Review

kcc2 sirna (Santa Cruz Biotechnology)

Name: kcc2 sirna
Brand: Santa Cruz Biotechnology
Rating: 86 (1 reviews)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Santa Cruz Biotechnology kcc2 sirna

<t>APP‐KCC2</t> interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Kcc2 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kcc2 sirna/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews

kcc2 sirna - by Bioz Stars, 2025-07

86/100 stars

Images

1) Product Images from "Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model"

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

Journal: Aging Cell

doi: 10.1111/acel.13573

APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Figure Legend Snippet: APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Techniques Used: Clinical Proteomics, Membrane, Western Blot, Immunoprecipitation, Immunohistochemistry, Control

Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Figure Legend Snippet: Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Techniques Used: Phospho-proteomics, Ubiquitin Proteomics, Immunoprecipitation, Isolation, Western Blot, Incubation, Membrane, Control

Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Figure Legend Snippet: Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Techniques Used: Membrane, Western Blot, Phospho-proteomics, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Immunohistochemistry, Fluorescence, Flow Cytometry, Software, Labeling

Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Figure Legend Snippet: Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Techniques Used: Phospho-proteomics, Activation Assay, Clinical Proteomics, Membrane

Figure Legend Snippet: List of reagent or resource used in this study

Techniques Used: Ubiquitin Proteomics, Plasmid Preparation, ATP Assay, Enzyme-linked Immunosorbent Assay, Clinical Proteomics, Membrane, Isolation, Cell Fractionation

Image Search Results

KCC2 mediates the effects of IL-1β on neonatal severe inflammation-induced cognitive impairment. (A) Schematic illustrating the chronological order used for the establishment of the inflammation model and KCC2 level testing. Five litters were used in this cohort of experiment. (B) The protein levels of KCC2 in P7 (left panel, n = 6), P14 (middle panel, n = 6), and P30 (right panel, n = 6) rats after LPS injection. (C) Schematic illustrating the chronological order used for siRNA injection, establishment of the inflammation model, and cognitive testing. Nine litters were used in this cohort of experiment. (D) The knockdown efficiency of KCC2-siRNA by PCR ( n = 6). (E) Learning curve for the escape latency. (F) Time spent in the target quadrant ( n = 10–15). (G) Distance spent in the target quadrant ( n = 10–15). (H) Number of platform crossings ( n = 10–15). (I) Mean velocity during the spatial probe test ( n = 10–15). (J) The freezing time of rats during FC training. (K) The freezing time of rats in the context FC test ( n = 10–15). (L) The freezing time of rats in the cued FC test ( n = 10–15). LPS: lipopolysaccharide; NS: normal saline; MWM: Morris water maze; FC: fear conditioning; Panels B and D were compared by unpaired two-tailed Student’s t test; Panels F, G, H, I, K and L were compared by one-way ANOVA with repeated measures followed by a Tukey post hoc test; * P < 0.05, ** P < 0.01, and *** P < 0.001, n.s.: no significance; Error bars indicate SD

Journal: BMC Medicine

Article Title: Severe inflammation in new-borns induces long-term cognitive impairment by activation of IL-1β/KCC2 signaling during early development

doi: 10.1186/s12916-022-02434-w

Figure Lengend Snippet: KCC2 mediates the effects of IL-1β on neonatal severe inflammation-induced cognitive impairment. (A) Schematic illustrating the chronological order used for the establishment of the inflammation model and KCC2 level testing. Five litters were used in this cohort of experiment. (B) The protein levels of KCC2 in P7 (left panel, n = 6), P14 (middle panel, n = 6), and P30 (right panel, n = 6) rats after LPS injection. (C) Schematic illustrating the chronological order used for siRNA injection, establishment of the inflammation model, and cognitive testing. Nine litters were used in this cohort of experiment. (D) The knockdown efficiency of KCC2-siRNA by PCR ( n = 6). (E) Learning curve for the escape latency. (F) Time spent in the target quadrant ( n = 10–15). (G) Distance spent in the target quadrant ( n = 10–15). (H) Number of platform crossings ( n = 10–15). (I) Mean velocity during the spatial probe test ( n = 10–15). (J) The freezing time of rats during FC training. (K) The freezing time of rats in the context FC test ( n = 10–15). (L) The freezing time of rats in the cued FC test ( n = 10–15). LPS: lipopolysaccharide; NS: normal saline; MWM: Morris water maze; FC: fear conditioning; Panels B and D were compared by unpaired two-tailed Student’s t test; Panels F, G, H, I, K and L were compared by one-way ANOVA with repeated measures followed by a Tukey post hoc test; * P < 0.05, ** P < 0.01, and *** P < 0.001, n.s.: no significance; Error bars indicate SD

Article Snippet: IL-1β-siRNA, KCC2-siRNA or negative control was mixed with In vivo SilenceMag™ transfection reagent (OZ Biosciences, Marseille, France) to a final concentration of 1 μg μL −1 20 min before injection.

Techniques: Injection, Two Tailed Test

RNA profiling of the SCN samples showed the distinct transcriptome by the TRF entrainment at ZT0-4 (A) FPKM of clock genes in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. n = 3 per time point. (B) PCA of SCN RNA-seq data at CT1, CT7, CT13 and CT19 in three groups: ZT0-4 TRF, ZT8-12 TRF and ad libitum , (n = 3 per time point). (C) KEGG and GO pathway analysis of the 142 most relevant genes. (D) Changes in Igf2 and Igfbp6 in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (E) Change in ion transport in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (F and G) Relative expression levels of Kcc2 (F) and Igf2 (G) in the CT0 SCN samples of the seventh day after ZT0-4 TRF under constant darkness in both the ad libitum control and ZT0-4 TRF groups. Values represent the average ±SD, ∗: p < 0.05, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figures S7 and . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: RNA profiling of the SCN samples showed the distinct transcriptome by the TRF entrainment at ZT0-4 (A) FPKM of clock genes in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. n = 3 per time point. (B) PCA of SCN RNA-seq data at CT1, CT7, CT13 and CT19 in three groups: ZT0-4 TRF, ZT8-12 TRF and ad libitum , (n = 3 per time point). (C) KEGG and GO pathway analysis of the 142 most relevant genes. (D) Changes in Igf2 and Igfbp6 in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (E) Change in ion transport in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (F and G) Relative expression levels of Kcc2 (F) and Igf2 (G) in the CT0 SCN samples of the seventh day after ZT0-4 TRF under constant darkness in both the ad libitum control and ZT0-4 TRF groups. Values represent the average ±SD, ∗: p < 0.05, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figures S7 and .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: RNA Sequencing, Expressing, Control, Two Tailed Test

