klenow dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    DNA Polymerase I Klenow Fragment
    Description:
    DNA Polymerase I Klenow Fragment 1 000 units
    Catalog Number:
    m0210l
    Price:
    244
    Size:
    1 000 units
    Category:
    DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs klenow dna polymerase
    DNA Polymerase I Klenow Fragment
    DNA Polymerase I Klenow Fragment 1 000 units
    https://www.bioz.com/result/klenow dna polymerase/product/New England Biolabs
    Average 90 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    klenow dna polymerase - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Strand displacement synthesis by yeast DNA polymerase ε"

    Article Title: Strand displacement synthesis by yeast DNA polymerase ε

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw556

    Pol ε poorly extends D-loops in comparison to Pol δ but is proficient to extend primed single-stranded DNA using the same substrates under the same conditions. ( A ) In vitro D-loop reactions using a 37-mer oligonucleotide were reconstituted using purified S. cerevisiae proteins as described in Materials and Methods. ( B ) Product analysis of reconstituted D-loop reactions containing either Klenow polymerase, Pol δ (10 nM) or Pol ε (10 nM) at 0, 2 (not for Klenow), 5 and 10 min extension times. ( C ) Extension of primed single-stranded circular template DNA using a 37-mer oligonucleotide. ( D ) Product analysis of primer extension on denaturing gels of reaction containing Klenow polymerase, Pol δ (10 nM) or Pol ε (10 nM) each plus or minus 10 nM PCNA/RFC at 0, 2 (not for Klenow), 5 and 10 min extension times. A 100 nt size ladder is shown in the left-most lane.
    Figure Legend Snippet: Pol ε poorly extends D-loops in comparison to Pol δ but is proficient to extend primed single-stranded DNA using the same substrates under the same conditions. ( A ) In vitro D-loop reactions using a 37-mer oligonucleotide were reconstituted using purified S. cerevisiae proteins as described in Materials and Methods. ( B ) Product analysis of reconstituted D-loop reactions containing either Klenow polymerase, Pol δ (10 nM) or Pol ε (10 nM) at 0, 2 (not for Klenow), 5 and 10 min extension times. ( C ) Extension of primed single-stranded circular template DNA using a 37-mer oligonucleotide. ( D ) Product analysis of primer extension on denaturing gels of reaction containing Klenow polymerase, Pol δ (10 nM) or Pol ε (10 nM) each plus or minus 10 nM PCNA/RFC at 0, 2 (not for Klenow), 5 and 10 min extension times. A 100 nt size ladder is shown in the left-most lane.

    Techniques Used: In Vitro, Purification

    2) Product Images from "Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology"

    Article Title: Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq512

    Analysis of the overhang types created by ZFNs. ( A ) Scheme to determine ZFN overhangs. A supercoiled plasmid with a ZFN cleavage site is cut by a titration of in vitro transcribed and translated ZFNs. ZFN-linearized plasmids are purified by gel electrophoresis, 5′ overhangs filled in with Klenow polymerase (grey nucleotides), and the resulting blunt ends ligated. The mixture is subjected to high-throughput DNA sequencing. ( B ) Overhang types generated by a control restriction enzyme (HindIII) and three of the ZFN pairs used in this work. For clarity, only one DNA strand is shown. Enzyme binding sites are shown in grey; only the flanking three nucleotides are shown for ZFN binding sites. Primary cleavage sites, black triangles; secondary and tertiary cleavage sites, dark and light grey triangles, respectively; deletions, Δ. Microhomology within the target site can prevent unambiguous deduction of the overhang type. In such situations the possible overhangs are shown as joined triangles. Either of the two indicated thymidine residues may have been deleted after HindIII digestion.
    Figure Legend Snippet: Analysis of the overhang types created by ZFNs. ( A ) Scheme to determine ZFN overhangs. A supercoiled plasmid with a ZFN cleavage site is cut by a titration of in vitro transcribed and translated ZFNs. ZFN-linearized plasmids are purified by gel electrophoresis, 5′ overhangs filled in with Klenow polymerase (grey nucleotides), and the resulting blunt ends ligated. The mixture is subjected to high-throughput DNA sequencing. ( B ) Overhang types generated by a control restriction enzyme (HindIII) and three of the ZFN pairs used in this work. For clarity, only one DNA strand is shown. Enzyme binding sites are shown in grey; only the flanking three nucleotides are shown for ZFN binding sites. Primary cleavage sites, black triangles; secondary and tertiary cleavage sites, dark and light grey triangles, respectively; deletions, Δ. Microhomology within the target site can prevent unambiguous deduction of the overhang type. In such situations the possible overhangs are shown as joined triangles. Either of the two indicated thymidine residues may have been deleted after HindIII digestion.

