sphk1 activity assay  (Echelon Biosciences)

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Staining, Concentration Assay

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: SPHK1-mediated elevation of S1P contributes directly to hypoxia-induced sickling in cultured human sickle erythrocytes independent of S1P receptor activation. ( A – C ) Pretreatment of cultured primary erythrocytes isolated from patients with SCD with PF-543 inhibited hypoxia-mediated induction of ( A ) SPHK1 activity, ( B ) S1P production, and ( C ) sickling in a dosage-dependent manner. ( D ) Changes in the percentage of sickled cells in erythrocytes isolated from patients with SCD, following exposure to different hypoxic conditions in the absence or presence of PF-543 treatment. ( E ) S1P contributes to sickling independent of S1P receptor activation. S1P receptor antagonists (VPC, S1P 1 and S1P 3 receptor antagonist; JTE, S1P 2 receptor antagonist) did not reduce hypoxia-induced sickling. ( F ) Exogenous S1P (100 to 500 nM) did not enhance hypoxia-induced sickling in cultured human sickle erythrocytes under different hypoxia conditions. Data are presented as the mean ± SEM. * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Cell Culture, Activation Assay, Isolation, Activity Assay

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Erythrocyte SPHK1 activity and S1P levels in both erythrocytes and plasma are elevated in individuals with SCD. ( A and B ) Average S1P levels in ( A ) erythrocytes and ( B ) plasma from healthy volunteers (control, n = 14) and patients with SCD ( n = 30). ( C ) Erythrocyte SPHK1 activity for healthy volunteers (control, n = 14) and patients with SCD ( n = 30). Data are presented as the mean ± SEM. * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Activity Assay

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: PF-543, a potent, specific SPHK1 inhibitor, reduces sickling, hemolysis, and inflammation in SCD Tg mice by reducing erythrocyte SPHK1 activity and S1P levels. ( A – C ) PF-543 treatment significantly reduced ( A ) erythrocyte SPHK1 activity, ( B ) erythrocyte levels, and ( C ) plasma levels of S1P in SCD Tg mice. ( D ) Representative blood smears of SCD Tg mice, as a function PF-543 treatment (original magnification, ×100). ( E ) Percentages of sickle cells and reticulocytes were significantly reduced by PF-543 treatment in SCD Tg mice. ( F – I ) Effects of PF-543 treatment on ( F ) plasma Hb, ( G ) plasma haptoglobin, ( H ) plasma total bilirubin, and ( I ) circulating cytokines in SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–11). * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Mouse Assay, Activity Assay

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced erythrocyte SPHK1 protein levels and erythrocyte and plasma S1P levels. ( A ) HPLC and electrophoresis analysis of HbS and mouse normal Hb (HbA) in BMT SCD chimeras to assess the percentage of chimerism. Representative electrophoresis analysis and the average of percentage of chimerism with HbS in SCD chimeras were shown as insets. Data shown represent the mean ± SEM ( n = 6–9). ( B ) Erythrocyte SPHK1 levels, ( C ) activity, ( D ) plasma S1P levels, and ( E ) erythrocyte S1P levels were significantly reduced in the SCD chimeras with specific SPHK1 knockdown compared with those in mice with BMCs infected with a scrambled shRNA. * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: High Performance Liquid Chromatography, Electrophoresis, Activity Assay, Mouse Assay, Infection, shRNA

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced sickling, hemolysis, inflammation, and prolonged life span of erythrocytes. ( A ) Blood smears of SCD chimeras with or without SPHK1 knockdown (original magnification, ×100). ( B ) Percentages of sickle cells and reticulocytes were significantly reduced in the SCD chimeras with HSC-specific SPHK1 knockdown. ( C – E ) SPHK1 knockdown in HSCs ( C ) decreased plasma Hb levels, ( D ) prolonged life span of erythrocytes, and ( E ) reduced circulating cytokines in SCD chimeras. Values shown represent the mean ± SEM ( n = 6–11). * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques:

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras increased survival rates and reduced pulmonary congestion and inflammation under hypoxic conditions. ( A ) Knockdown of SPHK1 in HSCs prolonged survival rates of BMT SCD chimeras under hypoxic conditions with 8% O 2 concentration. ( B and C ) Knockdown of SPHK1 in HSCs in SCD chimeras ( B ) reduced hypoxia-induced pulmonary congestion and ( C ) decreased elevation of multiple cytokines in the lung tissue. Values shown represent the mean ± SEM ( n = 6–9). * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Concentration Assay

Journal: The Journal of Clinical Investigation

Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

doi: 10.1172/JCI74604

Figure Lengend Snippet: Metabolomic screening reveals that blood S1P levels and erythrocyte SPHK1 activity are elevated in SCD Tg mice. ( A ) Z-score quantification of lipids detected in the blood of both WT and SCD Tg mice. Among all lipids detected, S1P was one of the most substantially elevated in the blood of SCD Tg mice compared with that in WT mice ( n = 6). ( B and C ) LC/MS POS platform measurement indicates that S1P levels in the ( B ) erythrocytes and ( C ) plasma of SCD mice were significantly elevated compared with those in WT mice ( n = 6–8). ( D ) Total erythrocyte SPHK1 activity was significantly elevated in SCD Tg mice compared with that in WT mice ( n = 8). ( E ) SPHK1 activities in purified reticulocytes and mature erythrocytes of SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–8). * P

Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

Techniques: Activity Assay, Mouse Assay, Liquid Chromatography with Mass Spectroscopy, Purification

Journal: International Journal of Molecular Sciences

Article Title: Development of 1,2,3-Triazole-Based Sphingosine Kinase Inhibitors and Their Evaluation as Antiproliferative Agents

doi: 10.3390/ijms18112332

Figure Lengend Snippet: Effect of the tested compounds on the adenosine triphosphate (ATP) levels in the presence of SphK1 and SphK2. ( A , B ): ATP concentrations (µM) were measured by the Sphingosine Kinase Activity Assay (Echelon Biosciences) in the presence of SphK1 ( A ) and SphK2 ( B ), and tested with PF-543, 5h , and 8f . All the compounds were evaluated at the concentrations of 10 µM. For further details, see the Materials and Methods section. Data represent the mean (±SD) of two experiments performed in triplicate. Bars show SDs. ( C , D ): Percent of enzyme inhibition by PF-543, 5h , and 8f on SphK1 ( C ) and by 5h on SphK2 ( D ), respectively, as measured by the Sphingosine Kinase Activity Assay ( Echelon Biosciences ).

Article Snippet: Sphingosine Kinase Activity Assay The capability of the tested compounds to inhibit SphK1 and SphK2 enzyme activity was measured by using the Sphingosine Kinase Activity Assay (K-3500, Echelon Biosciences, Salt Lake City, UT, USA).

Techniques: Kinase Assay, Enzyme Inhibition Assay

Journal: British Journal of Cancer

Article Title: Binding of eEF1A2 to the RNA-dependent protein kinase PKR modulates its activity and promotes tumour cell survival

doi: 10.1038/s41416-018-0336-y

Figure Lengend Snippet: Proposed pro-oncogenic mechanism of eEF1A2 and its inhibition by plitidepsin. When expressed in cancer cells, eEF1A2 forms complexes with several partners that elicit the pro-oncogenic activities of the elongation factor. Binding to PRDX1 and SPHK, eEF1A2 potentiates their activity, thus reducing the oxidative stress and increasing the S1P production within the cancer cell, providing it with improved growth and survival properties. Furthermore, sequestering PKR, eEF1A2 inhibits its pro-apoptotic activity. When cancer cells are treated with plitidepsin, the interaction between eEF1A2 and PRDX1 is broken, therefore reducing the antioxidant capacity of PRDX1 and increasing oxidative stress. SPHK is not released from its complex with eEF1A2 by plitidepsin, but the activity of the lipid kinase is greatly reduced, diminishing the cellular level of S1P and unbalancing the equilibrium towards the formation of pro-apoptotic ceramides. Plitidepsin also released PKR from its complex with eEF1A2, rendering the kinase active (either directly or through the stress stimuli generated by the compound). Active PKR, on its turn, phosphorylates downstream targets as JNK or FADD with clear pro-apoptotic activity. Furthermore, although PKR also phosphorylates IKK and releases NF-κB from its inhibitor IκB, it seems that the transcription factor is unable to activate pro-survival genes but transactivates FAS, the death receptor that has been previously shown to trigger the apoptotic effect of plitidepsin. The final outcome of the inhibition of the pro-oncogenic properties of eEF1A2 by plitidepsin is the death of cancer cells

Article Snippet: SPHK Activity Assay and Sphingosine-1-phosphate (S1P) Competitive ELISA Kits were from Echelon Biosciences (Salt Lake City, UT, USA).

Techniques: Inhibition, Binding Assay, Activity Assay, Generated

Journal: Scientific Reports

Article Title: K27Q/K29Q mutations in sphingosine kinase 1 attenuate high-fat diet induced obesity and altered glucose homeostasis in mice

doi: 10.1038/s41598-020-77096-w

Figure Lengend Snippet: Generation of QSPHK1 knock-in mice. ( A ) Schematic diagram of Sphk1 K27Q K29Q (QSPHK1) targeting strategy. ( B ) Genotyping of QSPHK1 and WT mice. Genomic DNA was extracted from the tails of the mice and used as templates for PCR amplification of the region flanking the Frt site. Then PCR products were subjected to electrophoresis on a 1.5% agarose gel. Lane M: DNA marker. Lane 1 and 3: homozygous QSPHK1 and WT mice, respectively. Lane 2: heterozygous mice. ( C ) Confirmation of codon substitution of K27Q and K29Q in Sphk1 by sequencing. PCR products of exon 3 of S phk1 were amplified with primers (SPKF: 5′- AGAGCAGCAAGTGCTCTTACCT-3′ and SPKR: 5′- GTCAGCACTCACCGGTGAGTAT -3′) and then sequenced.

Article Snippet: Measurement of Sphk1 activity0.1 g tissue extracts from liver were used for Sphk1 activity assay with a commercial kit according to the manufacturer’s instructions (Sphingosine Kinase Activity Assay Kit, Echelon Biosciences Inc.).

Techniques: Knock-In, Mouse Assay, Polymerase Chain Reaction, Amplification, Electrophoresis, Agarose Gel Electrophoresis, Marker, Sequencing