Kcc2 knockdown in SCN GABAergic and NMS neurons increased the free-running locomotion range (A) Two representative actograms of locomotors in control (n = 15) and Kcc2 knockdown (n = 7) mice injected with AAV-VGAT-Cre and Cre inducible scramble or Kcc2 shRNA in the SCN. All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The expression of KCC2 (green) was verified by KCC2 antibody in SCN slices after experiments. The AAV injection site (red) was also verified by SCN slices. (Scale bar: 100 μm). (B) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 6) mice after 2 weeks of ZT0-4 TRF entrainment. (Scale bar: 100 μm). (C) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 4) mice after 2 weeks of ZT8-12 TRF entrainment. (Scale bar: 100 μm). (D) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 8) in NMS-Cre mice. (E) Statistical analysis of the locomotion range of each group in (A), (B) and (C). (F) Statistics of the locomotion range in NMS-Cre mice. Values represent the average ±SD, ∗∗∗∗: p < 0.0001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figure S9 . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: Kcc2 knockdown in SCN GABAergic and NMS neurons increased the free-running locomotion range (A) Two representative actograms of locomotors in control (n = 15) and Kcc2 knockdown (n = 7) mice injected with AAV-VGAT-Cre and Cre inducible scramble or Kcc2 shRNA in the SCN. All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The expression of KCC2 (green) was verified by KCC2 antibody in SCN slices after experiments. The AAV injection site (red) was also verified by SCN slices. (Scale bar: 100 μm). (B) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 6) mice after 2 weeks of ZT0-4 TRF entrainment. (Scale bar: 100 μm). (C) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 4) mice after 2 weeks of ZT8-12 TRF entrainment. (Scale bar: 100 μm). (D) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 8) in NMS-Cre mice. (E) Statistical analysis of the locomotion range of each group in (A), (B) and (C). (F) Statistics of the locomotion range in NMS-Cre mice. Values represent the average ±SD, ∗∗∗∗: p < 0.0001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figure S9 .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Knockdown, Control, Injection, shRNA, Expressing, Two Tailed Test

The IGF2-KCC2 pathway regulates the aftereffect of the ZT0-4 TRF on locomotion changes (A) Two representative actograms of control (n = 7), IGF2 inhibitor-Chromeceptin (n = 7) and IGF1R inhibitor-GSK1904529A (n = 5) treated mice that were administered with 1 week of TRF entrainment and Chromeceptin (n = 5) treated mice with cage changes. (B) Statistical analysis of locomotion range under DD in control, IGF2R inhibitor GSK1904529A, IGF2 inhibitor Chromeceptin-treated TRF-entrained mice and Chromeceptin-treated mice without TRF. (C) A mixture of AAV-VGAT-Cre and AAV with Cre inducible EGFP and IGF2 was injected into the SCN of wild-type mice. Two representative actograms of locomotors in SCN GABAergic neurons EGFP-overexpressing control (n = 4) and IGF2-overexpressing mice (n = 4). All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The AAV injection site (green) was also verified by SCN slices. (Scale bar: 100 μm). (D) Statistics of the locomotion range for EGFP- and IGF2- overexpressing mice. (E) The Kcc2 mRNA expression in rat SCN 2.2 cells administered with PBS, a low concentration of IGF2 (IGF2-L, 5 ng/mL), a moderate concentration of IGF2 (IGF2-M, 50 ng/mL) and a high concentration of IGF2 (IGF2-H, 500 ng/mL). (F) The working model of the effect of ZT0-4 TRF on SCN. ZT0-4 TRF affects the SCN plasticity by regulating Igf2 signaling and thereby ion transport Kcc2 , and finally influence the circadian output such as the neuron Ca 2+ rhythm, sleep-wake cycle and locomotion range. Values represent the average ±SD， ∗: p < 0.05, ∗∗∗: p < 0.001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figure S10 . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: The IGF2-KCC2 pathway regulates the aftereffect of the ZT0-4 TRF on locomotion changes (A) Two representative actograms of control (n = 7), IGF2 inhibitor-Chromeceptin (n = 7) and IGF1R inhibitor-GSK1904529A (n = 5) treated mice that were administered with 1 week of TRF entrainment and Chromeceptin (n = 5) treated mice with cage changes. (B) Statistical analysis of locomotion range under DD in control, IGF2R inhibitor GSK1904529A, IGF2 inhibitor Chromeceptin-treated TRF-entrained mice and Chromeceptin-treated mice without TRF. (C) A mixture of AAV-VGAT-Cre and AAV with Cre inducible EGFP and IGF2 was injected into the SCN of wild-type mice. Two representative actograms of locomotors in SCN GABAergic neurons EGFP-overexpressing control (n = 4) and IGF2-overexpressing mice (n = 4). All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The AAV injection site (green) was also verified by SCN slices. (Scale bar: 100 μm). (D) Statistics of the locomotion range for EGFP- and IGF2- overexpressing mice. (E) The Kcc2 mRNA expression in rat SCN 2.2 cells administered with PBS, a low concentration of IGF2 (IGF2-L, 5 ng/mL), a moderate concentration of IGF2 (IGF2-M, 50 ng/mL) and a high concentration of IGF2 (IGF2-H, 500 ng/mL). (F) The working model of the effect of ZT0-4 TRF on SCN. ZT0-4 TRF affects the SCN plasticity by regulating Igf2 signaling and thereby ion transport Kcc2 , and finally influence the circadian output such as the neuron Ca 2+ rhythm, sleep-wake cycle and locomotion range. Values represent the average ±SD， ∗: p < 0.05, ∗∗∗: p < 0.001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figure S10 .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Control, Injection, Expressing, Concentration Assay, Two Tailed Test

