK4.12 and pGL4.12-LGR5up1155bp. .. For pGL4.12-inverted tandem repeats-MUC5ACup1433bp, Pci I (Klenow blunted)-Nhe I fragment of pGL4.12-MUC5ACup3000bp was cloned into Kpn I (T4-DNA-Polymerase blunted)-Nhe I site of pGL4.12-MUC5ACup1433bp.

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: PCR amplicons with the expected size (~270 bp) were cloned and sequenced. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 . .. The expression plasmid for MIA3/TANGO1 , pcDNA3.1(+)-TANGO1-HA, was as described previously [ – ] and kindly provided by Dr. Vivek Malhotra and colleagues.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively.

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively. .. Then pSC101-sRNA, pSC101-anti(sthA), pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively, was transformed into strain Ec/Lau C4H-Ath PAL cells to obtain the recombinant strain Ec/Lau C4H-Ath PAL-sRNA, Ec/Lau C4H-Ath PAL-anti(sthA), Ec/Lau C4H-Ath PAL-PntAB, and Ec/Lau C4H-Ath PAL-PntAB-anti(sthA).

Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor
Article Snippet: Paragraph title: Cloning of fDAF ... Both DAF 5′ and DAF 3′ were digested with Nco I and Kpn I (Takara), and then the 5′ product was ligated to the 3′ sequence to produce the full-length fDAF sequence (GenBank accession number: AB773827).

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt). .. Another two sense primers were used to construct the other two luciferase reporter plasmids: IL-8 pro M (−765nt to +44nt) and IL-8 pro S (−176nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The empty pcDNA3.1 (+) plasmid without any insertion fragment was set as negative control (OV-NC).

Luciferase:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: Paragraph title: Luciferase reporter assay ... For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Kpn I (T4-DNA-Polymerase (Takara) blunted)-Spe I sites of pTK4.12 and pGL4.12-LGR5up1155bp.

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt). .. Another two sense primers were used to construct the other two luciferase reporter plasmids: IL-8 pro M (−765nt to +44nt) and IL-8 pro S (−176nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Reporter Assay:

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: Paragraph title: Luciferase reporter assay ... For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Kpn I (T4-DNA-Polymerase (Takara) blunted)-Spe I sites of pTK4.12 and pGL4.12-LGR5up1155bp.

Polymerase Chain Reaction:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Article Snippet: Reaction conditions were at 95 °C for 5 min, then 30 cycles each at 95 °C for 1 min, at 62 °C for 1 min, at 72 °C for 3 min, followed by a final extension at 72 °C for 5 min. PCR products were purified by UNIQUE-10 Kit (Shanghai Shenggong Biological Co.Ltd) after 20 g/L agarose gel electrophoresis. .. PCR products and pVAX1 were digested by Eco R I and Kpn I (TaKaRa Biotechnology, Dalian) respectively, then purifed and ligased with T4DNA ligase (TaKaRa Biotechnology, Dalian) at room temperature overnight. .. E.coli , DH5α, competent cells were transfected using CaCl2 .

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: PCR amplicons with the expected size (~270 bp) were cloned and sequenced. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 . .. The expression plasmid for MIA3/TANGO1 , pcDNA3.1(+)-TANGO1-HA, was as described previously [ – ] and kindly provided by Dr. Vivek Malhotra and colleagues.

Article Title: Circulating granulysin levels in healthcare workers and latent tuberculosis infection estimated using interferon-gamma release assays
Article Snippet: A non-synonymous SNP rs11127 (C/T) of the exon 4 (NM_006433.4) was selected and genotyped as a representative SNP. .. Genomic DNA was amplified using the primers 5′-GGAGGTATCAGTCTAGAG G TA-3′ and 5′-GCTAAAGTCCATCTGCTCAA-3′, and a mismatch nucleotide (bold) was introduced in the sense primer to generate a Kpn I restriction enzyme site when the rs11127 allele was C. Genotype was determined according to the length of PCR products after digestion with Kpn I (TaKaRa) and C and T alleles gave 207- and 229-bp fragments, respectively. .. Proportions between two study groups were compared using the chi-squared test.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: The target gene spd1590 was cloned from S. pneumoniae D39 genomic DNA by PCR. .. The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively. .. Next, the fragments were ligated with the ClonExpress II One Step Cloning Kit (Vazyme, China) to construct the fusion plasmid pBAD/HisA-1590.

Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor
Article Snippet: PCR was performed using Ex Taq DNA polymerase, and the PCR product was then ligated into the pGEM-T Easy vector. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Kpn I (Takara), and then the 5′ product was ligated to the 3′ sequence to produce the full-length fDAF sequence (GenBank accession number: AB773827).

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 cDNA fragment containing complete coding DNA sequence (CDS) region was obtained from the total RNA of WPMY-1 cells by reverse transcription and PCR amplification. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing. .. Pme I enzyme (New England BioLabs, Inc., Ipswich, MA, USA) was used to linearly cut pAdTrack-ScFv shuttle plasmid.

Construct:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively. .. Next, the fragments were ligated with the ClonExpress II One Step Cloning Kit (Vazyme, China) to construct the fusion plasmid pBAD/HisA-1590.

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: Then, the plasmid skeleton and the PR -MicC-BBa_B0015 fragment were assembled by ClonExpress One Step Cloning Kit (Vazyme Biotech) to construct the new plasmid pSC101-sRNA for synthetic sRNA production. .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively.

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt). .. Another two sense primers were used to construct the other two luciferase reporter plasmids: IL-8 pro M (−765nt to +44nt) and IL-8 pro S (−176nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: Through Tag enzyme amplification, ScFv was linked into pMD-19T (both from Takara Biotechnology Co., Ltd., Dalian, China), and Sanger DNA sequencing technology (Thermo Fisher Scientific, Inc.) was used to identify successfully constructed pMD-19T-ScFv. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing.

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The empty pcDNA3.1 (+) plasmid without any insertion fragment was set as negative control (OV-NC).

Electrophoresis:

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Incubation:

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence. .. 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence.

Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification
Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing Kpn I (1 µL) (Takara), 10×L Buffer (2 µL), LAMP products (8 µL), and ddH2 O (9 µL), incubated at 37°C overnight, after which the DNA band were analyzed on 3% agarose gel electrophoresis stained with ethidium bromide and photographed as above. .. LAMP specificity was verified by performing the assay of DNA of B. cinerea and other important plant-pathogenic fungi in agricultural production, including Sclerotinia sclerotiorum , Fusarium graminearum , Rhizoctonia cerealis , Rhizoctonia solani , Verticillium dahliae , Alternaria alternata , Colletotrichum gloesporioides , and Magnaporthe grisea .

Amplification:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The PCR amplification protocol was as follows: denaturation at 94 °C for 2 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 62.4 °C for 45 s, and extension at 68 °C for 30–90 s (according to the fragment length of PCR products, about 1 kb/1 min); and final extension at 68 °C for 10 min. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: These primers amplified a 248-bp fragment of the IPT gene sequence. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: To yield LGR5 upstream plasmids, 2000 bp of LGR5 promoter region was amplified from TIG-112 genome using the primers: 5′- CAAACTCGAGGGGTAGGAGAAGGGTGTGGG -3′ and 5′- TCATGGATCCGGTGCCCGAAGTAGGGGGCC -3′, treated with Bam HI and Xho I, and cloned into Bgl II-Xho I site of pGL4.12. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Kpn I (T4-DNA-Polymerase (Takara) blunted)-Spe I sites of pTK4.12 and pGL4.12-LGR5up1155bp.

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: Partial reverse transcriptase (RT) fragments of Ty1/copia -like retrotransposons in E. agallocha were amplified using degenerate primer pairs corresponding to the “KTAFLH/NG” and “LLYVDDM/V” conserved motifs (Voytas et al., ). .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full length cDNA for AR was amplified by PCR analysis using pEZ-M02 AR as the template and primers AR (920aa) 2763 bp F- BglII : 5′-GGAAGATCTGGATGGAAGTGCAGTTAGGGCTGGG-3’and R- XhoI :5′-CCGCTCGAGTCACTGGGTGTGGAAATAGATGGGCT-3′. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 .

Article Title: Circulating granulysin levels in healthcare workers and latent tuberculosis infection estimated using interferon-gamma release assays
Article Snippet: A non-synonymous SNP rs11127 (C/T) of the exon 4 (NM_006433.4) was selected and genotyped as a representative SNP. .. Genomic DNA was amplified using the primers 5′-GGAGGTATCAGTCTAGAG G TA-3′ and 5′-GCTAAAGTCCATCTGCTCAA-3′, and a mismatch nucleotide (bold) was introduced in the sense primer to generate a Kpn I restriction enzyme site when the rs11127 allele was C. Genotype was determined according to the length of PCR products after digestion with Kpn I (TaKaRa) and C and T alleles gave 207- and 229-bp fragments, respectively. .. Proportions between two study groups were compared using the chi-squared test.

