kpn i (TaKaRa)
Structured Review

Kpn I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kpn i/product/TaKaRa
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Related Products / Commonly Used Together
Images
1) Product Images from "Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit"
Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Journal: Scientific Reports
doi: 10.1038/srep41851

Figure Legend Snippet: Detection and quantification of replicating HBV genome. Cells were infected with Ax-CM103G-kS (kS) or Ax-CM103G-dP (dP) by the indicated MOIs, or transfected with plasmids possessing the same mutant HBV expression units. ( a ) Detection of the replicating HBV genome. Total DNA either from infected or transfected HepG2 cells were analysed using Southern blot analysis. AdV (◆), Kpn I-digested genome of adenovirus vector; rc, relaxed circular DNA genome of HBV; dsL, double-stranded linear DNA genome of HBV; ss, single stranded DNA of HBV; plasmid ( ¢ ), Hind III and Dpn I-digested plasmid fragments; mock, mock infection. Overexposure of blots and full-length blots are presented in Supplementary Figs S5 and S9 , respectively. ( b ) Replicating HBV genomes were quantified using qPCR. Total DNA from infected HepG2 or PXB cells were used to performed qPCR. n = 3. Error bars represent ± s.d.; mock, mock infection of the indicated cells; ** P
Techniques Used: Infection, Transfection, Mutagenesis, Expressing, Southern Blot, Plasmid Preparation, Real-time Polymerase Chain Reaction
2) Product Images from "Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo"
Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo
Journal:
doi: 10.3748/wjg.v10.i19.2874

Figure Legend Snippet: Detection of the recombinant plasmid pVAX-sEN using Eco R I and Kpn I digestion. A: Marker15000; B: pVAX1 digested by Eco R I; C: Recombinant plasmid pVAX-sEN digested by Eco R I; D: Recombinant plasmid pVAX-sEN digested by Eco R I and Kpn I.
Techniques Used: Recombinant, Plasmid Preparation
3) Product Images from "Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition"
Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition
Journal: Plant Molecular Biology Reporter / Ispmb
doi: 10.1007/s11105-015-0948-9

Figure Legend Snippet: Kanamycin-resistant shoots, GUS histochemical detection, and PCR analysis. a WT shoots. b Kanamycin-resistant shoots. Black arrows show epiphyllous shoots. c WT shoots. d GUS-positive shoots and leaves. e PCR analysis of transgenic Asakura-sanshoo plants. M DL2000 DNA marker, WT DNA from non-transgenic plant, P plasmid, 1–5 transgenic lines. f Southern blotting analysis. P pBin-Ex-Hipt plasmid; WT genomic DNA from non-transgenic plant; Y1 , Y17 , Y5 , and Y16 genomic DNA from transgenic lines. Genomic DNA from all lines and plasmid DNA were digested with Eco RI and Kpn I
Techniques Used: Polymerase Chain Reaction, Transgenic Assay, Marker, Plasmid Preparation, Southern Blot
4) Product Images from "Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification"
Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification
Journal: PLoS ONE
doi: 10.1371/journal.pone.0111094

Figure Legend Snippet: LAMP detection of the Bcos5 gene in B. cinerea and digestion of positive LAMP products. (a) LAMP for detection of B. cinerea using HNB as a visual indicator. The reaction becomes sky blue if the Bcos5 gene is present but remains violet if the gene is absent; (b) Agarose gel electrophoresis of LAMP products. The positive reaction is manifested as a ladder-like pattern on the 3.0% agarose gel. In (a) and (b), the positive reaction (with target DNA) is labeled “1″, and the negative reaction (without target DNA) is labeled “2″; (c), LAMP products were digested with Kpn I, and two fragments (153 bp, 49 bp) were observed by 3.0% agarose gel. M = 100-bp ladder, 1, LAMP products without digestion; 2, LAMP products digested by Kpn I.
Techniques Used: Agarose Gel Electrophoresis, Labeling
5) Product Images from "Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species"
Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species
Journal: Scientific Reports
doi: 10.1038/s41598-017-07084-0

Figure Legend Snippet: Southern blot analysis to determine TaARG copy number in the common wheat genome. ( A ) Bam HI-digested genomic DNA of CB037; ( B ) Kpn I-digested genomic DNA of CB037. acquisition tools and image processing software package. The photo was acquired by Tanon 5200 software (YPH-bio, Co. Ltd. Beijing, China).