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet:

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Virus, Recombinant, shRNA, Sequencing, Software

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Clinical Proteomics, Membrane, Western Blot, Immunoprecipitation, Immunohistochemistry, Control

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Phospho-proteomics, Ubiquitin Proteomics, Immunoprecipitation, Isolation, Western Blot, Incubation, Membrane, Control

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Membrane, Western Blot, Phospho-proteomics, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Immunohistochemistry, Fluorescence, Flow Cytometry, Software, Labeling

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Phospho-proteomics, Activation Assay, Clinical Proteomics, Membrane

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: List of reagent or resource used in this study

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Ubiquitin Proteomics, Plasmid Preparation, ATP Assay, Enzyme-linked Immunosorbent Assay, Clinical Proteomics, Membrane, Isolation, Cell Fractionation

Recombinant, Flag-tagged KCC2 transporter is targeted to the somatodendritic neuron cell surface and preferentially accumulates at synapses. A, Scheme showing the site of insertion of the three Flag sequence in the second extracellular loop between transmembrane segments 3 and 4. B, Flag-tag staining (red) in permeabilized hippocampal neurons (22 DIV) transfected with KCC2–Flag and eGFP (green). Insets, Higher magnification of the regions of interest in B. Scale bars, 10 μm. KCC2–Flag immunoreactivity is somatodendritic (arrow) and absent from axons (arrowhead). C, D, Flag (red, C) or KCC2 (red, D) staining in neurons transfected with KCC2–Flag plus eGFP (C) or eGFP alone (D). Scale bar, 1 μm. Flag-tagged KCC2 forms numerous clusters in dendritic shafts (arrow) and spines (arrowheads) as the endogenous KCC2 protein. E–G, KCC2–Flag clusters at synapses. E, KCC2–Flag surface staining (blue) in neurons cotransfected with homer1c–GFP (green) and gephyrin–mRFP (red), two markers of excitatory (ES) and inhibitory (IS) synapses. Note that some KCC2–Flag clusters partially overlaid homer1c–GFP clusters (crossed arrow) or gephyrin–mRFP clusters (double crossed arrow), whereas others are associated with the extrasynaptic membrane (arrowhead). Scale bar, 2 μm. F, Quantification of the proportion of KCC2–Flag membrane clusters at synapses (syn) compared with extrasynaptic membrane (extra), showing a preferential localization of KCC2 in the vicinity of synapses (n = 40; 3 cultures; ***p < 10−4). G, Comparable proportion of KCC2 at excitatory (ES) and inhibitory (IS) synapses (n = 40; 3 cultures).

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Recombinant, Flag-tagged KCC2 transporter is targeted to the somatodendritic neuron cell surface and preferentially accumulates at synapses. A, Scheme showing the site of insertion of the three Flag sequence in the second extracellular loop between transmembrane segments 3 and 4. B, Flag-tag staining (red) in permeabilized hippocampal neurons (22 DIV) transfected with KCC2–Flag and eGFP (green). Insets, Higher magnification of the regions of interest in B. Scale bars, 10 μm. KCC2–Flag immunoreactivity is somatodendritic (arrow) and absent from axons (arrowhead). C, D, Flag (red, C) or KCC2 (red, D) staining in neurons transfected with KCC2–Flag plus eGFP (C) or eGFP alone (D). Scale bar, 1 μm. Flag-tagged KCC2 forms numerous clusters in dendritic shafts (arrow) and spines (arrowheads) as the endogenous KCC2 protein. E–G, KCC2–Flag clusters at synapses. E, KCC2–Flag surface staining (blue) in neurons cotransfected with homer1c–GFP (green) and gephyrin–mRFP (red), two markers of excitatory (ES) and inhibitory (IS) synapses. Note that some KCC2–Flag clusters partially overlaid homer1c–GFP clusters (crossed arrow) or gephyrin–mRFP clusters (double crossed arrow), whereas others are associated with the extrasynaptic membrane (arrowhead). Scale bar, 2 μm. F, Quantification of the proportion of KCC2–Flag membrane clusters at synapses (syn) compared with extrasynaptic membrane (extra), showing a preferential localization of KCC2 in the vicinity of synapses (n = 40; 3 cultures; ***p < 10−4). G, Comparable proportion of KCC2 at excitatory (ES) and inhibitory (IS) synapses (n = 40; 3 cultures).

Article Snippet: Neuronal transfections with KCC2–IRES–GFP, KCC2–Flag, KCC2–CTD ( Gauvain et al., 2011 ), KCC2–Flag–S940D, KCC2–Flag–S940A, the shRNA sequence against rat 4.1N mRNA (4.1N shRNA) and nontarget shRNA sequence (NT shRNA), the shRNA sequence against rat KCC2 mRNA and nontarget shRNA sequence ( Gauvain et al., 2011 ), chicken NCAM-120, gephyrin–mRFP ( Hanus et al., 2006 ; gift from A. Triller, École Normale Supérieure, INSERM, Paris, France), and homer1c–GFP ( Bats et al., 2007 ; gift from D. Choquet, Centre National de la Recherche Scientifique, Bordeaux, France) were done at 13–14 d in vitro (DIV) using Lipofectamine 2000 (Invitrogen) or Transfectin (Bio-Rad), according to the instructions of the manufacturers (DNA/lipofectant ratio of 1:3 μg/μl), with 1 μg of plasmid DNA per 20 mm well.

