Review

kcc2 sirna (Santa Cruz Biotechnology)

Name: kcc2 sirna
Brand: Santa Cruz Biotechnology
Rating: 86 (1 reviews)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Santa Cruz Biotechnology kcc2 sirna

<t>APP‐KCC2</t> interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Kcc2 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kcc2 sirna/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews

kcc2 sirna - by Bioz Stars, 2025-07

86/100 stars

Images

1) Product Images from "Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model"

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

Journal: Aging Cell

doi: 10.1111/acel.13573

APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Figure Legend Snippet: APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Techniques Used: Clinical Proteomics, Membrane, Western Blot, Immunoprecipitation, Immunohistochemistry, Control

Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Figure Legend Snippet: Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Techniques Used: Phospho-proteomics, Ubiquitin Proteomics, Immunoprecipitation, Isolation, Western Blot, Incubation, Membrane, Control

Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Figure Legend Snippet: Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Techniques Used: Membrane, Western Blot, Phospho-proteomics, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Immunohistochemistry, Fluorescence, Flow Cytometry, Software, Labeling

Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Figure Legend Snippet: Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Techniques Used: Phospho-proteomics, Activation Assay, Clinical Proteomics, Membrane

Figure Legend Snippet: List of reagent or resource used in this study

Techniques Used: Ubiquitin Proteomics, Plasmid Preparation, ATP Assay, Enzyme-linked Immunosorbent Assay, Clinical Proteomics, Membrane, Isolation, Cell Fractionation

Image Search Results

KCC2 mediates the effects of IL-1β on neonatal severe inflammation-induced cognitive impairment. (A) Schematic illustrating the chronological order used for the establishment of the inflammation model and KCC2 level testing. Five litters were used in this cohort of experiment. (B) The protein levels of KCC2 in P7 (left panel, n = 6), P14 (middle panel, n = 6), and P30 (right panel, n = 6) rats after LPS injection. (C) Schematic illustrating the chronological order used for siRNA injection, establishment of the inflammation model, and cognitive testing. Nine litters were used in this cohort of experiment. (D) The knockdown efficiency of KCC2-siRNA by PCR ( n = 6). (E) Learning curve for the escape latency. (F) Time spent in the target quadrant ( n = 10–15). (G) Distance spent in the target quadrant ( n = 10–15). (H) Number of platform crossings ( n = 10–15). (I) Mean velocity during the spatial probe test ( n = 10–15). (J) The freezing time of rats during FC training. (K) The freezing time of rats in the context FC test ( n = 10–15). (L) The freezing time of rats in the cued FC test ( n = 10–15). LPS: lipopolysaccharide; NS: normal saline; MWM: Morris water maze; FC: fear conditioning; Panels B and D were compared by unpaired two-tailed Student’s t test; Panels F, G, H, I, K and L were compared by one-way ANOVA with repeated measures followed by a Tukey post hoc test; * P < 0.05, ** P < 0.01, and *** P < 0.001, n.s.: no significance; Error bars indicate SD

Journal: BMC Medicine

Article Title: Severe inflammation in new-borns induces long-term cognitive impairment by activation of IL-1β/KCC2 signaling during early development

doi: 10.1186/s12916-022-02434-w

Figure Lengend Snippet: KCC2 mediates the effects of IL-1β on neonatal severe inflammation-induced cognitive impairment. (A) Schematic illustrating the chronological order used for the establishment of the inflammation model and KCC2 level testing. Five litters were used in this cohort of experiment. (B) The protein levels of KCC2 in P7 (left panel, n = 6), P14 (middle panel, n = 6), and P30 (right panel, n = 6) rats after LPS injection. (C) Schematic illustrating the chronological order used for siRNA injection, establishment of the inflammation model, and cognitive testing. Nine litters were used in this cohort of experiment. (D) The knockdown efficiency of KCC2-siRNA by PCR ( n = 6). (E) Learning curve for the escape latency. (F) Time spent in the target quadrant ( n = 10–15). (G) Distance spent in the target quadrant ( n = 10–15). (H) Number of platform crossings ( n = 10–15). (I) Mean velocity during the spatial probe test ( n = 10–15). (J) The freezing time of rats during FC training. (K) The freezing time of rats in the context FC test ( n = 10–15). (L) The freezing time of rats in the cued FC test ( n = 10–15). LPS: lipopolysaccharide; NS: normal saline; MWM: Morris water maze; FC: fear conditioning; Panels B and D were compared by unpaired two-tailed Student’s t test; Panels F, G, H, I, K and L were compared by one-way ANOVA with repeated measures followed by a Tukey post hoc test; * P < 0.05, ** P < 0.01, and *** P < 0.001, n.s.: no significance; Error bars indicate SD

Article Snippet: IL-1β-siRNA, KCC2-siRNA or negative control was mixed with In vivo SilenceMag™ transfection reagent (OZ Biosciences, Marseille, France) to a final concentration of 1 μg μL −1 20 min before injection.