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively. .. Then pSC101-sRNA, pSC101-anti(sthA), pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively, was transformed into strain Ec/Lau C4H-Ath PAL cells to obtain the recombinant strain Ec/Lau C4H-Ath PAL-sRNA, Ec/Lau C4H-Ath PAL-anti(sthA), Ec/Lau C4H-Ath PAL-PntAB, and Ec/Lau C4H-Ath PAL-PntAB-anti(sthA).

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The ScFv was amplified by PCR using pMD-19T-ScFv as a template, and the following primers were used: upstream primer (5′-ATAGGTACCGCCACCATGCAGGTGCAACTGCAGGA-3′ containing the Kpn I site, GGTACC) and downstream primer (5′-GGCAAGCTTTTAGTTTGATTTCCAGCTTGGTC-3 containing the Hin dIII site, AAGCTT). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing.

Cell Culture:

Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries
Article Snippet: After being cultured at 30 °C for 6–12 h, the upper layer of the double-decker agar plate was checked for phage plaque. .. Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively. .. The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively.

Expressing:

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Kpn I (TaKaRa Biotechnology, Dalian) respectively, then purifed and ligased with T4DNA ligase (TaKaRa Biotechnology, Dalian) at room temperature overnight.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 . .. The expression plasmid for MIA3/TANGO1 , pcDNA3.1(+)-TANGO1-HA, was as described previously [ – ] and kindly provided by Dr. Vivek Malhotra and colleagues.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively.

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: Human Smad3 expression plasmid (pcDNA3.1-Smad3) was gifted from Prof. Rujun Gong (Brown University, RI, USA). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

Transformation Assay:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Over Expression:

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively.

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: The cDNA fragment was cloned into vector PCDNA3.1 (+) with the restriction enzymes BamH I and Xho I (Takara, Japan) and the over-expression plasmid was named PCDNA3.1-IL8. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The empty pcDNA3.1 (+) plasmid without any insertion fragment was set as negative control (OV-NC).

Hybridization:

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence. .. The digested products were fractionated by 0.8% agarose gel electrophoresis and transferred onto a nylon membrane (Roche, Japan).

Transfection:

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Paragraph title: Plasmids and transfection ... The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: Paragraph title: Construction and Cell Transfection ... The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR).

Inverse PCR:

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: Among them, 25 sequences with a sequence identity of 90–100% were used to design primers for the subsequent inverse PCR. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA. .. The sequence assembly was conducted using Lasergene (DNASTAR, Inc., Madison, WI, USA), requiring a minimum overlap of 150 bp and a nucleotide identity over 90%.

Southern Blot:

Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Kpn I (Takara Bio, Inc., Shiga, Japan) at 37 °C for 4 h, while DNA from plasmid-transfected cells was treated with both 100 U Hind III (New England Biolabs, Inc., MA, USA) and 100 U Dpn I (New England Biolabs, Inc., MA, USA) at 37 °C for 4 h. Southern blot analysis was then perfomed as described in Maekawa et al . .. Huh-7 cells were infected with Ax-CM103G-ΔpreS or Ax-CM103G-dP at MOI 10, and seeded in a 96-well microplate at 3 × 104 cells per well in 100 μl of high-glucose DMEM supplemented with 5% FCS.

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Article Snippet: Paragraph title: Southern blotting analysis ... 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Ligation:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Protease Inhibitor:

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

SYBR Green Assay:

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: PVDF Membranes and iQTM SYBR® Green qPCR kits were from Bio-rad Inc. (Hercules, CA, USA). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

Infection:

Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Article Snippet: HepG2 cells in a 6 well plate were infected with AdVs. .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Kpn I (Takara Bio, Inc., Shiga, Japan) at 37 °C for 4 h, while DNA from plasmid-transfected cells was treated with both 100 U Hind III (New England Biolabs, Inc., MA, USA) and 100 U Dpn I (New England Biolabs, Inc., MA, USA) at 37 °C for 4 h. Southern blot analysis was then perfomed as described in Maekawa et al .