Techniques: Recombinant, Sequencing, FLAG-tag, Staining, Transfection, Membrane

Recombinant KCC2–Flag is functional, and its expression does not perturb chloride extrusion in neurons. A, Calibration of the CFP–YFP chloride sensor (n = 12 for each chloride concentration, 3 cultures). B, C, Live cell ratiometric chloride imaging in COS cells transfected with the CFP–YFP chloride sensor (Cl− sensor) alone or in combination with WT (KCC2–WT) or Flag-tagged KCC2 (KCC2–Flag). B, Images show the F440/F480 fluorescence ratio. Scale bar, 20 μm. C, Quantifications showing significant (***p < 10−3) decrease in the CFP/YFP ratio in cells expressing the Cl− sensor in combination with KCC2–WT or KCC2–Flag versus cells expressing the chloride sensor alone. Cl− sensor, r = 1.0 ± 0.02, n = 51; KCC2–WT, r = 0.86 ± 0.03, n = 53; KCC2–Flag, r = 0.83 ± 0.02, n = 53, four cultures. No significant difference between cells expressing WT or Flag-tagged KCC2 (p = 7 × 10−2) demonstrating that Flag-tag insertion in the second predicted extracellular loop does not compromise KCC2 function. D–F, No effect of KCC2–Flag expression on chloride export estimated from the somatodendritic EGABA gradient. D, E, Representative currents at voltage steps ranging from −75 to −25 mV during Rubi-GABA uncaging at somatic and dendritic sites (D) and normalized I–V relationships (E). Note the leftward shift in I–V relationships of dendritic versus somatic GABA currents. F, Mean somatodendritic EGABA gradient from seven (eGFP) and nine (KCC2–Flag) cells.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Recombinant KCC2–Flag is functional, and its expression does not perturb chloride extrusion in neurons. A, Calibration of the CFP–YFP chloride sensor (n = 12 for each chloride concentration, 3 cultures). B, C, Live cell ratiometric chloride imaging in COS cells transfected with the CFP–YFP chloride sensor (Cl− sensor) alone or in combination with WT (KCC2–WT) or Flag-tagged KCC2 (KCC2–Flag). B, Images show the F440/F480 fluorescence ratio. Scale bar, 20 μm. C, Quantifications showing significant (***p < 10−3) decrease in the CFP/YFP ratio in cells expressing the Cl− sensor in combination with KCC2–WT or KCC2–Flag versus cells expressing the chloride sensor alone. Cl− sensor, r = 1.0 ± 0.02, n = 51; KCC2–WT, r = 0.86 ± 0.03, n = 53; KCC2–Flag, r = 0.83 ± 0.02, n = 53, four cultures. No significant difference between cells expressing WT or Flag-tagged KCC2 (p = 7 × 10−2) demonstrating that Flag-tag insertion in the second predicted extracellular loop does not compromise KCC2 function. D–F, No effect of KCC2–Flag expression on chloride export estimated from the somatodendritic EGABA gradient. D, E, Representative currents at voltage steps ranging from −75 to −25 mV during Rubi-GABA uncaging at somatic and dendritic sites (D) and normalized I–V relationships (E). Note the leftward shift in I–V relationships of dendritic versus somatic GABA currents. F, Mean somatodendritic EGABA gradient from seven (eGFP) and nine (KCC2–Flag) cells.

Techniques: Recombinant, Functional Assay, Expressing, Concentration Assay, Imaging, Transfection, Fluorescence, FLAG-tag

Membrane dynamics of the KCC2 transporter studied with QD-based SPT. A, Representative trajectories (white) of QD-bound Flag-tagged recombinant KCC2 in extrasynaptic membrane (1014 frames, D = 3 × 10−2 μm2s−1), at excitatory synapses (1002 frames, D = 2 × 10−2 μm2s−1), and at inhibitory synapses (773 frames, D = 4 × 10−2 μm2s−1). QD trajectories (white) were overlaid with fluorescent clusters of recombinant homer1c–GFP (green) and gephyrin–mRFP (red) to identify excitatory (ES) and inhibitory (IS) synapses, respectively. Scale bars, 1 μm. B, Time-averaged MSD functions of extrasynaptic QDs (black), QDs at excitatory synapses (green), and QDs at inhibitory synapses (red). The MSD versus time relationship for extrasynaptic trajectories shows a steeper initial slope, suggesting that trajectories were less confined. C, Decreased size of the confinement domain L for synaptic QDs showing increased confinement (***p < 10−3). D, E, Cumulative probabilities (D) and median values ± 25–75% IQR (E) of QD diffusion coefficients D in extrasynaptic membrane (black) or at excitatory (green) or inhibitory (red) synapses. Note the reduced diffusion at synapses (**p = 2 × 10−3, ***p < 10−3). F, Cumulative probability plots of KCC2–Flag DTs are shifted toward higher values at excitatory synapses (p = 6 × 10−2). G, Mean DTs at excitatory synapses (green) and at inhibitory synapses (red) showing increased DT of KCC2–Flag at excitatory synapses (*p < 5 × 10−2).