Techniques: Injection, Two Tailed Test

RNA profiling of the SCN samples showed the distinct transcriptome by the TRF entrainment at ZT0-4 (A) FPKM of clock genes in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. n = 3 per time point. (B) PCA of SCN RNA-seq data at CT1, CT7, CT13 and CT19 in three groups: ZT0-4 TRF, ZT8-12 TRF and ad libitum , (n = 3 per time point). (C) KEGG and GO pathway analysis of the 142 most relevant genes. (D) Changes in Igf2 and Igfbp6 in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (E) Change in ion transport in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (F and G) Relative expression levels of Kcc2 (F) and Igf2 (G) in the CT0 SCN samples of the seventh day after ZT0-4 TRF under constant darkness in both the ad libitum control and ZT0-4 TRF groups. Values represent the average ±SD, ∗: p < 0.05, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figures S7 and . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: RNA profiling of the SCN samples showed the distinct transcriptome by the TRF entrainment at ZT0-4 (A) FPKM of clock genes in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. n = 3 per time point. (B) PCA of SCN RNA-seq data at CT1, CT7, CT13 and CT19 in three groups: ZT0-4 TRF, ZT8-12 TRF and ad libitum , (n = 3 per time point). (C) KEGG and GO pathway analysis of the 142 most relevant genes. (D) Changes in Igf2 and Igfbp6 in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (E) Change in ion transport in the ad libitum , ZT0-4 TRF, and ZT8-12 TRF entrainment groups. (F and G) Relative expression levels of Kcc2 (F) and Igf2 (G) in the CT0 SCN samples of the seventh day after ZT0-4 TRF under constant darkness in both the ad libitum control and ZT0-4 TRF groups. Values represent the average ±SD, ∗: p < 0.05, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figures S7 and .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: RNA Sequencing, Expressing, Control, Two Tailed Test

Kcc2 knockdown in SCN GABAergic and NMS neurons increased the free-running locomotion range (A) Two representative actograms of locomotors in control (n = 15) and Kcc2 knockdown (n = 7) mice injected with AAV-VGAT-Cre and Cre inducible scramble or Kcc2 shRNA in the SCN. All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The expression of KCC2 (green) was verified by KCC2 antibody in SCN slices after experiments. The AAV injection site (red) was also verified by SCN slices. (Scale bar: 100 μm). (B) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 6) mice after 2 weeks of ZT0-4 TRF entrainment. (Scale bar: 100 μm). (C) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 4) mice after 2 weeks of ZT8-12 TRF entrainment. (Scale bar: 100 μm). (D) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 8) in NMS-Cre mice. (E) Statistical analysis of the locomotion range of each group in (A), (B) and (C). (F) Statistics of the locomotion range in NMS-Cre mice. Values represent the average ±SD, ∗∗∗∗: p < 0.0001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figure S9 . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: Kcc2 knockdown in SCN GABAergic and NMS neurons increased the free-running locomotion range (A) Two representative actograms of locomotors in control (n = 15) and Kcc2 knockdown (n = 7) mice injected with AAV-VGAT-Cre and Cre inducible scramble or Kcc2 shRNA in the SCN. All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The expression of KCC2 (green) was verified by KCC2 antibody in SCN slices after experiments. The AAV injection site (red) was also verified by SCN slices. (Scale bar: 100 μm). (B) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 6) mice after 2 weeks of ZT0-4 TRF entrainment. (Scale bar: 100 μm). (C) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 4) mice after 2 weeks of ZT8-12 TRF entrainment. (Scale bar: 100 μm). (D) Two representative actograms of locomotors in the control (n = 5) and Kcc2 knockdown (n = 8) in NMS-Cre mice. (E) Statistical analysis of the locomotion range of each group in (A), (B) and (C). (F) Statistics of the locomotion range in NMS-Cre mice. Values represent the average ±SD, ∗∗∗∗: p < 0.0001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figure S9 .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Knockdown, Control, Injection, shRNA, Expressing, Two Tailed Test

The IGF2-KCC2 pathway regulates the aftereffect of the ZT0-4 TRF on locomotion changes (A) Two representative actograms of control (n = 7), IGF2 inhibitor-Chromeceptin (n = 7) and IGF1R inhibitor-GSK1904529A (n = 5) treated mice that were administered with 1 week of TRF entrainment and Chromeceptin (n = 5) treated mice with cage changes. (B) Statistical analysis of locomotion range under DD in control, IGF2R inhibitor GSK1904529A, IGF2 inhibitor Chromeceptin-treated TRF-entrained mice and Chromeceptin-treated mice without TRF. (C) A mixture of AAV-VGAT-Cre and AAV with Cre inducible EGFP and IGF2 was injected into the SCN of wild-type mice. Two representative actograms of locomotors in SCN GABAergic neurons EGFP-overexpressing control (n = 4) and IGF2-overexpressing mice (n = 4). All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The AAV injection site (green) was also verified by SCN slices. (Scale bar: 100 μm). (D) Statistics of the locomotion range for EGFP- and IGF2- overexpressing mice. (E) The Kcc2 mRNA expression in rat SCN 2.2 cells administered with PBS, a low concentration of IGF2 (IGF2-L, 5 ng/mL), a moderate concentration of IGF2 (IGF2-M, 50 ng/mL) and a high concentration of IGF2 (IGF2-H, 500 ng/mL). (F) The working model of the effect of ZT0-4 TRF on SCN. ZT0-4 TRF affects the SCN plasticity by regulating Igf2 signaling and thereby ion transport Kcc2 , and finally influence the circadian output such as the neuron Ca 2+ rhythm, sleep-wake cycle and locomotion range. Values represent the average ±SD， ∗: p < 0.05, ∗∗∗: p < 0.001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also <xref ref-type=