    Techniques Used: Plasmid Preparation, Titration, In Vitro, Purification, Nucleic Acid Electrophoresis, High Throughput Screening Assay, DNA Sequencing, Generated, Binding Assay

    3) Product Images from "An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents"

    Article Title: An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0020303

    The principle of PE-PCR for bacterial DNA amplification and detection. A fusion probe is designed with the sequences at the 3′-end corresponding to the bacterial genomic sequences and a non-bacterial tag sequence at the 5′-end. The reaction is initiated by annealing the fusion probe to the template bacterial DNA after heat-denaturing at 95°C for 5 min (Step 1 and 2). An enzyme mix (EK mix) of exo I and Klenow DNA polymerase is then added into the reaction mixture and incubated at 37°C for 2 h (Step 3a and 3b). Following heat-inactivation of EK mix at 80°C for 20 min (Step 3c), a forward primer (non-bac-F) corresponding to the non-bacterial sequence of the fusion probe and a reverse primer (bac-R) targeting bacterial genomic sequence downstream of the fusion probe are used for PCR amplification of the primer extension product (Step 4). In this setting, only template bacterial DNA but not the endogenous contaminated bacterial DNA is amplified (Step 5).
    Figure Legend Snippet: The principle of PE-PCR for bacterial DNA amplification and detection. A fusion probe is designed with the sequences at the 3′-end corresponding to the bacterial genomic sequences and a non-bacterial tag sequence at the 5′-end. The reaction is initiated by annealing the fusion probe to the template bacterial DNA after heat-denaturing at 95°C for 5 min (Step 1 and 2). An enzyme mix (EK mix) of exo I and Klenow DNA polymerase is then added into the reaction mixture and incubated at 37°C for 2 h (Step 3a and 3b). Following heat-inactivation of EK mix at 80°C for 20 min (Step 3c), a forward primer (non-bac-F) corresponding to the non-bacterial sequence of the fusion probe and a reverse primer (bac-R) targeting bacterial genomic sequence downstream of the fusion probe are used for PCR amplification of the primer extension product (Step 4). In this setting, only template bacterial DNA but not the endogenous contaminated bacterial DNA is amplified (Step 5).

    Techniques Used: Polymerase Chain Reaction, Amplification, Genomic Sequencing, Sequencing, Incubation, BAC Assay

    Related Articles

    Transduction:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: Paragraph title: HDAC3 viral transduction. ... The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

    Clone Assay:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Hybridization probes were prepared from a double-stranded plasmid template (plasmid EN40 generously provided by Robert Nicholls) containing a 3.9 kb EcoRI-NotI fragment (encompassing the Mkrn3 promoter region) cloned into a pZErOTM-2 vector. .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Amplification:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Briefly, 167 bp long fragment of α-Man promoter upstream of ATG of gene was PCR amplified by using primers listed in Supplementary Table . .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: Briefly, a 200bp β-Hex promoter fragment upstream of ATG was PCR amplified using primers listed in Supplementary Table S1 . .. HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Synthesized:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Plasmid DNA was first purified and linearized by double digestion with NotI and EcoRI, then strand-specific radiolabeled single-stranded hybridization probes were synthesized from the linearized plasmid template with the same gene-specific primer used for each LMPCR reaction. .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: A 464-bp probe for hybridization was synthesized from genomic DNA by PCR using primers flanking exons 2 and 3 of NOP56 . .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots. .. Western blots were performed from total L. infantum lysates equivalent to 2 × 106 parasites in 2× Laemmli buffer.

    Construct:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: Plasmid MinR-1 vector containing HDAC3 construct (MinR1-HDAC3) was generated from a pCMV-Sport6 expression vector containing murine HDAC3 (pCMV-Sport6-Mbd2, MMM 1013-9200215, OpenBiosystems). .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Incubation:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

    Expressing:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: Plasmid MinR-1 vector containing HDAC3 construct (MinR1-HDAC3) was generated from a pCMV-Sport6 expression vector containing murine HDAC3 (pCMV-Sport6-Mbd2, MMM 1013-9200215, OpenBiosystems). .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

    Western Blot:

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots. .. Western blots were performed from total L. infantum lysates equivalent to 2 × 106 parasites in 2× Laemmli buffer.

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. NEO-expressing L . infantum promastigotes and third passage axenic amastigotes were used to extract total proteins for Western blotting.