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Membrane dynamics of the KCC2 transporter studied with QD-based SPT. A, Representative trajectories (white) of QD-bound Flag-tagged recombinant KCC2 in extrasynaptic membrane (1014 frames, D = 3 × 10−2 μm2s−1), at excitatory synapses (1002 frames, D = 2 × 10−2 μm2s−1), and at inhibitory synapses (773 frames, D = 4 × 10−2 μm2s−1). QD trajectories (white) were overlaid with fluorescent clusters of recombinant homer1c–GFP (green) and gephyrin–mRFP (red) to identify excitatory (ES) and inhibitory (IS) synapses, respectively. Scale bars, 1 μm. B, Time-averaged MSD functions of extrasynaptic QDs (black), QDs at excitatory synapses (green), and QDs at inhibitory synapses (red). The MSD versus time relationship for extrasynaptic trajectories shows a steeper initial slope, suggesting that trajectories were less confined. C, Decreased size of the confinement domain L for synaptic QDs showing increased confinement (***p < 10−3). D, E, Cumulative probabilities (D) and median values ± 25–75% IQR (E) of QD diffusion coefficients D in extrasynaptic membrane (black) or at excitatory (green) or inhibitory (red) synapses. Note the reduced diffusion at synapses (**p = 2 × 10−3, ***p < 10−3). F, Cumulative probability plots of KCC2–Flag DTs are shifted toward higher values at excitatory synapses (p = 6 × 10−2). G, Mean DTs at excitatory synapses (green) and at inhibitory synapses (red) showing increased DT of KCC2–Flag at excitatory synapses (*p < 5 × 10−2).

Techniques: Membrane, Recombinant, Diffusion-based Assay

Diffusion properties of KCC2–Flag at excitatory and inhibitory synapses

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Diffusion properties of KCC2–Flag at excitatory and inhibitory synapses

Techniques: Diffusion-based Assay

F-actin depolymerization and KCC2–actin binding interference increase the lateral diffusion of KCC2. A–C, Cumulative probability plots of diffusion coefficients (for bulk population of QDs) of KCC2–Flag in control conditions (gray in A) or during application of latrunculin A (black in A), in neurons transfected with eGFP (gray in B), KCC2–CTD (black in B), nontarget shRNA (gray in C), and shRNA against 4.1N (black in C). Note the increase (***p < 10−4) in KCC2–Flag diffusion coefficients during actin depolymerization, KCC2–CTD overexpression, or 4.1N suppression. D–F, Examples of KCC2–Flag trajectories in control (D; 827 frames, D = 4 × 10−2 μm2s−1) versus latrunculin A application (D; 944 frames, D = 9 × 10−2 μm2s−1), or in neurons transfected with eGFP (E; 974 frames, D = 4 × 10−2 μm2s−1) versus KCC2–CTD (E; 554 frames, D = 9 × 10−2 μm2s−1), or in nontarget shRNA (F; 494 frames, D = 4 × 10−2 μm2s−1) versus 4.1N shRNA (F; 380 frames, D = 13 × 10−2 μm2s−1) expressing neurons. QD trajectories were overlaid with fluorescent clusters of recombinant homer1c–GFP (green) to identify excitatory synapses. Scale bars, 0.5 μm. Note the increase in surface exploration and faster escape of KCC2 from excitatory synapses (green). G–I, Significant reduction in KCC2–Flag DT at excitatory synapses (ES) but not at inhibitory synapses (IS) after actin depolymerization with latrunculin (IS, p = 0.9), reduced KCC2 actin binding with KCC2–CTD overexpression or 4.1N suppression (G, **p = 3 × 10−3; H, ***p < 10−4; I, **p = 1.2 × 10−3). Ctrl, Control; lat, latrunculin.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: F-actin depolymerization and KCC2–actin binding interference increase the lateral diffusion of KCC2. A–C, Cumulative probability plots of diffusion coefficients (for bulk population of QDs) of KCC2–Flag in control conditions (gray in A) or during application of latrunculin A (black in A), in neurons transfected with eGFP (gray in B), KCC2–CTD (black in B), nontarget shRNA (gray in C), and shRNA against 4.1N (black in C). Note the increase (***p < 10−4) in KCC2–Flag diffusion coefficients during actin depolymerization, KCC2–CTD overexpression, or 4.1N suppression. D–F, Examples of KCC2–Flag trajectories in control (D; 827 frames, D = 4 × 10−2 μm2s−1) versus latrunculin A application (D; 944 frames, D = 9 × 10−2 μm2s−1), or in neurons transfected with eGFP (E; 974 frames, D = 4 × 10−2 μm2s−1) versus KCC2–CTD (E; 554 frames, D = 9 × 10−2 μm2s−1), or in nontarget shRNA (F; 494 frames, D = 4 × 10−2 μm2s−1) versus 4.1N shRNA (F; 380 frames, D = 13 × 10−2 μm2s−1) expressing neurons. QD trajectories were overlaid with fluorescent clusters of recombinant homer1c–GFP (green) to identify excitatory synapses. Scale bars, 0.5 μm. Note the increase in surface exploration and faster escape of KCC2 from excitatory synapses (green). G–I, Significant reduction in KCC2–Flag DT at excitatory synapses (ES) but not at inhibitory synapses (IS) after actin depolymerization with latrunculin (IS, p = 0.9), reduced KCC2 actin binding with KCC2–CTD overexpression or 4.1N suppression (G, **p = 3 × 10−3; H, ***p < 10−4; I, **p = 1.2 × 10−3). Ctrl, Control; lat, latrunculin.