Figure S10 . " width="100%" height="100%">

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet: The IGF2-KCC2 pathway regulates the aftereffect of the ZT0-4 TRF on locomotion changes (A) Two representative actograms of control (n = 7), IGF2 inhibitor-Chromeceptin (n = 7) and IGF1R inhibitor-GSK1904529A (n = 5) treated mice that were administered with 1 week of TRF entrainment and Chromeceptin (n = 5) treated mice with cage changes. (B) Statistical analysis of locomotion range under DD in control, IGF2R inhibitor GSK1904529A, IGF2 inhibitor Chromeceptin-treated TRF-entrained mice and Chromeceptin-treated mice without TRF. (C) A mixture of AAV-VGAT-Cre and AAV with Cre inducible EGFP and IGF2 was injected into the SCN of wild-type mice. Two representative actograms of locomotors in SCN GABAergic neurons EGFP-overexpressing control (n = 4) and IGF2-overexpressing mice (n = 4). All mice were entrained under LD for 2 weeks and then released to DD for 2 weeks. The AAV injection site (green) was also verified by SCN slices. (Scale bar: 100 μm). (D) Statistics of the locomotion range for EGFP- and IGF2- overexpressing mice. (E) The Kcc2 mRNA expression in rat SCN 2.2 cells administered with PBS, a low concentration of IGF2 (IGF2-L, 5 ng/mL), a moderate concentration of IGF2 (IGF2-M, 50 ng/mL) and a high concentration of IGF2 (IGF2-H, 500 ng/mL). (F) The working model of the effect of ZT0-4 TRF on SCN. ZT0-4 TRF affects the SCN plasticity by regulating Igf2 signaling and thereby ion transport Kcc2 , and finally influence the circadian output such as the neuron Ca 2+ rhythm, sleep-wake cycle and locomotion range. Values represent the average ±SD， ∗: p < 0.05, ∗∗∗: p < 0.001, ns: not significant. All p values are from two-tailed Student’s t -tests. See also Figure S10 .

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Control, Injection, Expressing, Concentration Assay, Two Tailed Test

Journal: iScience

Article Title: Time-restricted feeding entrains long-term behavioral changes through the IGF2-KCC2 pathway

doi: 10.1016/j.isci.2022.104267

Figure Lengend Snippet:

Article Snippet: Kcc2 shRNA sequence: GCCATTTCCATGAGTGCAATC , BrainVTA , N/A.

Techniques: Virus, Recombinant, shRNA, Sequencing, Software

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: APP‐KCC2 interaction is enhanced by gamma frequency light flicker to stabilize KCC2 on the plasma membrane. (a) Representative immunoblots of surface KCC2 and GABA A R α1 levels in 6‐month‐old WT or APP/PS1 mice under 7 days of 1 h/day 40 Hz light flicker or not ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (b) Quantification of surface‐KCC2 levels. (c) Quantification of surface‐GABA A R α1 levels. (d) Representative Western blots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cerebral cortex of 6‐month‐old WT or APP/PS1 mice with or without 40 Hz light flicker ( n = 3 mice per group). Data are presented as mean ± SEM. # p < 0.05 vs. indicated group, ## p < 0.01 vs. indicated group, by unpaired t ‐test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Immunohistochemistry with anti‐APP (red) and KCC2 (green) in cerebral cortex of 6‐month‐old WT or APP/PS1 under 7 days of 1 h/day 40 Hz light flicker or not. Scale bar, 50 μm. (h) Pearson's correlation coefficient analysis of APP and KCC2, and quantification of KCC2 levels in different groups ( n = 18 slices from 7 to 9 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, **p < 0.01 vs. WT group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (i) Representative immunoblots of surface KCC2, GABA A R α1, and APP levels in siNC, siKCC2, and siAPP treatment group. (j) Quantification of surface‐KCC2, surface‐GABA A R α1, surface‐APP levels ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, **p < 0.01 vs. control group; #p < 0.05 vs. indicated group, ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Clinical Proteomics, Membrane, Western Blot, Immunoprecipitation, Immunohistochemistry, Control

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Gamma frequency light flicker suppresses KCC2 internalization and subsequent degradation via regulating both tyrosine phosphorylation and ubiquitination, leading to an increase in surface‐KCC2 levels. (a) Cortex extracted from 6‐month‐old WT and APP/PS1 littermates treated with 7 days of 1 h/day dark or 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐ubiquitin antibody. (b) Quantification of the ubiquitinated KCC2 (Ub‐KCC2) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. WT group, #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Cortex isolated from 6‐month‐old WT and APP/PS1 littermates with or without 7 days of 1 h/day 40 Hz light flicker immunoprecipitated with an anti‐KCC2 antibody (IP: KCC2) and probed with anti‐phospho‐Tyrosine antibody. (d) Quantification of phosphorylated KCC2 on tyrosine (p‐KCC2 (Tyr)) for each group ( n = 3 mice per group). Data are presented as mean ± SEM. #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Representative immunoblots of KCC2 incubated with MG132 at different concentrations. (f) Representative immunoblots of membrane proteins from 6‐month‐old WT or APP/PS1 mice treated with or without 7 days of 1 h/day 40 Hz light flicker and MG132. (g) Relative immunoreactivity of surface‐KCC2 normalized to Na/K‐ATPase ( n = 3). Data are presented as mean ± SEM. *p < 0.05 vs. control group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Phospho-proteomics, Ubiquitin Proteomics, Immunoprecipitation, Isolation, Western Blot, Incubation, Membrane, Control