Generated:

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

DNA Sequencing:

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively. .. Next, the fragments were ligated with the ClonExpress II One Step Cloning Kit (Vazyme, China) to construct the fusion plasmid pBAD/HisA-1590.

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: Through Tag enzyme amplification, ScFv was linked into pMD-19T (both from Takara Biotechnology Co., Ltd., Dalian, China), and Sanger DNA sequencing technology (Thermo Fisher Scientific, Inc.) was used to identify successfully constructed pMD-19T-ScFv. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing.

DNA Labeling:

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 .

Recombinant:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Kpn I (TaKaRa Biotechnology, Dalian) respectively, then purifed and ligased with T4DNA ligase (TaKaRa Biotechnology, Dalian) at room temperature overnight.

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing. .. Pme I enzyme (New England BioLabs, Inc., Ipswich, MA, USA) was used to linearly cut pAdTrack-ScFv shuttle plasmid.

Mutagenesis:

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The primers for mutagenesis from TGTTCT to TAAAAA included a forward primer 5′-TGCATATACCACTTCCTTAAAAAGAGCTGGTATACTTTCC-3′ and a reverse primer 5′-GGAAAGTATACCAGTTCTTTTTAAGGAAGTGGTATATGCA-3′ (for pGL3-Basic-ADTRPp-Luc-Mut 2). .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 .

Isolation:

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: Paragraph title: Isolation and characterization of EARE-1 ... The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 .

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Size-exclusion Chromatography:

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The PCR reaction program started with 5 min at 94°C, which was followed by 30 cycles of 30 sec at 94°C, 30 sec at 56°C and 1 min at 72°C, and a final extension at 72°C for 7 min. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing.

Purification:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively.

Sequencing:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Article Snippet: In brief, a probe was designed to hybridize to the ~250 bp upstream and downstream regions flanking the stop codon (Table ). .. 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence. .. The 50 μl digestion reaction contained 10 μg gDNA, 5 μl 10× Buffer and was incubated overnight at 37 °C.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: These primers amplified a 248-bp fragment of the IPT gene sequence. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer
Article Snippet: The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA.

Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor
Article Snippet: Four independent clones were sequenced, and we identified the 5′ sequence downstream of the start codon. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Kpn I (Takara), and then the 5′ product was ligated to the 3′ sequence to produce the full-length fDAF sequence (GenBank accession number: AB773827). .. A homology search of human DAF (hDAF; NP_000565), mouse DAF (mDAF; NP_034146), and swine DAF (sDAF; NP_998980) with fDAF was performed using NCBI’s BLAST.

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 cDNA fragment containing complete coding DNA sequence (CDS) region was obtained from the total RNA of WPMY-1 cells by reverse transcription and PCR amplification. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing. .. Pme I enzyme (New England BioLabs, Inc., Ipswich, MA, USA) was used to linearly cut pAdTrack-ScFv shuttle plasmid.

Protein Extraction:

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The cells were seeded into 12-well plates in triplicate and transfected with OV-TTR, OV-NC on 7 day after adipogenic induction, respectively.

Bradford Protein Assay:

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: Bradford Protein Assay Kits were from Beyotime (Beijing, China). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

Gel Extraction:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Plasmid Preparation:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. The ligation mixtures, including 0.3 μg of recombinant fragments (Kpn I/Hind III), 0.1 μg of pGL3-basic plasmid (Kpn I/Hind III), 1 μL of 10× buffer M, and 1U of T4 ligase in a final volume of 10 μL, were incubated at 16 °C overnight and then 65 °C for 5 min.

Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Kpn I (Takara Bio, Inc., Shiga, Japan) at 37 °C for 4 h, while DNA from plasmid-transfected cells was treated with both 100 U Hind III (New England Biolabs, Inc., MA, USA) and 100 U Dpn I (New England Biolabs, Inc., MA, USA) at 37 °C for 4 h. Southern blot analysis was then perfomed as described in Maekawa et al . .. Huh-7 cells were infected with Ax-CM103G-ΔpreS or Ax-CM103G-dP at MOI 10, and seeded in a 96-well microplate at 3 × 104 cells per well in 100 μl of high-glucose DMEM supplemented with 5% FCS.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Southern blot analysis was according to the protocol of Southern ( ). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. The digested genomic DNA and plasmid DNA were separated by 1.0 % agarose gel electrophoresis and transferred onto a Hybond N+ membrane.

Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries
Article Snippet: Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp. .. Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp.

Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Kpn I (TaKaRa Biotechnology, Dalian) respectively, then purifed and ligased with T4DNA ligase (TaKaRa Biotechnology, Dalian) at room temperature overnight.

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: The resulting plasmid, which contains LGR5 upstream 1155 bp was named pGL4.12-Lgr5up1155bp. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Kpn I (T4-DNA-Polymerase (Takara) blunted)-Spe I sites of pTK4.12 and pGL4.12-LGR5up1155bp.

Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription
Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Kpn I (TAKARA, Japan) and sub-cloned into the multiple cloning site of pCDNA3.1(−), resulting in an expression plasmid for PIK3R3 , pCDNA3.1(−)- PIK3R3 . .. The expression plasmid for MIA3/TANGO1 , pcDNA3.1(+)-TANGO1-HA, was as described previously [ – ] and kindly provided by Dr. Vivek Malhotra and colleagues.

Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties
Article Snippet: The target gene spd1590 was cloned from S. pneumoniae D39 genomic DNA by PCR. .. The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Kpn I (TaKaRa, Japan), respectively. .. Next, the fragments were ligated with the ClonExpress II One Step Cloning Kit (Vazyme, China) to construct the fusion plasmid pBAD/HisA-1590.

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: Then, the plasmid skeleton and the PR -MicC-BBa_B0015 fragment were assembled by ClonExpress One Step Cloning Kit (Vazyme Biotech) to construct the new plasmid pSC101-sRNA for synthetic sRNA production. .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively.

Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor
Article Snippet: PCR was performed using Ex Taq DNA polymerase, and the PCR product was then ligated into the pGEM-T Easy vector. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Kpn I (Takara), and then the 5′ product was ligated to the 3′ sequence to produce the full-length fDAF sequence (GenBank accession number: AB773827).

Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression
Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Kpn I and Bgl II (Takara, Japan) to construct the luciferase reporter plasmid IL-8 pro L (−1481nt to +44nt). .. Another two sense primers were used to construct the other two luciferase reporter plasmids: IL-8 pro M (−765nt to +44nt) and IL-8 pro S (−176nt to +44nt).

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes. .. This plasmid was named pGL3-2000.

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: Human Smad3 expression plasmid (pcDNA3.1-Smad3) was gifted from Prof. Rujun Gong (Brown University, RI, USA). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling
Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Kpn I and Hin dIII enzyme (Takara Biotechnology Co., Ltd.) restriction digestion and sequencing. .. Pme I enzyme (New England BioLabs, Inc., Ipswich, MA, USA) was used to linearly cut pAdTrack-ScFv shuttle plasmid.

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The empty pcDNA3.1 (+) plasmid without any insertion fragment was set as negative control (OV-NC).

Real-time Polymerase Chain Reaction:

Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression
Article Snippet: PVDF Membranes and iQTM SYBR® Green qPCR kits were from Bio-rad Inc. (Hercules, CA, USA). .. Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China).

Binding Assay:

Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea
Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Kpn I (TaKaRa) digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively.

Agarose Gel Electrophoresis:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Kpn I (TaKaRa, Dalian, China), which have no recognition sites in the ARG gDNA sequence. .. The 50 μl digestion reaction contained 10 μg gDNA, 5 μl 10× Buffer and was incubated overnight at 37 °C.

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification
Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing Kpn I (1 µL) (Takara), 10×L Buffer (2 µL), LAMP products (8 µL), and ddH2 O (9 µL), incubated at 37°C overnight, after which the DNA band were analyzed on 3% agarose gel electrophoresis stained with ethidium bromide and photographed as above. .. LAMP specificity was verified by performing the assay of DNA of B. cinerea and other important plant-pathogenic fungi in agricultural production, including Sclerotinia sclerotiorum , Fusarium graminearum , Rhizoctonia cerealis , Rhizoctonia solani , Verticillium dahliae , Alternaria alternata , Colletotrichum gloesporioides , and Magnaporthe grisea .

Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries
Article Snippet: Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp. .. Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep
Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and kpn I (Takara, Dalian, China), and ligated into the pGL3-basic vector digested with the same restriction enzymes.