Techniques: Binding Assay, Diffusion-based Assay, Control, Transfection, shRNA, Over Expression, Expressing, Recombinant

Effects of F-actin depolymerization and interference with actin binding on KCC2 mobility at excitatory and inhibitory synapses

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Effects of F-actin depolymerization and interference with actin binding on KCC2 mobility at excitatory and inhibitory synapses

Techniques: Binding Assay, Control, shRNA

Effects of overexpression of the CTD of KCC2 on its clustering. A, KCC2–Flag remains clustered at the surface of hippocampal neurons after KCC2–CTD overexpression. Scale bar, 10 μm. B, Summary plots of the effect of KCC2–CTD overexpression on the number of KCC2–Flag clusters per 10 μm2, cluster size, mean fluorescence intensity per cluster, and mean fluorescence intensity per pixel within clusters. Values were normalized to the corresponding control values. eGFP, n = 36; KCC2–CTD, n = 34; three cultures; ***p < 10−3.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Effects of overexpression of the CTD of KCC2 on its clustering. A, KCC2–Flag remains clustered at the surface of hippocampal neurons after KCC2–CTD overexpression. Scale bar, 10 μm. B, Summary plots of the effect of KCC2–CTD overexpression on the number of KCC2–Flag clusters per 10 μm2, cluster size, mean fluorescence intensity per cluster, and mean fluorescence intensity per pixel within clusters. Values were normalized to the corresponding control values. eGFP, n = 36; KCC2–CTD, n = 34; three cultures; ***p < 10−3.

Techniques: Over Expression, Fluorescence, Control

Elevated neuronal activity increases the membrane dynamics of KCC2 at excitatory synapses. A, Examples of trajectories of QD-coupled KCC2–Flag and NCAM-120 in the absence (1049 and 708 frames) or presence of 4-AP (1155 and 825 frames). Scale bar, 0.5 μm. B, Cumulative probabilities of diffusion coefficients (for bulk population of QDs) associated with KCC2–Flag (control, n = 507; 4-AP, n = 430, 4 cultures) or NCAM-120 (inset; control, n = 241; 4-AP, n = 228, 2 cultures) in the absence (gray) or presence (black) of 4-AP. Note the selective increase in KCC2 diffusion after 4-AP treatment (***p < 10−3). C, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs) measured in the absence (left) or presence (right) of the membrane-permeant dynamin inhibitory peptide (dynamin inh) in control (gray) or 4-AP (black) conditions. Slowing down of KCC2 (***p < 10−4) in the presence of endocytosis blocker in basal activity conditions. In the same culture, 4-AP increased KCC2 mobility in the absence (*p = 3 × 10−2) or presence (***p < 10−4) of the dynamin inhibitory peptide. D–F, Median diffusion coefficients ± 25–75% IQR (D), mean confinement domain L (E), and mean DT (F) of KCC2–Flag in the extrasynaptic region (extra), at excitatory (ES) or inhibitory (IS) synapses, in the absence (gray) or presence (black) of 4-AP. Acute 4-AP treatment increased KCC2 diffusion coefficients in all membrane compartments (*p = 2 × 10−2; ***p = 5 × 10−4), whereas it selectively reduced confinement and DT at excitatory synapses (***p < 10−3). Ctrl, Control.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Elevated neuronal activity increases the membrane dynamics of KCC2 at excitatory synapses. A, Examples of trajectories of QD-coupled KCC2–Flag and NCAM-120 in the absence (1049 and 708 frames) or presence of 4-AP (1155 and 825 frames). Scale bar, 0.5 μm. B, Cumulative probabilities of diffusion coefficients (for bulk population of QDs) associated with KCC2–Flag (control, n = 507; 4-AP, n = 430, 4 cultures) or NCAM-120 (inset; control, n = 241; 4-AP, n = 228, 2 cultures) in the absence (gray) or presence (black) of 4-AP. Note the selective increase in KCC2 diffusion after 4-AP treatment (***p < 10−3). C, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs) measured in the absence (left) or presence (right) of the membrane-permeant dynamin inhibitory peptide (dynamin inh) in control (gray) or 4-AP (black) conditions. Slowing down of KCC2 (***p < 10−4) in the presence of endocytosis blocker in basal activity conditions. In the same culture, 4-AP increased KCC2 mobility in the absence (*p = 3 × 10−2) or presence (***p < 10−4) of the dynamin inhibitory peptide. D–F, Median diffusion coefficients ± 25–75% IQR (D), mean confinement domain L (E), and mean DT (F) of KCC2–Flag in the extrasynaptic region (extra), at excitatory (ES) or inhibitory (IS) synapses, in the absence (gray) or presence (black) of 4-AP. Acute 4-AP treatment increased KCC2 diffusion coefficients in all membrane compartments (*p = 2 × 10−2; ***p = 5 × 10−4), whereas it selectively reduced confinement and DT at excitatory synapses (***p < 10−3). Ctrl, Control.

Techniques: Activity Assay, Membrane, Diffusion-based Assay, Control

Molecular mechanisms underlying 4-AP-dependent regulation of KCC2 lateral diffusion

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Molecular mechanisms underlying 4-AP-dependent regulation of KCC2 lateral diffusion

Techniques: Diffusion-based Assay, Control

Effects of 4-AP on KCC2 lateral diffusion parameters

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Effects of 4-AP on KCC2 lateral diffusion parameters