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Activated PKC by gamma frequency light flicker phosphorylates APP and KCC2 to maintain membrane levels of both, which contributes to the upregulation of surface‐GABA A R α1. (a) Representative immunoblots showing levels of p‐PKC in cortex of 6‐month‐old APP/PS1 mice after 7 days of 1 h/day dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker. Immunoprecipitates were analyzed to detect the serine phosphorylation levels of APP and KCC2 with anti‐KCC2, anti‐APP, and anti‐phosphoserine antibodies. (b) Quantification of phosphorylated KCC2 and APP normalized to total KCC2 and APP ( n = 4 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; #p < 0.05 vs. indicated group; by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (c) Soluble and insoluble Aβ 1‐40 and Aβ 1‐42 levels in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker were performed by ELISA (8 mice/group). Data are presented as mean ± SEM. **p < 0.01 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (d) Representative immunoblots showing co‐immunoprecipitation with both KCC2 and APP antibodies in cortex of APP/PS1 mice exposed to dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker ( n = 6 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (e) Relative immunoreactivity of APP normalized to KCC2 (IP: KCC2). (f) Relative immunoreactivity of KCC2 normalized to APP (IP: APP). (g) Representative immunoblots of membrane proteins from 6‐month‐old APP/PS1 mice exposed to 7 days of dark, 40 Hz flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker (3 mice per group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; ##p < 0.01 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (h) Immunohistochemistry with anti‐APP (red) and anti‐KCC2 (green) in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 5 mice/group). Scale bar, 50 μm. (i) Gates P2 (green gate) and P3 (orange gate) for surface APP and GABA A R α1 were determined, respectively, in the unstained group, and the number of APP + cells (gate P2) was allowed to count 10,000 statistically in each experimental group, and the percentage number of GABA A R α1 + cells and mean fluorescence intensity (MFI) levels of surface GABA A R α1 in the gate P2 (APP + cells) were analyzed on a CytoFLEX flow cytometer, using CytExpert software ( n = 5 mice/group). Data are presented as mean ± SEM. *p < 0.05 vs. APP/PS1 group; **p < 0.01 vs. APP/PS1 group; #p < 0.05 vs. indicated group, by two‐way ANOVA with Tukey's post hoc multiple comparisons test. (j) Immunohistochemistry with anti‐Aβ (green) and anti‐EEA1 (red) antibodies in cortex of 6‐month‐old APP/PS1 treated with dark, 40 Hz light flicker, RO 31‐8220 (6 mg/kg/d, s.c), RO 31‐8220 (6 mg/kg/d, s.c) with 40 Hz flicker for 7 days ( n = 6 to 7 mice per group), scale bar, 50 μm. DAPI labeling was used for cell nuclei

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Membrane, Western Blot, Phospho-proteomics, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Immunohistochemistry, Fluorescence, Flow Cytometry, Software, Labeling

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: Model shows the potential mechanism by which 40 Hz light flicker reduces Aβ levels. Phosphorylation of APP induced by PKC activation under the treatment of 40 Hz light flicker led to maintained plasma membrane levels of full‐length APP as well as decreased trafficking to endosomes, which ultimately inhibited BACE1 cleavage pathway. Moreover, on the basis of PKC‐induced serine phosphorylation of KCC2, the tyrosine phosphorylation and degradation of KCC2 were further limited by a direct interaction with full‐length APP anchored within the plasma membrane, which contributed to the upregulation of surface GABA A receptor α1 levels. In addition, the increase of ATP caused by 40 Hz light flicker promoted PLC/DAG signaling cascade, which is likely to be involved in the activation of PKC

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Phospho-proteomics, Activation Assay, Clinical Proteomics, Membrane

Journal: Aging Cell

Article Title: Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model

doi: 10.1111/acel.13573

Figure Lengend Snippet: List of reagent or resource used in this study

Article Snippet: KCC2 siRNA , Santa Cruz Biotechnology , Cat# sc‐42607.

Techniques: Ubiquitin Proteomics, Plasmid Preparation, ATP Assay, Enzyme-linked Immunosorbent Assay, Clinical Proteomics, Membrane, Isolation, Cell Fractionation

( a ) In KCC2 over-expression experiments, transfection was performed at DIV0 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 6–7. ( b ) In chronic Bumetanide experiments, the drug was applied at DIV0 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 6–7. ( c ) In KCC2 shRNA experiments, transfection was performed at DIV5 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV12–13. ( d ) In chronic DIOA experiments, the drug was applied at DIV5 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 12–13. ( e ) In late transfection of KCC2 shRNA experiments, trasfection was performed at DIV12–13 whereas the recordings of IPSCs and immunocytochemistry (IC) were performed at DIV14.