    Competitive Binding Assay:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

    Hybridization:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Plasmid DNA was first purified and linearized by double digestion with NotI and EcoRI, then strand-specific radiolabeled single-stranded hybridization probes were synthesized from the linearized plasmid template with the same gene-specific primer used for each LMPCR reaction. .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: A 464-bp probe for hybridization was synthesized from genomic DNA by PCR using primers flanking exons 2 and 3 of NOP56 . .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: Hybridization intensity signals from plasmid and genomic DNA were measured by a PhosphorImager. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

    Transfection:

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: A ratio of the signal obtained from the plasmid DNA versus the genomic DNA was used to determine the plasmid copy number in each transfectant cell line. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

    Southern Blot:

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: Paragraph title: Southern blot. ... The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

    Ligation:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Illumina adapter ligation was performed in a 20-μL reaction by incubation at 20°C for 15 min, followed by 65°C for 10 min (10 μL of DNA from previous step, 1× T4 DNA ligase buffer, 1 μL of T4 DNA ligase (NEB # M0202S), 1 μL of 40-μM pre-annealed adapter mix).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Footprinting:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Paragraph title: In vivo footprinting ... Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Northern Blot:

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots. .. Western blots were performed from total L. infantum lysates equivalent to 2 × 106 parasites in 2× Laemmli buffer.

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: Southern and Northern blot hybridizations were performed following standard procedures. .. DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs).

    Generated:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: Plasmid MinR-1 vector containing HDAC3 construct (MinR1-HDAC3) was generated from a pCMV-Sport6 expression vector containing murine HDAC3 (pCMV-Sport6-Mbd2, MMM 1013-9200215, OpenBiosystems). .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

    other:

    Article Title: Strand-specific libraries for high throughput RNA sequencing (RNA-Seq) prepared without poly(A) selection
    Article Snippet: DNA Polymerase I, Large (Klenow) Fragment (5 U/μl, NEB, Catalog Number M0210L).

    Article Title: Crystallographic Analysis of Small Ribozymes and Riboswitches
    Article Snippet: Klenow fragment, 5,000 U/mL, with 10× reaction buffer, cat. #M0210S (New England Biolabs, Ipswich, MA).

    DNA Sequencing:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: PCR products from LMPCR were size-fractionated on DNA sequencing gels, and electrotransferred onto a nylon membrane as described previously , . .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Sequencing:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Retro­viruses were generated by cotransfection of MinR1-HDAC3 or parental MinR1 vector with pCLeco (Invitrogen) helper plasmid into the 293T Phoenix ecotropic packaging cell line (ATCC) using Lipofectamine 2000 (11668-019, Invitrogen).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Paragraph title: Preparation of sequencing libraries ... Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Binding Assay:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Electrophoretic Mobility Shift Assay EMSA was performed for in vitro binding of RIN (AF448522.1) protein with α-Man promoter as methods described previously ( ) with minor modifications. .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

    Hi-C:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: Paragraph title: Construction of Hi-C library ... The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    ChIP-sequencing:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    In Vivo:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Paragraph title: In vivo footprinting ... Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    RNA Sequencing Assay:

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Paragraph title: 5′ End Enriched RNA-seq Library Construction ... Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

    Sensitive Assay:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Magnetic Beads:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Supernatants were collected and used to infect purified Tregs isolated with magnetic beads.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: 20 μl Magna ChIP™ Protein A Magnetic Beads (Millipore, cat. # 16-661) were added and incubated for 1.5 h at 4 °C rotating. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Isolation:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Supernatants were collected and used to infect purified Tregs isolated with magnetic beads.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Genomic DNA was isolated from 10–20 mL of YPD-grown cells using Qiagen Genomic-tip 100/G columns as described by the manufacturer. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: Total RNA from parasites was isolated by TRIzol (Life Technologies) according to manufacturer's instructions and resolved on 1% agarose formaldehyde gels. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

    Electrophoretic Mobility Shift Assay:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Paragraph title: Electrophoretic Mobility Shift Assay ... Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

    Purification:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Supernatants were collected and used to infect purified Tregs isolated with magnetic beads.

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Plasmid DNA was first purified and linearized by double digestion with NotI and EcoRI, then strand-specific radiolabeled single-stranded hybridization probes were synthesized from the linearized plasmid template with the same gene-specific primer used for each LMPCR reaction. .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA was purified with AMPure XP beads (Beckman Coulter, A63881). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: .. HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: 5′ End Enriched RNA-seq Library Construction First strand of cDNA was prepared with 3 μg of purified RNA, random hexamers and Invitrogen SuperScript® III First-Strand Synthesis System (Pub. .. Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