Techniques Used: Southern Blot, Software
6) Product Images from "Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter"
Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter
Journal: International Journal of Molecular Sciences
doi: 10.3390/ijms17010119

Figure Legend Snippet: Verification of mouse Omi/HtrA2 promoter luciferase expression plasmids. Plasmids were verified by double enzyme digestion with Kpn I and Hind III, which releases a vector fragment and a variable-sized promoter insert. M: DL2000 Marker; 1 : pGL3-239; 2 : pGL3-472; 3 : pGL3-742; 4 : pGL3-931; 5 : pGL3-1298. Luc: luciferase expression plasmids.
Techniques Used: Luciferase, Expressing, Plasmid Preparation, Marker
7) Product Images from "Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries"
Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries
Journal: Acta Pharmacologica Sinica
doi: 10.1038/aps.2009.152

Figure Legend Snippet: AGE and HPLC analysis of purified pGJA-P/VAX(G). (A) AGE after restriction endonuclease digestion. pGJA-P/VAX(G) digested by Kpn I (Lane 1); Xho I (Lane 2); both Xho I and Nhe I (Lane 3); Nhe I (Lane 4). Lane 5 represents the DNA marker λ Hind III. (B)HPLC analysis of purified pGJA-P/VAX(G). Peak 1: open circular topology; Peak 2: supercoiled topology.
Techniques Used: High Performance Liquid Chromatography, Purification, Marker
Related Articles
Clone Assay:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo Article Snippet: PCR products and pVAX1 were digested by Eco R I and Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression Article Snippet: The resulting plasmid, which contains LGR5 upstream 1155 bp was named pGL4.12-Lgr5up1155bp. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: PCR amplicons with the expected size (~270 bp) were cloned and sequenced. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor Article Snippet: Paragraph title: Cloning of fDAF ... Both DAF 5′ and DAF 3′ were digested with Nco I and Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Luciferase:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression Article Snippet: Paragraph title: Luciferase reporter assay ... For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Reporter Assay:Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression Article Snippet: Paragraph title: Luciferase reporter assay ... For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Polymerase Chain Reaction:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo Article Snippet: Reaction conditions were at 95 °C for 5 min, then 30 cycles each at 95 °C for 1 min, at 62 °C for 1 min, at 72 °C for 3 min, followed by a final extension at 72 °C for 5 min. PCR products were purified by UNIQUE-10 Kit (Shanghai Shenggong Biological Co.Ltd) after 20 g/L agarose gel electrophoresis. .. PCR products and pVAX1 were digested by Eco R I and Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: PCR amplicons with the expected size (~270 bp) were cloned and sequenced. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Article Title: Circulating granulysin levels in healthcare workers and latent tuberculosis infection estimated using interferon-gamma release assays Article Snippet: A non-synonymous SNP rs11127 (C/T) of the exon 4 (NM_006433.4) was selected and genotyped as a representative SNP. .. Genomic DNA was amplified using the primers 5′-GGAGGTATCAGTCTAGAG G TA-3′ and 5′-GCTAAAGTCCATCTGCTCAA-3′, and a mismatch nucleotide (bold) was introduced in the sense primer to generate a Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: The target gene spd1590 was cloned from S. pneumoniae D39 genomic DNA by PCR. .. The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor Article Snippet: PCR was performed using Ex Taq DNA polymerase, and the PCR product was then ligated into the pGEM-T Easy vector. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 cDNA fragment containing complete coding DNA sequence (CDS) region was obtained from the total RNA of WPMY-1 cells by reverse transcription and PCR amplification. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Construct:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: Then, the plasmid skeleton and the PR -MicC-BBa_B0015 fragment were assembled by ClonExpress One Step Cloning Kit (Vazyme Biotech) to construct the new plasmid pSC101-sRNA for synthetic sRNA production. .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: Through Tag enzyme amplification, ScFv was linked into pMD-19T (both from Takara Biotechnology Co., Ltd., Dalian, China), and Sanger DNA sequencing technology (Thermo Fisher Scientific, Inc.) was used to identify successfully constructed pMD-19T-ScFv. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Electrophoresis:Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Incubation:Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing Amplification:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The PCR amplification protocol was as follows: denaturation at 94 °C for 2 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 62.4 °C for 45 s, and extension at 68 °C for 30–90 s (according to the fragment length of PCR products, about 1 kb/1 min); and final extension at 68 °C for 10 min. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: These primers amplified a 248-bp fragment of the IPT gene sequence. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression Article Snippet: To yield LGR5 upstream plasmids, 2000 bp of LGR5 promoter region was amplified from TIG-112 genome using the primers: 5′- CAAACTCGAGGGGTAGGAGAAGGGTGTGGG -3′ and 5′- TCATGGATCCGGTGCCCGAAGTAGGGGGCC -3′, treated with Bam HI and Xho I, and cloned into Bgl II-Xho I site of pGL4.12. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: Partial reverse transcriptase (RT) fragments of Ty1/copia -like retrotransposons in E. agallocha were amplified using degenerate primer pairs corresponding to the “KTAFLH/NG” and “LLYVDDM/V” conserved motifs (Voytas et al., ). .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full length cDNA for AR was amplified by PCR analysis using pEZ-M02 AR as the template and primers AR (920aa) 2763 bp F- BglII : 5′-GGAAGATCTGGATGGAAGTGCAGTTAGGGCTGGG-3’and R- XhoI :5′-CCGCTCGAGTCACTGGGTGTGGAAATAGATGGGCT-3′. .. The PCR product was digested with EcoR I and Article Title: Circulating granulysin levels in healthcare workers and latent tuberculosis infection estimated using interferon-gamma release assays Article Snippet: A non-synonymous SNP rs11127 (C/T) of the exon 4 (NM_006433.4) was selected and genotyped as a representative SNP. .. Genomic DNA was amplified using the primers 5′-GGAGGTATCAGTCTAGAG G TA-3′ and 5′-GCTAAAGTCCATCTGCTCAA-3′, and a mismatch nucleotide (bold) was introduced in the sense primer to generate a Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The ScFv was amplified by PCR using pMD-19T-ScFv as a template, and the following primers were used: upstream primer (5′-ATAGGTACCGCCACCATGCAGGTGCAACTGCAGGA-3′ containing the Kpn I site, GGTACC) and downstream primer (5′-GGCAAGCTTTTAGTTTGATTTCCAGCTTGGTC-3 containing the Hin dIII site, AAGCTT). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Cell Culture:Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries Article Snippet: After being cultured at 30 °C for 6–12 h, the upper layer of the double-decker agar plate was checked for phage plaque. .. Single identification digestion was made using only one restriction enzyme, Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Expressing:Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: Human Smad3 expression plasmid (pcDNA3.1-Smad3) was gifted from Prof. Rujun Gong (Brown University, RI, USA). .. Restriction enzymes, Transformation Assay:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Over Expression:Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: The cDNA fragment was cloned into vector PCDNA3.1 (+) with the restriction enzymes BamH I and Xho I (Takara, Japan) and the over-expression plasmid was named PCDNA3.1-IL8. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Hybridization:Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Transfection:Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Paragraph title: Plasmids and transfection ... The fragment was cloned into PGL3-Basic plasmid with Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: Paragraph title: Construction and Cell Transfection ... The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Inverse PCR:Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: Among them, 25 sequences with a sequence identity of 90–100% were used to design primers for the subsequent inverse PCR. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Southern Blot:Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species Article Snippet: Paragraph title: Southern blotting analysis ... 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Paragraph title: Confirmation of Transformation by PCR and Southern Blotting ... Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Ligation:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Protease Inhibitor:Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: Restriction enzymes, Kpn I and Xho I, were bought from Takara (Dalian, China). .. Restriction enzymes, SYBR Green Assay:Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: PVDF Membranes and iQTM SYBR® Green qPCR kits were from Bio-rad Inc. (Hercules, CA, USA). .. Restriction enzymes, Infection:Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Article Snippet: HepG2 cells in a 6 well plate were infected with AdVs. .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Generated:Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and DNA Sequencing:Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: Through Tag enzyme amplification, ScFv was linked into pMD-19T (both from Takara Biotechnology Co., Ltd., Dalian, China), and Sanger DNA sequencing technology (Thermo Fisher Scientific, Inc.) was used to identify successfully constructed pMD-19T-ScFv. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, DNA Labeling:Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Reverse Transcription Polymerase Chain Reaction:Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Recombinant:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Mutagenesis:Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The primers for mutagenesis from TGTTCT to TAAAAA included a forward primer 5′-TGCATATACCACTTCCTTAAAAAGAGCTGGTATACTTTCC-3′ and a reverse primer 5′-GGAAAGTATACCAGTTCTTTTTAAGGAAGTGGTATATGCA-3′ (for pGL3-Basic-ADTRPp-Luc-Mut 2). .. The PCR product was digested with EcoR I and Isolation:Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: Paragraph title: Isolation and characterization of EARE-1 ... The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Size-exclusion Chromatography:Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The PCR reaction program started with 5 min at 94°C, which was followed by 30 cycles of 30 sec at 94°C, 30 sec at 56°C and 1 min at 72°C, and a final extension at 72°C for 7 min. .