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) In KCC2 over-expression experiments, transfection was performed at DIV0 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 6–7. ( b ) In chronic Bumetanide experiments, the drug was applied at DIV0 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 6–7. ( c ) In KCC2 shRNA experiments, transfection was performed at DIV5 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV12–13. ( d ) In chronic DIOA experiments, the drug was applied at DIV5 whereas the recordings of IPSCs, E Cl measurements and immunocytochemistry (IC) were performed at DIV 12–13. ( e ) In late transfection of KCC2 shRNA experiments, trasfection was performed at DIV12–13 whereas the recordings of IPSCs and immunocytochemistry (IC) were performed at DIV14.

Article Snippet: Control (pRNAT-U6.3-cGFP) and KCC2 RNA interference (KCC2 shRNA) vectors were transfected into neurons at 5 days in vitro (DIV5) or DIV12 using Effectene reagent according to the manufacturer's recommendations (Qiagen, Valencia, CA, USA).

Techniques: Over Expression, Transfection, Immunocytochemistry, shRNA

( a ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in control neurons. ( b ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in KCC2 over-expressing neurons. ( c ) Bar plot showing the mean E Cl in immature neurons (control, grey bar n =6; KCC2 over, black bar n =7; ** P <0.01; unpaired t -test). ( d ) Somatic KCC2 immunostaining in control and KCC2 over-expressing neuron. (Scale bar: 5 μm). ( e ) Quantification of KCC2 immunofluorescence signals in control and KCC2 transfected neurons (control, grey bar n =16; KCC2 over, black bar n =20; *** P <0.001; unpaired t -test). ( f ) Representative sIPSCs from control and KCC2 transfected neurons. ( g ) Summary of sIPSC decay kinetics in control (grey bar n =44) and KCC2 transfected neurons (black bar n =37; ** P <0.01; unpaired t -test). ( h ) Summary of sIPSC frequency in control (grey bar n =41) and KCC2 transfected neurons (black bar n =40; P >0.05; unpaired t -test). ( i ) Immunostaining of VGAT clusters (green fluorescence) in control (left panel) and KCC2 over-expressing neurons (right panel). ( j ) Summary of VGAT cluster density quantification in control (grey bar n =19) and KCC2 transfected neurons (black bar n =24; P >0.05; unpaired t -test). ( k ) Summary of tonic current amplitude in control (grey bar n =43) and KCC2 neurons (black bar n =28; * P <0.05; unpaired t -test). ( l ) Somatic immunostaining of immunofluorescence signals for α3 and α1 subunits in control and KCC2 over-expressed neurons at DIV7, scale bar 10 μm. ( m ) Quantification of immunofluorescence signals for α3 and α1 subunits at DIV7 (α3 control, grey bar n =69; KCC2 over, black bar n =75; ** P <0.01; unpaired t -test; α1 control grey bar n =104; KCC2 over black bar n =121; *** P <0.001; unpaired t -test). ( n ) Somatic immunostaining of immunofluorescence signals for δ subunit in control and KCC2 over-expressing neurons at DIV7. ( o ) Quantification of immunofluorescence signals for δ subunit (control, grey bar n =17; KCC2 over, black bar n =42; * P <0.05; unpaired t -test). Scale bar: 23 μm. Data is presented as mean±s.e.m.

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in control neurons. ( b ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in KCC2 over-expressing neurons. ( c ) Bar plot showing the mean E Cl in immature neurons (control, grey bar n =6; KCC2 over, black bar n =7; ** P <0.01; unpaired t -test). ( d ) Somatic KCC2 immunostaining in control and KCC2 over-expressing neuron. (Scale bar: 5 μm). ( e ) Quantification of KCC2 immunofluorescence signals in control and KCC2 transfected neurons (control, grey bar n =16; KCC2 over, black bar n =20; *** P <0.001; unpaired t -test). ( f ) Representative sIPSCs from control and KCC2 transfected neurons. ( g ) Summary of sIPSC decay kinetics in control (grey bar n =44) and KCC2 transfected neurons (black bar n =37; ** P <0.01; unpaired t -test). ( h ) Summary of sIPSC frequency in control (grey bar n =41) and KCC2 transfected neurons (black bar n =40; P >0.05; unpaired t -test). ( i ) Immunostaining of VGAT clusters (green fluorescence) in control (left panel) and KCC2 over-expressing neurons (right panel). ( j ) Summary of VGAT cluster density quantification in control (grey bar n =19) and KCC2 transfected neurons (black bar n =24; P >0.05; unpaired t -test). ( k ) Summary of tonic current amplitude in control (grey bar n =43) and KCC2 neurons (black bar n =28; * P <0.05; unpaired t -test). ( l ) Somatic immunostaining of immunofluorescence signals for α3 and α1 subunits in control and KCC2 over-expressed neurons at DIV7, scale bar 10 μm. ( m ) Quantification of immunofluorescence signals for α3 and α1 subunits at DIV7 (α3 control, grey bar n =69; KCC2 over, black bar n =75; ** P <0.01; unpaired t -test; α1 control grey bar n =104; KCC2 over black bar n =121; *** P <0.001; unpaired t -test). ( n ) Somatic immunostaining of immunofluorescence signals for δ subunit in control and KCC2 over-expressing neurons at DIV7. ( o ) Quantification of immunofluorescence signals for δ subunit (control, grey bar n =17; KCC2 over, black bar n =42; * P <0.05; unpaired t -test). Scale bar: 23 μm. Data is presented as mean±s.e.m.