Radio Immunoprecipitation:

Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle
Article Snippet: The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Kpn I and Xba I (TaKaRa, Dalian, China) restriction sites to construct the overexpression vector of bovine TTR gene (OV-TTR). .. The cells were seeded into 12-well plates in triplicate and transfected with OV-TTR, OV-NC on 7 day after adipogenic induction, respectively.

Transgenic Assay:

Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Article Snippet: Total genomic DNA was extracted from fresh leaves of putatively transgenic and wild-type (WT) Asakura-sanshoo plants using a DNAsecure Plant Kit (Tiangen Corp., Beijing, China), according to the manufacturer’s instructions. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China).

Produced:

Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries
Article Snippet: Restriction enzyme digestion and 0.8% agarose gel electrophoresis (AGE) were performed to confirm the identity of the plasmid. .. Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp. .. Double digestion was done by applying both Xho I and Nhe I to produce three fragments of 2273 bp, 2077 bp, and 2999 bp ( ).

Concentration Assay:

Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Kpn I (Takara Bio, Inc., Shiga, Japan) at 37 °C for 4 h, while DNA from plasmid-transfected cells was treated with both 100 U Hind III (New England Biolabs, Inc., MA, USA) and 100 U Dpn I (New England Biolabs, Inc., MA, USA) at 37 °C for 4 h. Southern blot analysis was then perfomed as described in Maekawa et al .

Staining:

Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification
Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing Kpn I (1 µL) (Takara), 10×L Buffer (2 µL), LAMP products (8 µL), and ddH2 O (9 µL), incubated at 37°C overnight, after which the DNA band were analyzed on 3% agarose gel electrophoresis stained with ethidium bromide and photographed as above. .. LAMP specificity was verified by performing the assay of DNA of B. cinerea and other important plant-pathogenic fungi in agricultural production, including Sclerotinia sclerotiorum , Fusarium graminearum , Rhizoctonia cerealis , Rhizoctonia solani , Verticillium dahliae , Alternaria alternata , Colletotrichum gloesporioides , and Magnaporthe grisea .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa kpn i restriction enzymes
    Schematic illustration of the general idea of this study. The ING4 DNA fragments were first cloned into the <t>pEGFP-C2</t> expression vector using Xho I and Kpn I restriction enzymes to produce the eukaryotic expression vector pEGFP-ING4. The vector was then transfected into human osteosarcoma cells U-2OS, and stable transfectants of pEGFP-ING4 with successful plasmid transfection were selected. Finally, the effects of overexpressed ING4 on the proliferation, cell cycle, invasion and apoptosis of U-2OS cells were evaluated.
    Kpn I Restriction Enzymes, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpn i restriction enzymes/product/TaKaRa
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    kpn i restriction enzymes - by Bioz Stars, 2019-12
    85/100 stars
      Buy from Supplier

    95
    TaKaRa pgfp c1
    GEF-H1 recruits NMIIB to FAs through its DH domain. (A) FA fraction (FA) and whole-cell lysate (WCL) from MSC-3A6 cells treated with control culture medium (M) or serum-starved MSC-3A6 cells treated with ethanol (–) or Dex (0.1 µM) for 6 h was immunoprecipitated using the control (rabbit anti-GAPDH) or anti-GEF-H1 antibodies, and analyzed by western blotting. The 3% input of FA fraction was analyzed by western blotting. (B) Diagram of the domain structures of GEF-H1 and GEF-H1_DH(m). ZF, zinc-finger motif; DH, Dbl homology domain; PH, pleckstrin homology domain; CC, coiled-coil domain. (C) Whole-cell lysates from serum-starved MSC-3A6 cells expressing GFP–C1, GFP–GEF-H1 or GFP–GEF-H1_DH(m) treated with Dex (0.1 µM, 6 h) were immunoprecipitated using GFP-Trap beads. The immunoprecipitated complexes and the 3% input of whole-cell lysate were then analyzed by western blotting. (D) The FA fraction (FA) and the whole-cell lysate (WCL) from serum-starved non-silencing and GEF-H1-silencing MSC-3A6 cells expressing <t>pGFP-C1</t> (mock), pGFP-GEF-H1 or pGFP-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h) were analyzed by western blotting. (E) TIRF images of immunolocalized paxillin (red) and NMIIB (green) in GEF-H1-silencing MSCs expressing pLKO-vector (mock), pLKO-GEF-H1, or pLKO-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h). Scale bars: 20 µm. The boxed 20 µm×20 µm areas indicated in the upper image rows are magnified in the row below. (F) Ratio of average density (intensity per µm 2 ) of paxillin or NMIIB within segmented FAs of GEF-H1-silencing MSCs expressing pLKO-GEF-H1 relative to mock, or GEF-H1-silencing MSCs expressing pLKO-GEF-H1_DH(m) relative to mock ( n = 11 cells for each condition). Data are mean±s.e.m. ** P
    Pgfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgfp c1/product/TaKaRa
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pgfp c1 - by Bioz Stars, 2019-12
    95/100 stars
      Buy from Supplier

