|
Microsynth ag
its2 reverse primer Its2 Reverse Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/its2 reverse primer/product/Microsynth ag Average 90 stars, based on 1 article reviews
its2 reverse primer - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
its2 reverse primer ![]() Its2 Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/its2 reverse primer/product/Illumina Inc Average 90 stars, based on 1 article reviews
its2 reverse primer - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
its2 reverse primer (5'- gctgcgttcttcatcgatgc-3) ![]() Its2 Reverse Primer (5' Gctgcgttcttcatcgatgc 3), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/its2 reverse primer (5'- gctgcgttcttcatcgatgc-3)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
its2 reverse primer (5'- gctgcgttcttcatcgatgc-3) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
primers itsintfor2 and its2-reverse ![]() Primers Itsintfor2 And Its2 Reverse, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers itsintfor2 and its2-reverse/product/Illumina Inc Average 90 stars, based on 1 article reviews
primers itsintfor2 and its2-reverse - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
its2-reverse primer ![]() Its2 Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/its2-reverse primer/product/Illumina Inc Average 90 stars, based on 1 article reviews
its2-reverse primer - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
primers itsintfor2 and its2-reverse with illumina sequencing adapters ![]() Primers Itsintfor2 And Its2 Reverse With Illumina Sequencing Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers itsintfor2 and its2-reverse with illumina sequencing adapters/product/Illumina Inc Average 90 stars, based on 1 article reviews
primers itsintfor2 and its2-reverse with illumina sequencing adapters - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
reverse primer (its2 ![]() Reverse Primer (Its2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer (its2/product/Illumina Inc Average 90 stars, based on 1 article reviews
reverse primer (its2 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Millipore
forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers ![]() Forward Its1 F (Cttggtcatttagaggaagtaa) Reverse Its2 (Gctgcgttcttcatcgatgc) Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers/product/Millipore Average 90 stars, based on 1 article reviews
forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer ![]() Primer Its2 2043r (Gctgcgttcttcatcgatgc) + Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer/product/Illumina Inc Average 90 stars, based on 1 article reviews
primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
its1 forward and illumina barcoded its2 reverse primers ![]() Its1 Forward And Illumina Barcoded Its2 Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/its1 forward and illumina barcoded its2 reverse primers/product/Illumina Inc Average 90 stars, based on 1 article reviews
its1 forward and illumina barcoded its2 reverse primers - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Journal: Global Change Biology
Article Title: Rapid Evolution in Action: Environmental Filtering Supports Coral Adaptation to a Hot, Acidic, and Deoxygenated Extreme Habitat
doi: 10.1111/gcb.70103
Figure Lengend Snippet: Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed ITS2 sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
Article Snippet: We used ITS2 forward (5’‐TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATTGCAGAACTCCGTG‐3′) and
Techniques: Transformation Assay, Sequencing, Sampling