Techniques: Expressing, Immunostaining, Immunofluorescence, Transfection, Fluorescence

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in control neurons. ( b ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in KCC2 shRNA transfected neurons. ( c ) Summary of E Cl at DIV12 in control (grey bar n =15) and KCC2 shRNA transfected neurons (white bar n =11; *** P <0.001; unpaired t -test). ( d ) Somatic KCC2 immunostaining in control and KCC2 shRNA neurons at DIV12 (Scale bar: 5 μm). ( e ) Quantification of KCC2 immunofluorescence signals in control and KCC2 shRNA neurons (at DIV7 control, grey bar n =9; KCC2 shRNA, white bar n =9; P >0.05 unpaired t -test; at DIV12 control, grey bar n =12; KCC2 shRNA, white bar n =12; *** P <0.001; ** P <0.01; unpaired t -test). ( f ) Representative sIPSCs from control and KCC2 shRNA transfected neurons. ( g ) Summary of sIPSC decay kinetics in control (grey bar DIV7 n =11; DIV8 n =20; DIV9 n =10; DIV10–13 n =22) and KCC2 shRNA transfected neurons (white bar DIV7 n =9; DIV8 n =7; DIV9 n =9; DIV10–13 n =19; * P <0.05;** P <0.01; unpaired t -test). ( h ) Summary of sIPSC frequency in control (grey bar DIV7 n =12; DIV8 n =21; DIV9 n =11; DIV10–13 n =23) and KCC2 shRNA transfected neurons (white bar DIV7 n =7; DIV8 n =8; DIV9 n =10; DIV10–13 n =19; P >0.05; unpaired t -test). ( i ) Summary of tonic current amplitude in control (grey bar DIV7–8 n =17; DIV9 n =9; DIV10–13 n =13) and KCC2 shRNA neurons (white bar DIV7–8 n =27; DIV9 n =9; DIV10–13 n =25; ** P <0.01; unpaired t -test). ( j ) Somatic immunostaining of immunofluorescence signals for α3 and α1 subunits in control and KCC2 shRNA transfected neurons at DIV12. ( k ) Quantification of immunofluorescence signals for α3 and α1 subunits (α3 control, grey bar n =9; KCC2 shRNA, white bar n =14; * P <0.5; unpaired t -test; α1 control, grey bar n =15; KCC2 shRNA, white bar n =21; *** P <0.001; unpaired t -test). ( l ) Somatic immunostaining of immunofluorescence signals for δ subunit in control and KCC2 shRNA transfected neurons. ( m ) Quantification of immunofluorescence signals for δ subunit in control (grey bar n =20) and KCC2 shRNA expressing neurons (white bar n =18; ** P <0.01; unpaired t -test) at DIV12. Scale bar: 23 μm. Data is presented as mean±s.e.m.

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence, Expressing

( a ) Summary of the average percent increase in the sIPSC decay kinetics in KCC2 and KCC2 shRNA transfected neurons by application of Zolpidem (at DIV6–7 control n =6; KCC2 over n =9 * P <0.05; ANOVA; at DIV12–13 control n =9; KCC2 shRNA n =10; ** P <0.01; ANOVA). ( b ) Representative whole-cell responses in KCC2 and KCC2 shRNA transfected neurons to applications of THIP (30 μM) and GABA (1 mM). ( c ) Summary of the average current density I THIP / I GABA in KCC2 transfected neurons (control, grey bar n =22; KCC2 over, black bar n =22; *** P <0.001 ANOVA). ( d ) Summary of the average current density I THIP / I GABA in KCC2 shRNA transfected neurons (control, grey bar n =12; KCC2 shRNA, white bar n =12; *** P <0.001 ANOVA). Data is presented as mean±s.e.m.

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Summary of the average percent increase in the sIPSC decay kinetics in KCC2 and KCC2 shRNA transfected neurons by application of Zolpidem (at DIV6–7 control n =6; KCC2 over n =9 * P <0.05; ANOVA; at DIV12–13 control n =9; KCC2 shRNA n =10; ** P <0.01; ANOVA). ( b ) Representative whole-cell responses in KCC2 and KCC2 shRNA transfected neurons to applications of THIP (30 μM) and GABA (1 mM). ( c ) Summary of the average current density I THIP / I GABA in KCC2 transfected neurons (control, grey bar n =22; KCC2 over, black bar n =22; *** P <0.001 ANOVA). ( d ) Summary of the average current density I THIP / I GABA in KCC2 shRNA transfected neurons (control, grey bar n =12; KCC2 shRNA, white bar n =12; *** P <0.001 ANOVA). Data is presented as mean±s.e.m.

Techniques: shRNA, Transfection

( a ) Representative sIPSCs traces from control and KCC2 over-expressing neurons chronically treated with PTX at DIV7. ( b ) Representative sIPSCs traces from control and KCC2 shRNA transfected neurons chronically treated with PTX at DIV14. ( c ) Summary of sIPSC decay kinetics in KCC2 and KCC2 shRNA transfected neurons chronically treated with 100 μM PTX (at DIV6–7 control n =44; PTX control n =9; PTX KCC2 over n =17; ** P <0.01; at DIV12–13 control n =22; PTX control n =7; PTX KCC2 shRNA n =12; * P <0.05; unpaired t -test). Data is presented as mean±s.e.m.