    Polymerase Chain Reaction:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Briefly, 167 bp long fragment of α-Man promoter upstream of ATG of gene was PCR amplified by using primers listed in Supplementary Table . .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: PCR products from LMPCR were size-fractionated on DNA sequencing gels, and electrotransferred onto a nylon membrane as described previously , . .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Article Title: Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings
    Article Snippet: .. Reagent list: name (catalog no., vendor) Ethanol 200 proof (E7023; Sigma Aldrich) 5 M NaCl solution (AM9759; Thermo Fisher) HEPES 1 M (15630106; Thermo Fisher) KOH 8 N (P4494; Millipore Sigma) 0.5 M EDTA solution (15575020; Thermo Fisher) Dithiothreitol (R0861; Thermo Fisher) Triton X-100 (85112; Thermo Fisher) Glycerol (17904; Thermo Fisher) 1 M Tris pH 7.0 (AM9850G; Thermo Fisher) 1 M MgCl2 solution (AM9530G; Thermo Fisher) NN-dimethylformamide (D4551; Millipore Sigma) KAPA HiFi PCR kit with dNTPs (NC0142652; Thermo Fisher) 10% SDS (15553027; Thermo Fisher) i5/i7 index primers (any oligo provider) DNA LoBind tubes (13-698-791; Thermo Fisher) Protein LoBind tubes (0030108116; Eppendorf) SPRIselect (B23317; Beckman Coulter) Tn5 transposase with Nextera adapters (custom; QB3 Macrolab) Elution buffer (19086; Qiagen) DNase endonuclease (DB0715K; Lucigen) DNase exonuclease (E3101K; Lucigen) MinElute Virus Spin kit (57704; Qiagen) dNTP solution mix (N0447S; NEB) Klenow (M0210L; NEB) Millex-GP filter unit 0.22 μm (SLGP033RS; EMD) Random primer mix (S1330S; NEB) dNTP solution mix (N0447S; NEB) Ultrapure (10977015; Thermo Fisher) Qubit dsDNA High Sensitivity Kit (Q33230; Thermo Fisher). .. Equipment list Magnetic tube rack for microcentrifuge tubes Heat block Microcentrifuge Vortexer Benchtop centrifuge PCR thermocycler Qubit fluorometer with provided tubes Computer with 2GB+ of RAM, with Docker and Python 3.

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP. ..

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
    Article Snippet: Briefly, a 200bp β-Hex promoter fragment upstream of ATG was PCR amplified using primers listed in Supplementary Table S1 . .. HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column.

    Labeling:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: .. DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

    Cotransfection:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Retro­viruses were generated by cotransfection of MinR1-HDAC3 or parental MinR1 vector with pCLeco (Invitrogen) helper plasmid into the 293T Phoenix ecotropic packaging cell line (ATCC) using Lipofectamine 2000 (11668-019, Invitrogen).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Chromatin Immunoprecipitation:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: 20 μl Magna ChIP™ Protein A Magnetic Beads (Millipore, cat. # 16-661) were added and incubated for 1.5 h at 4 °C rotating. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Plasmid Preparation:

    Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
    Article Snippet: .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Retro­viruses were generated by cotransfection of MinR1-HDAC3 or parental MinR1 vector with pCLeco (Invitrogen) helper plasmid into the 293T Phoenix ecotropic packaging cell line (ATCC) using Lipofectamine 2000 (11668-019, Invitrogen).

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Plasmid DNA was first purified and linearized by double digestion with NotI and EcoRI, then strand-specific radiolabeled single-stranded hybridization probes were synthesized from the linearized plasmid template with the same gene-specific primer used for each LMPCR reaction. .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
    Article Snippet: A ratio of the signal obtained from the plasmid DNA versus the genomic DNA was used to determine the plasmid copy number in each transfectant cell line. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

    Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
    Article Snippet: DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

    In Vitro:

    Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
    Article Snippet: Electrophoretic Mobility Shift Assay EMSA was performed for in vitro binding of RIN (AF448522.1) protein with α-Man promoter as methods described previously ( ) with minor modifications. .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

    Selection:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Agarose Gel Electrophoresis:

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: Digested DNA was resolved on a 0.8% agarose gel, depurinated with 0.25 M HCl, denatured with 1.5 M NaCl, 0.5 M NaOH neutralized with 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.0), and transferred with 20× saline-sodium citrate buffer onto a Hybond-N+ nylon membrane (GE Health care, Piscataway, NJ). .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    In Situ:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Hydrophobic Interaction Chromatography:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Random Hexamer Labeling:

    Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
    Article Snippet: .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP. ..

    Concentration Assay:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. NEBNext Adaptor (0.05 μM final concentration, E7335L and E750L, NEB) was ligated to A-tailed DNA with T4-Ligase (12 U, M0202L, NEB) in 30 μl 1x T4 Ligase reaction Buffer (B0202S, NEB) shaking at 16 °C overnight, then cleaved by addition of USER™ Enzyme (3 U, M5505L, NEB) for 15 min at 37 °C.

    High Throughput Screening Assay:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Gel Extraction:

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Hood:

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: Wear protective clothing and gloves and handle under a fume hood. .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs dna polymerase i klenow fragment
    Dna Polymerase I Klenow Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase i klenow fragment/product/New England Biolabs
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    dna polymerase i klenow fragment - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs klenow fragment
    Klenow Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klenow fragment/product/New England Biolabs
    Average 90 stars, based on 230 article reviews
    Price from $9.99 to $1999.99
    klenow fragment - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results