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Purification:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: Paragraph title: Cloning, Expression, and Purification of SPD_1590 ... The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Sequencing:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species Article Snippet: In brief, a probe was designed to hybridize to the ~250 bp upstream and downstream regions flanking the stop codon (Table ). .. 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: These primers amplified a 248-bp fragment of the IPT gene sequence. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer Article Snippet: The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Kpn I (TAKARA) was used for the digestion of the E. agallocha genomic DNA. .. The inverse PCR was conducted as previously described (Syed and Flavell, ) except that BamHI, EcoRI, Hind III, or Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor Article Snippet: Four independent clones were sequenced, and we identified the 5′ sequence downstream of the start codon. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 cDNA fragment containing complete coding DNA sequence (CDS) region was obtained from the total RNA of WPMY-1 cells by reverse transcription and PCR amplification. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Protein Extraction:Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Bradford Protein Assay:Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: Bradford Protein Assay Kits were from Beyotime (Beijing, China). .. Restriction enzymes, Gel Extraction:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Plasmid Preparation:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: The A-tailing products were cloned into pMD18-T vector (#6011; Takara) to produce recombinant constructs (pMD18-T-239 to pMD18-T-1298) which were confirmed by sequencing. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Southern blot analysis was according to the protocol of Southern ( ). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries Article Snippet: Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp. .. Single identification digestion was made using only one restriction enzyme, Article Title: Human endostatin gene transfer, either naked or with liposome, has the same inhibitory effect on growth of mouse liver tumor cells in vivo Article Snippet: Paragraph title: Construction of recombinant eukaryotic plasmid expressing secretive endostatin ... PCR products and pVAX1 were digested by Eco R I and Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression Article Snippet: The resulting plasmid, which contains LGR5 upstream 1155 bp was named pGL4.12-Lgr5up1155bp. .. For pTK4.12-MUC5ACup and pGL4.12-MUC5ACup-Lgr5up1155bp, Pci I (Klenow blunted)-Spe I fragment of pGL4.12-MUC5ACup3000bp (−3000 to −1425 bp upstream of MUC5AC ) was cloned into Article Title: Androgen inhibits key atherosclerotic processes by directly activating ADTRP transcription Article Snippet: The full-length cDNA for PIK3R3 ( , Entrez GeneID 8503, Ensembl: ENSG00000117461) was obtained by RT-PCR analysis using RNA samples isolated from HeLa cells. .. The PCR product was digested with EcoR I and Article Title: A Novel Iron Transporter SPD_1590 in Streptococcus pneumoniae Contributing to Bacterial Virulence Properties Article Snippet: The target gene spd1590 was cloned from S. pneumoniae D39 genomic DNA by PCR. .. The PCR product and pBAD/HisA plasmid were digested with restriction enzymes Xho I and Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: Then, the plasmid skeleton and the PR -MicC-BBa_B0015 fragment were assembled by ClonExpress One Step Cloning Kit (Vazyme Biotech) to construct the new plasmid pSC101-sRNA for synthetic sRNA production. .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Article Title: Generation of a Felinized Swine Endothelial Cell Line by Expression of Feline Decay-Accelerating Factor Article Snippet: PCR was performed using Ex Taq DNA polymerase, and the PCR product was then ligated into the pGEM-T Easy vector. .. Both DAF 5′ and DAF 3′ were digested with Nco I and Article Title: Ginsenoside Rg3 inhibits the senescence of prostate stromal cells through down-regulation of interleukin 8 expression Article Snippet: Human IL-8 gene promoter fragment (−1481nt to +44nt) was amplified from genomic DNA isolated from WPMY-1. .. The fragment was cloned into PGL3-Basic plasmid with Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: Human Smad3 expression plasmid (pcDNA3.1-Smad3) was gifted from Prof. Rujun Gong (Brown University, RI, USA). .. Restriction enzymes, Article Title: Role of blocking ADAM10 hydrolysis site on N-cadherin by single-chain antibody in ventricular remodeling Article Snippet: The ScFv fragment