Techniques: Diffusion-based Assay, Control

Increased neuronal activity disperses KCC2 clusters and reduces chloride export. A, Flag surface staining in hippocampal neurons (23 DIV) expressing recombinant KCC2–Flag in the absence (Control) or presence of 4-AP for 10 min and after a 30 min washout (Wash). Scale bar, 10 μm. Note the loss of KCC2 clusters after 10 min exposure to 4-AP and the recovery of clusters 30 min after drug washout. B, Quantifications showing significant reduction in the number of KCC2–Flag clusters per 10 μm2 (left), cluster size (middle), and cluster intensity (right) after 10 min of 4-AP. Values were normalized to the corresponding control values. Control, n = 26; 4-AP at 10 min, n = 31; three cultures; *p = 3 × 10−2, **p = 2 × 10−3, ***p < 10−3. C, The mean fluorescence intensity of KCC2–Flag clusters was reduced by 30% in neurons exposed for 10 min to 4-AP (black) compared with untreated cells (gray). The mean cluster intensity started to increase 10 min (fine hatched) after drug removal to return to control values 30 min (large hatched) later. Values were normalized to the corresponding control values. Control, n = 22; 4-AP at 10 min, n = 26; 4-AP washout at 10 min, n = 25; 4-AP washout at 30 min, n = 22; two cultures; *p = 3 × 10−2. D, Effect of 4-AP on the mean fluorescence intensity of KCC2 aggregates at excitatory (ES) and inhibitory (IS) synapses showing dispersion of KCC2 clusters at either type of synapses after 10 min (black) or 1 h (black dots) exposure to 4-AP compared with control conditions (gray). Values were normalized to the corresponding control. Excitatory synapses: control, n = 38; 4-AP at 10 min, n = 31; 4-AP at 1 h, n = 31; inhibitory synapses: control, n = 39; 4-AP at 10 min, n = 31; 4-AP at 1 h, n = 32; four cultures; ***p < 10−3. E, 4-AP reduces the chloride ion transport capacity of treated neurons. Reduced somatodendritic EGABA gradient in neurons exposed to 4-AP (black) versus neurons maintained in control (gray) conditions (control, 14.0 ± 1.2, n = 12; 4-AP, 9.5 ± 0.9, n = 16; t test, **p = 5.0 × 10−3). In comparison, KCC2 shRNA (white) reduced by 98% the somatodendritic EGABA gradient (0.3 ± 0.9, n = 5; t test, ***p < 10−3). Ctrl, Control.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: Increased neuronal activity disperses KCC2 clusters and reduces chloride export. A, Flag surface staining in hippocampal neurons (23 DIV) expressing recombinant KCC2–Flag in the absence (Control) or presence of 4-AP for 10 min and after a 30 min washout (Wash). Scale bar, 10 μm. Note the loss of KCC2 clusters after 10 min exposure to 4-AP and the recovery of clusters 30 min after drug washout. B, Quantifications showing significant reduction in the number of KCC2–Flag clusters per 10 μm2 (left), cluster size (middle), and cluster intensity (right) after 10 min of 4-AP. Values were normalized to the corresponding control values. Control, n = 26; 4-AP at 10 min, n = 31; three cultures; *p = 3 × 10−2, **p = 2 × 10−3, ***p < 10−3. C, The mean fluorescence intensity of KCC2–Flag clusters was reduced by 30% in neurons exposed for 10 min to 4-AP (black) compared with untreated cells (gray). The mean cluster intensity started to increase 10 min (fine hatched) after drug removal to return to control values 30 min (large hatched) later. Values were normalized to the corresponding control values. Control, n = 22; 4-AP at 10 min, n = 26; 4-AP washout at 10 min, n = 25; 4-AP washout at 30 min, n = 22; two cultures; *p = 3 × 10−2. D, Effect of 4-AP on the mean fluorescence intensity of KCC2 aggregates at excitatory (ES) and inhibitory (IS) synapses showing dispersion of KCC2 clusters at either type of synapses after 10 min (black) or 1 h (black dots) exposure to 4-AP compared with control conditions (gray). Values were normalized to the corresponding control. Excitatory synapses: control, n = 38; 4-AP at 10 min, n = 31; 4-AP at 1 h, n = 31; inhibitory synapses: control, n = 39; 4-AP at 10 min, n = 31; 4-AP at 1 h, n = 32; four cultures; ***p < 10−3. E, 4-AP reduces the chloride ion transport capacity of treated neurons. Reduced somatodendritic EGABA gradient in neurons exposed to 4-AP (black) versus neurons maintained in control (gray) conditions (control, 14.0 ± 1.2, n = 12; 4-AP, 9.5 ± 0.9, n = 16; t test, **p = 5.0 × 10−3). In comparison, KCC2 shRNA (white) reduced by 98% the somatodendritic EGABA gradient (0.3 ± 0.9, n = 5; t test, ***p < 10−3). Ctrl, Control.

Techniques: Activity Assay, Staining, Expressing, Recombinant, Control, Fluorescence, Dispersion, Comparison, shRNA

NMDAR activation and calcium influx mediate the 4-AP-induced upregulation of KCC2 diffusion. A–E, The increase in KCC2 diffusion coefficients (calculated for bulk population of QDs) after 4-AP (black) was reversed by (hatched bars) TTX (A, ***p < 10−3), d,l-AP-5 (B, ***p < 10−3), or EGTA (C, ***p < 10−3) but not NBQX (D, *p = 1 × 10−2) or R,S-MCPG (E, *p = 1 × 10−2). F, The effect of 4-AP on KCC2 acceleration (black) was partially mimicked by NMDA application (gray, **p = 9 × 10−3). Note also that d,l-AP-5 slows down KCC2 at steady state in conditions of both low (white) and high (black dots) external Mg2+ concentration (1.5 mm Mg2+, n = 223; AP-5 plus 1.5 mm Mg2+, n = 174; ***p < 10−4; 3 mm Mg2+, n = 116; AP-5 plus 3 mm Mg2+, n = 135; ***p < 10−4; AP-5 plus 1.5 mm Mg2+ versus AP-5 plus 3 mm Mg2+, p = 0.5; 1 culture). In all histograms, values are expressed as percentage of change in diffusion coefficients and statistics compared with drugs versus appropriate controls.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: NMDAR activation and calcium influx mediate the 4-AP-induced upregulation of KCC2 diffusion. A–E, The increase in KCC2 diffusion coefficients (calculated for bulk population of QDs) after 4-AP (black) was reversed by (hatched bars) TTX (A, ***p < 10−3), d,l-AP-5 (B, ***p < 10−3), or EGTA (C, ***p < 10−3) but not NBQX (D, *p = 1 × 10−2) or R,S-MCPG (E, *p = 1 × 10−2). F, The effect of 4-AP on KCC2 acceleration (black) was partially mimicked by NMDA application (gray, **p = 9 × 10−3). Note also that d,l-AP-5 slows down KCC2 at steady state in conditions of both low (white) and high (black dots) external Mg2+ concentration (1.5 mm Mg2+, n = 223; AP-5 plus 1.5 mm Mg2+, n = 174; ***p < 10−4; 3 mm Mg2+, n = 116; AP-5 plus 3 mm Mg2+, n = 135; ***p < 10−4; AP-5 plus 1.5 mm Mg2+ versus AP-5 plus 3 mm Mg2+, p = 0.5; 1 culture). In all histograms, values are expressed as percentage of change in diffusion coefficients and statistics compared with drugs versus appropriate controls.