    Image Search Results


    Schematic illustration of the general idea of this study. The ING4 DNA fragments were first cloned into the pEGFP-C2 expression vector using Xho I and Kpn I restriction enzymes to produce the eukaryotic expression vector pEGFP-ING4. The vector was then transfected into human osteosarcoma cells U-2OS, and stable transfectants of pEGFP-ING4 with successful plasmid transfection were selected. Finally, the effects of overexpressed ING4 on the proliferation, cell cycle, invasion and apoptosis of U-2OS cells were evaluated.

    Journal: Scientific Reports

    Article Title: Delivery of inhibitor of growth 4 (ING4) gene significantly inhibits proliferation and invasion and promotes apoptosis of human osteosarcoma cells

    doi: 10.1038/srep07380

    Figure Lengend Snippet: Schematic illustration of the general idea of this study. The ING4 DNA fragments were first cloned into the pEGFP-C2 expression vector using Xho I and Kpn I restriction enzymes to produce the eukaryotic expression vector pEGFP-ING4. The vector was then transfected into human osteosarcoma cells U-2OS, and stable transfectants of pEGFP-ING4 with successful plasmid transfection were selected. Finally, the effects of overexpressed ING4 on the proliferation, cell cycle, invasion and apoptosis of U-2OS cells were evaluated.

    Article Snippet: The fragments were cloned into the pEGFP-C2 expression vector (Clontech) using Xho I and Kpn I restriction enzymes (Takara) to produce the eukaryotic expression vector pEGFP-ING4.

    Techniques: Clone Assay, Expressing, Plasmid Preparation, Transfection

    Verification of mouse Omi/HtrA2 promoter luciferase expression plasmids. Plasmids were verified by double enzyme digestion with Kpn I and Hind III, which releases a vector fragment and a variable-sized promoter insert. M: DL2000 Marker; 1 : pGL3-239; 2 : pGL3-472; 3 : pGL3-742; 4 : pGL3-931; 5 : pGL3-1298. Luc: luciferase expression plasmids.

    Journal: International Journal of Molecular Sciences

    Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter

    doi: 10.3390/ijms17010119

    Figure Lengend Snippet: Verification of mouse Omi/HtrA2 promoter luciferase expression plasmids. Plasmids were verified by double enzyme digestion with Kpn I and Hind III, which releases a vector fragment and a variable-sized promoter insert. M: DL2000 Marker; 1 : pGL3-239; 2 : pGL3-472; 3 : pGL3-742; 4 : pGL3-931; 5 : pGL3-1298. Luc: luciferase expression plasmids.

    Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3.

    Techniques: Luciferase, Expressing, Plasmid Preparation, Marker

    Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total DNA either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P

    Journal: Scientific Reports

    Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit

    doi: 10.1038/srep41851

    Figure Lengend Snippet: Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total DNA either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P

    Article Snippet: The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Kpn I (Takara Bio, Inc., Shiga, Japan) at 37 °C for 4 h, while DNA from plasmid-transfected cells was treated with both 100 U Hind III (New England Biolabs, Inc., MA, USA) and 100 U Dpn I (New England Biolabs, Inc., MA, USA) at 37 °C for 4 h. Southern blot analysis was then perfomed as described in Maekawa et al .