was then linked into pAdTrack-CMV (plasmid no. 16405; Addgene, Inc., Cambridge, MA, USA), a shuttle adenoviral plasmid (pAd). .. The recombinant pAdTrack-ScFv shuttle plasmid was identified by PCR, Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The relative expression ratios were calculated with the following formula 2−ΔΔCt as Schmittgen and Livak described ( ). .. The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Real-time Polymerase Chain Reaction:Article Title: Activation of FXR protects against renal fibrosis via suppressing Smad3 expression Article Snippet: PVDF Membranes and iQTM SYBR® Green qPCR kits were from Bio-rad Inc. (Hercules, CA, USA). .. Restriction enzymes, Binding Assay:Article Title: De Novo Biosynthesis of p-Coumaric Acid in E. coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea Article Snippet: For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB were overexpressed with their native ribosome binding sites under a constitutive T7 promoter and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). .. The EcopntAB DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer pairs pCL-T7-pntA -PF and pCL-BBa_B1006-pntB -PR, and assembled into the Agarose Gel Electrophoresis:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Kpn I (#1068A; Takara) and Hind III (#1060A; Takara), and the fragments of the recombinant constructs were subcloned into pGL3. .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Comprehensive molecular analysis of arginase-encoding genes in common wheat and its progenitor species Article Snippet: 10 μg CB037 gDNA was separately digested with the restriction enzymes Bam HI and Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Kpn I (Takara Corp., Dalian, China). .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries Article Snippet: Single identification digestion was made using only one restriction enzyme, Kpn I (Takara Bio Inc, Otsu, Japan) or Nhe I (Takara Bio Inc, Otsu, Japan), both of which produced one fragment 7349 bp in size; or Xho I (Takara Bio Inc, Otsu, Japan), which produced two fragments of 2273 bp and 5076 bp. .. Single identification digestion was made using only one restriction enzyme, Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Article Title: Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep Article Snippet: The PCR product was isolated from agarose gel using a gel extraction kit (omega Bio-Tek, Inc., Norcross, GA, USA) and was cloned into pDrive (cloning vector). .. For the generation of the luciferase reporter construct, the (−2000 to +88) bp of the sheep MC4R promoter fragment was excised from the pDrive (cloning vector) by digestion with xho I and Radio Immunoprecipitation:Article Title: Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle Article Snippet: The CDS region of bovine TTR gene (GenBank Accession Number: ) was cloned from adipocytes using the forward primer: 5′-CGGGGTACCATGGCTTCCTTCCGTCTGTTCC-3′ and the reverse primer: 5′-GCTCTAGATCACGCCTTGGGACTGCTGA-3′, then recombined into the pcDNA3.1 (+) plasmid vector between the Transgenic Assay:Article Title: Expression of IPT in Asakura-sanshoo (Zanthoxylum piperitum (L.) DC. f. inerme Makino) Alters Tree Architecture, Delays Leaf Senescence, and Changes Leaf Essential Oil Composition Article Snippet: Total genomic DNA was extracted from fresh leaves of putatively transgenic and wild-type (WT) Asakura-sanshoo plants using a DNAsecure Plant Kit (Tiangen Corp., Beijing, China), according to the manufacturer’s instructions. .. Briefly, 20 μg genomic DNA and 1 μg control plasmid were digested with Eco RI and Produced:Article Title: Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter Article Snippet: PCR products were purified using a DNA gel extraction kit (#AP-GX-50; Axygen, Corning, NY, USA), and then sticky end products were produced using a DNA A-Tailing Kit (Tiangen, Beijing, China) with a 20 μL reaction mixture containing 15 μL purified PCR products, 4 μL A-Tailing Mix, and 1 μL A-Tailing Enzyme (2.5 U/μL). .. Recombinant constructs pMD18-T-239 to pMD18-T-1298 and pGL3 luciferase reporter vector (#E1751; Promega, Madison, WI, USA) were digested for 4h at 37 °C with Article Title: Good Manufacturing Practices production and analysis of a DNA vaccine against dental caries Article Snippet: Restriction enzyme digestion and 0.8% agarose gel electrophoresis (AGE) were performed to confirm the identity of the plasmid. .. Single identification digestion was made using only one restriction enzyme, Concentration Assay:Article Title: Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Article Snippet: Briefly, the cells were suspended in 0.7 ml of TNE-PK [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 100 mg/ml ptoteinase K], followed by the addition of SDS (0.1% final concentration). .. The pellet was dissolved with TE containing 20 mg/ml RNase A. Twenty μg of DNA from the AdV-infected cells were digested with 100 U Staining:Article Title: Development and Evaluation of a Novel and Rapid Detection Assay for Botrytis cinerea Based on Loop-Mediated Isothermal Amplification Article Snippet: The recombinant plasmid pEASY -T1-N202 was extracted from positive clones and sequenced by Sangon (China). .. LAMP products were digested in a 20 µL reaction system containing |