Techniques: Activation Assay, Diffusion-based Assay, Concentration Assay

S940 dephosphorylation and calpain cleavage contribute to the 4-AP-mediated regulation of KCC2 diffusion, clustering, and function. A–C, Dephosphorylation of S940 is required for activity-dependent regulation of KCC2 diffusion. A, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs) of KCC2–S940 (gray) and KCC2–S940A (pattern) in basal activity conditions, showing increased mobility of the dephosphorylated KCC2–S940A transporter (**p = 2 × 10−3). B, C, Median QD diffusion coefficients values ± 25–75% IQR (for bulk population of QDs; B) and mean cluster fluorescence intensity (C) of KCC2–S940 (plain) and phospho-mimetic KCC2–S940D (pattern) in the absence (gray and fine pattern) or presence (black and coarse pattern) of 4-AP. Comparable diffusion behavior and clustering of KCC2–S940D and KCC2–S940. Note that 4-AP selectively reduced diffusion constraints (*p = 2 × 10−2) and clustering (***p < 10−3) of KCC2–S940 but not of KCC2–S940D. C, KCC2–S940, n = 32; KCC2–S940D, n = 30; KCC2–S940 plus 4-AP, n = 31; KCC2–S940D plus 4-AP, n = 28; three cultures. D–F, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs; D), mean cluster fluorescence intensity (E) of KCC2–Flag, and somatodendritic gradient of EGABA (F) in the absence (plain) or presence (pattern) of the calpain protease inhibitor PD150606, in control (gray and fine pattern) versus 4-AP (black and large pattern) conditions. No effect of calpain activity blockade in basal activity conditions. The 4-AP-induced increase in KCC2 diffusion (D, **p = 2 × 10−3) and decrease in clustering (E, ***p < 10−3) and function (F, **p = 5 × 10−3, t test) was reversed by calpain inhibitor (D, ***p < 10−3; E, *p = 2 × 10−2; F, **p = 6 × 10−3, t test). E, Control, n = 32; PD150606, n = 34; 4-AP n = 31; 4-AP plus PD150606, n = 27; three cultures. F, Control, n = 12; 4-AP, n = 16; 4-AP plus PD150606, n = 9.

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: S940 dephosphorylation and calpain cleavage contribute to the 4-AP-mediated regulation of KCC2 diffusion, clustering, and function. A–C, Dephosphorylation of S940 is required for activity-dependent regulation of KCC2 diffusion. A, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs) of KCC2–S940 (gray) and KCC2–S940A (pattern) in basal activity conditions, showing increased mobility of the dephosphorylated KCC2–S940A transporter (**p = 2 × 10−3). B, C, Median QD diffusion coefficients values ± 25–75% IQR (for bulk population of QDs; B) and mean cluster fluorescence intensity (C) of KCC2–S940 (plain) and phospho-mimetic KCC2–S940D (pattern) in the absence (gray and fine pattern) or presence (black and coarse pattern) of 4-AP. Comparable diffusion behavior and clustering of KCC2–S940D and KCC2–S940. Note that 4-AP selectively reduced diffusion constraints (*p = 2 × 10−2) and clustering (***p < 10−3) of KCC2–S940 but not of KCC2–S940D. C, KCC2–S940, n = 32; KCC2–S940D, n = 30; KCC2–S940 plus 4-AP, n = 31; KCC2–S940D plus 4-AP, n = 28; three cultures. D–F, Median QD diffusion coefficient D values ± 25–75% IQR (for bulk population of QDs; D), mean cluster fluorescence intensity (E) of KCC2–Flag, and somatodendritic gradient of EGABA (F) in the absence (plain) or presence (pattern) of the calpain protease inhibitor PD150606, in control (gray and fine pattern) versus 4-AP (black and large pattern) conditions. No effect of calpain activity blockade in basal activity conditions. The 4-AP-induced increase in KCC2 diffusion (D, **p = 2 × 10−3) and decrease in clustering (E, ***p < 10−3) and function (F, **p = 5 × 10−3, t test) was reversed by calpain inhibitor (D, ***p < 10−3; E, *p = 2 × 10−2; F, **p = 6 × 10−3, t test). E, Control, n = 32; PD150606, n = 34; 4-AP n = 31; 4-AP plus PD150606, n = 27; three cultures. F, Control, n = 12; 4-AP, n = 16; 4-AP plus PD150606, n = 9.

Techniques: De-Phosphorylation Assay, Diffusion-based Assay, Activity Assay, Fluorescence, Protease Inhibitor, Control

The KCC2–S940D mutant and PD150606 calpain inhibitor prevented the 4-AP-induced increased mobility of synaptic and extrasynaptic KCC2–Flag transporters

Journal: The Journal of Neuroscience

Article Title: Activity-Dependent Regulation of the K/Cl Transporter KCC2 Membrane Diffusion, Clustering, and Function in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.5889-12.2013

Figure Lengend Snippet: The KCC2–S940D mutant and PD150606 calpain inhibitor prevented the 4-AP-induced increased mobility of synaptic and extrasynaptic KCC2–Flag transporters

Techniques: Mutagenesis

Review

Structured Review

Images

1) Product Images from "Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model"

Similar Products

Image Search Results