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Representative sIPSCs traces from control and KCC2 over-expressing neurons chronically treated with PTX at DIV7. ( b ) Representative sIPSCs traces from control and KCC2 shRNA transfected neurons chronically treated with PTX at DIV14. ( c ) Summary of sIPSC decay kinetics in KCC2 and KCC2 shRNA transfected neurons chronically treated with 100 μM PTX (at DIV6–7 control n =44; PTX control n =9; PTX KCC2 over n =17; ** P <0.01; at DIV12–13 control n =22; PTX control n =7; PTX KCC2 shRNA n =12; * P <0.05; unpaired t -test). Data is presented as mean±s.e.m.

Techniques: Expressing, shRNA, Transfection

( a ) Representative sIPSCs traces in control and KCC2 shRNA transfected neurons at DIV14. ( b ) Summary of sIPSC decay kinetics in control and KCC2 shRNA transfected neurons (control, grey bar n =18; KCC2 shRNA, white bar n =25; ** P <0.01; unpaired t -test). ( c ) Summary of tonic currents in control and KCC2 shRNA transfected neurons (control, grey bar n =10; KCC2 shRNA, white bar n =24; ** P <0.01; unpaired t -test). ( d ) Representative somatic immunostaining of α3, α1 and δ subunits in control and KCC2 shRNA transfected neurons. ( e ) Quantification of immunofluorescence signals for α3 and α1 subunits (α3 control, grey bar n =16; KCC2 shRNA, white bar n =23; *** P <0.001; unpaired t -test; α1 control, grey bar n =16; KCC2 shRNA, white bar n =12; * P <0.05; unpaired t -test). ( f ) Quantification of immunofluorescence signals for δ subunit (control, grey bar n =34; KCC2 shRNA, white bar n =16; *** P <0.001; unpaired t -test). Scale bar: 23 μm. Data is presented as mean±s.e.m.

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Representative sIPSCs traces in control and KCC2 shRNA transfected neurons at DIV14. ( b ) Summary of sIPSC decay kinetics in control and KCC2 shRNA transfected neurons (control, grey bar n =18; KCC2 shRNA, white bar n =25; ** P <0.01; unpaired t -test). ( c ) Summary of tonic currents in control and KCC2 shRNA transfected neurons (control, grey bar n =10; KCC2 shRNA, white bar n =24; ** P <0.01; unpaired t -test). ( d ) Representative somatic immunostaining of α3, α1 and δ subunits in control and KCC2 shRNA transfected neurons. ( e ) Quantification of immunofluorescence signals for α3 and α1 subunits (α3 control, grey bar n =16; KCC2 shRNA, white bar n =23; *** P <0.001; unpaired t -test; α1 control, grey bar n =16; KCC2 shRNA, white bar n =12; * P <0.05; unpaired t -test). ( f ) Quantification of immunofluorescence signals for δ subunit (control, grey bar n =34; KCC2 shRNA, white bar n =16; *** P <0.001; unpaired t -test). Scale bar: 23 μm. Data is presented as mean±s.e.m.

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Article Snippet: Two complementary annealed oligonucleotides (Top oligo 5′-GGATCCCGTAAGTGGTACAGAAACGTGGTTTGATATCCGACCACGTTTCTGTACCACTTATTTTTTCCAAA-3′; Bottom oligo 5′-AAGCTTTTGGAAAAAATAAGTGGTACAGAAACGTGGTCGGATATCAAACCACGTTTCTGTACCACTTACGG-3′) targeting a 21-nucleotide stretch in KCC2 were inserted between the BamHI and HindIII sites of the pRNAT-U6.3-cGFP vector (GenScript) to generate the KCC2 shRNA construct.

Techniques: Over Expression, Transfection, Immunocytochemistry, shRNA

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: Expressing, Immunostaining, Immunofluorescence, Transfection, Fluorescence