    Techniques: Infection, Transfection, Mutagenesis, Expressing, Southern Blot, Plasmid Preparation, Real-time Polymerase Chain Reaction

    GEF-H1 recruits NMIIB to FAs through its DH domain. (A) FA fraction (FA) and whole-cell lysate (WCL) from MSC-3A6 cells treated with control culture medium (M) or serum-starved MSC-3A6 cells treated with ethanol (–) or Dex (0.1 µM) for 6 h was immunoprecipitated using the control (rabbit anti-GAPDH) or anti-GEF-H1 antibodies, and analyzed by western blotting. The 3% input of FA fraction was analyzed by western blotting. (B) Diagram of the domain structures of GEF-H1 and GEF-H1_DH(m). ZF, zinc-finger motif; DH, Dbl homology domain; PH, pleckstrin homology domain; CC, coiled-coil domain. (C) Whole-cell lysates from serum-starved MSC-3A6 cells expressing GFP–C1, GFP–GEF-H1 or GFP–GEF-H1_DH(m) treated with Dex (0.1 µM, 6 h) were immunoprecipitated using GFP-Trap beads. The immunoprecipitated complexes and the 3% input of whole-cell lysate were then analyzed by western blotting. (D) The FA fraction (FA) and the whole-cell lysate (WCL) from serum-starved non-silencing and GEF-H1-silencing MSC-3A6 cells expressing pGFP-C1 (mock), pGFP-GEF-H1 or pGFP-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h) were analyzed by western blotting. (E) TIRF images of immunolocalized paxillin (red) and NMIIB (green) in GEF-H1-silencing MSCs expressing pLKO-vector (mock), pLKO-GEF-H1, or pLKO-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h). Scale bars: 20 µm. The boxed 20 µm×20 µm areas indicated in the upper image rows are magnified in the row below. (F) Ratio of average density (intensity per µm 2 ) of paxillin or NMIIB within segmented FAs of GEF-H1-silencing MSCs expressing pLKO-GEF-H1 relative to mock, or GEF-H1-silencing MSCs expressing pLKO-GEF-H1_DH(m) relative to mock ( n = 11 cells for each condition). Data are mean±s.e.m. ** P

    Journal: Journal of Cell Science

    Article Title: GEF-H1 controls focal adhesion signaling that regulates mesenchymal stem cell lineage commitment

    doi: 10.1242/jcs.150227

    Figure Lengend Snippet: GEF-H1 recruits NMIIB to FAs through its DH domain. (A) FA fraction (FA) and whole-cell lysate (WCL) from MSC-3A6 cells treated with control culture medium (M) or serum-starved MSC-3A6 cells treated with ethanol (–) or Dex (0.1 µM) for 6 h was immunoprecipitated using the control (rabbit anti-GAPDH) or anti-GEF-H1 antibodies, and analyzed by western blotting. The 3% input of FA fraction was analyzed by western blotting. (B) Diagram of the domain structures of GEF-H1 and GEF-H1_DH(m). ZF, zinc-finger motif; DH, Dbl homology domain; PH, pleckstrin homology domain; CC, coiled-coil domain. (C) Whole-cell lysates from serum-starved MSC-3A6 cells expressing GFP–C1, GFP–GEF-H1 or GFP–GEF-H1_DH(m) treated with Dex (0.1 µM, 6 h) were immunoprecipitated using GFP-Trap beads. The immunoprecipitated complexes and the 3% input of whole-cell lysate were then analyzed by western blotting. (D) The FA fraction (FA) and the whole-cell lysate (WCL) from serum-starved non-silencing and GEF-H1-silencing MSC-3A6 cells expressing pGFP-C1 (mock), pGFP-GEF-H1 or pGFP-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h) were analyzed by western blotting. (E) TIRF images of immunolocalized paxillin (red) and NMIIB (green) in GEF-H1-silencing MSCs expressing pLKO-vector (mock), pLKO-GEF-H1, or pLKO-GEF-H1_DH(m) and treated with Dex (0.1 µM, 6 h). Scale bars: 20 µm. The boxed 20 µm×20 µm areas indicated in the upper image rows are magnified in the row below. (F) Ratio of average density (intensity per µm 2 ) of paxillin or NMIIB within segmented FAs of GEF-H1-silencing MSCs expressing pLKO-GEF-H1 relative to mock, or GEF-H1-silencing MSCs expressing pLKO-GEF-H1_DH(m) relative to mock ( n = 11 cells for each condition). Data are mean±s.e.m. ** P

    Article Snippet: To derive the GFP–C1-GEF-H1 (with shRNA resistance), full-length GEF-H1 cDNA was PCR amplified from the template pCMV5-EGFP-GEF-H1, and cloned into pGFP-C1 (Clontech) (Hin dIII/Kpn I).

    Techniques: Immunoprecipitation, Western Blot, Expressing, Plasmid Preparation