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in control neurons. ( b ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in KCC2 shRNA transfected neurons. ( c ) Summary of E Cl at DIV12 in control (grey bar n =15) and KCC2 shRNA transfected neurons (white bar n =11; *** P <0.001; unpaired t -test). ( d ) Somatic KCC2 immunostaining in control and KCC2 shRNA neurons at DIV12 (Scale bar: 5 μm). ( e ) Quantification of KCC2 immunofluorescence signals in control and KCC2 shRNA neurons (at DIV7 control, grey bar n =9; KCC2 shRNA, white bar n =9; P >0.05 unpaired t -test; at DIV12 control, grey bar n =12; KCC2 shRNA, white bar n =12; *** P <0.001; ** P <0.01; unpaired t -test). ( f ) Representative sIPSCs from control and KCC2 shRNA transfected neurons. ( g ) Summary of sIPSC decay kinetics in control (grey bar DIV7 n =11; DIV8 n =20; DIV9 n =10; DIV10–13 n =22) and KCC2 shRNA transfected neurons (white bar DIV7 n =9; DIV8 n =7; DIV9 n =9; DIV10–13 n =19; * P <0.05;** P <0.01; unpaired t -test). ( h ) Summary of sIPSC frequency in control (grey bar DIV7 n =12; DIV8 n =21; DIV9 n =11; DIV10–13 n =23) and KCC2 shRNA transfected neurons (white bar DIV7 n =7; DIV8 n =8; DIV9 n =10; DIV10–13 n =19; P >0.05; unpaired t -test). ( i ) Summary of tonic current amplitude in control (grey bar DIV7–8 n =17; DIV9 n =9; DIV10–13 n =13) and KCC2 shRNA neurons (white bar DIV7–8 n =27; DIV9 n =9; DIV10–13 n =25; ** P <0.01; unpaired t -test). ( j ) Somatic immunostaining of immunofluorescence signals for α3 and α1 subunits in control and KCC2 shRNA transfected neurons at DIV12. ( k ) Quantification of immunofluorescence signals for α3 and α1 subunits (α3 control, grey bar n =9; KCC2 shRNA, white bar n =14; * P <0.5; unpaired t -test; α1 control, grey bar n =15; KCC2 shRNA, white bar n =21; *** P <0.001; unpaired t -test). ( l ) Somatic immunostaining of immunofluorescence signals for δ subunit in control and KCC2 shRNA transfected neurons. ( m ) Quantification of immunofluorescence signals for δ subunit in control (grey bar n =20) and KCC2 shRNA expressing neurons (white bar n =18; ** P <0.01; unpaired t -test) at DIV12. Scale bar: 23 μm. Data is presented as mean±s.e.m.

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence, Expressing

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: shRNA, Transfection

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: Expressing, shRNA, Transfection

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Article Snippet: Chronic treatments with PTX (100 μM, Sigma, Italy) and R-(+)-[(dihydroindenyl)oxy] (DIOA) (10 μM, Sigma, Italy) were started at DIV5 in control and in KCC2 shRNA transfected neurons.

Techniques: Over Expression, Transfection, Immunocytochemistry, shRNA

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: Expressing, Immunostaining, Immunofluorescence, Transfection, Fluorescence

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Figure Lengend Snippet: ( a ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in control neurons. ( b ) Example of I – V relations of isoguvacine (10 μM) evoked GABA A currents at increasing holding potentials in KCC2 shRNA transfected neurons. ( c ) Summary of E Cl at DIV12 in control (grey bar n =15) and KCC2 shRNA transfected neurons (white bar n =11; *** P <0.001; unpaired t -test). ( d ) Somatic KCC2 immunostaining in control and KCC2 shRNA neurons at DIV12 (Scale bar: 5 μm). ( e ) Quantification of KCC2 immunofluorescence signals in control and KCC2 shRNA neurons (at DIV7 control, grey bar n =9; KCC2 shRNA, white bar n =9; P >0.05 unpaired t -test; at DIV12 control, grey bar n =12; KCC2 shRNA, white bar n =12; *** P <0.001; ** P <0.01; unpaired t -test). ( f ) Representative sIPSCs from control and KCC2 shRNA transfected neurons. ( g ) Summary of sIPSC decay kinetics in control (grey bar DIV7 n =11; DIV8 n =20; DIV9 n =10; DIV10–13 n =22) and KCC2 shRNA transfected neurons (white bar DIV7 n =9; DIV8 n =7; DIV9 n =9; DIV10–13 n =19; * P <0.05;** P <0.01; unpaired t -test). ( h ) Summary of sIPSC frequency in control (grey bar DIV7 n =12; DIV8 n =21; DIV9 n =11; DIV10–13 n =23) and KCC2 shRNA transfected neurons (white bar DIV7 n =7; DIV8 n =8; DIV9 n =10; DIV10–13 n =19; P >0.05; unpaired t -test). ( i ) Summary of tonic current amplitude in control (grey bar DIV7–8 n =17; DIV9 n =9; DIV10–13 n =13) and KCC2 shRNA neurons (white bar DIV7–8 n =27; DIV9 n =9; DIV10–13 n =25; ** P <0.01; unpaired t -test). ( j ) Somatic immunostaining of immunofluorescence signals for α3 and α1 subunits in control and KCC2 shRNA transfected neurons at DIV12. ( k ) Quantification of immunofluorescence signals for α3 and α1 subunits (α3 control, grey bar n =9; KCC2 shRNA, white bar n =14; * P <0.5; unpaired t -test; α1 control, grey bar n =15; KCC2 shRNA, white bar n =21; *** P <0.001; unpaired t -test). ( l ) Somatic immunostaining of immunofluorescence signals for δ subunit in control and KCC2 shRNA transfected neurons. ( m ) Quantification of immunofluorescence signals for δ subunit in control (grey bar n =20) and KCC2 shRNA expressing neurons (white bar n =18; ** P <0.01; unpaired t -test) at DIV12. Scale bar: 23 μm. Data is presented as mean±s.e.m.

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence, Expressing

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: shRNA, Transfection

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: Expressing, shRNA, Transfection

Journal: Nature Communications

Article Title: Intracellular chloride concentration influences the GABA A receptor subunit composition

doi: 10.1038/ncomms1744

Techniques: shRNA, Transfection, Immunostaining, Immunofluorescence

Review

Structured Review

Images

1) Product Images from "Gamma frequency light flicker regulates amyloid precursor protein trafficking for reducing β‐amyloid load in Alzheimer's disease model"

Similar Products

Image Search Results