Structured Review

Bio-Rad iscript cdna synthesis kit
Immunoblot and Q-RT-PCR analysis of LMP1 expression in SNK6 following inhibition of EBV-BART9 miRNA. ( A ) SNK6 cells were transfected with anti-EBV-BART9 miRNA or Scramble control miRNA and cell lysates prepared 96 hours post-transfection. LMP1 protein expression was analyzed in immunoblots. When compared to cells transfected with control miRNA and normalized to β-actin loading control, quantification of immunoblots showed that BART9 inhibition reduced LMP1 protein levels by ∼50%. ( B ) SNK6 cells were transfected with control or anti-EBV-BART9 miRNA and samples collected every 24 hours in a time-course experiment. Cell lysates were prepared and immunoblot analysis carried out to determine LMP1 expression. Quantification of LMP1 levels using Image J as described above showed that LMP1 protein levels are reduced only at later time-point. ( C ) SNK6 cells were transfected with either anti-EBV-BART9 or control miRNA and cells collected 96 hours post-transfection. Total RNA was extracted and <t>cDNA</t> synthesized using <t>iScript</t> cDNA synthesis kit. Using LMP1 specific primers, Q-PCR was carried out and data analyzed using the ΔΔCt method. Data shown is the average ± SD from three independent experiments. (** represents p value of
Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
Average 83 stars, based on 1 article reviews
Price from $9.99 to $1999.99
iscript cdna synthesis kit - by Bioz Stars, 2019-12
83/100 stars

Related Products / Commonly Used Together

facs aria ii

Images

1) Product Images from "Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas"

Article Title: Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas

Journal: PLoS ONE

doi: 10.1371/journal.pone.0027271

Immunoblot and Q-RT-PCR analysis of LMP1 expression in SNK6 following inhibition of EBV-BART9 miRNA. ( A ) SNK6 cells were transfected with anti-EBV-BART9 miRNA or Scramble control miRNA and cell lysates prepared 96 hours post-transfection. LMP1 protein expression was analyzed in immunoblots. When compared to cells transfected with control miRNA and normalized to β-actin loading control, quantification of immunoblots showed that BART9 inhibition reduced LMP1 protein levels by ∼50%. ( B ) SNK6 cells were transfected with control or anti-EBV-BART9 miRNA and samples collected every 24 hours in a time-course experiment. Cell lysates were prepared and immunoblot analysis carried out to determine LMP1 expression. Quantification of LMP1 levels using Image J as described above showed that LMP1 protein levels are reduced only at later time-point. ( C ) SNK6 cells were transfected with either anti-EBV-BART9 or control miRNA and cells collected 96 hours post-transfection. Total RNA was extracted and cDNA synthesized using iScript cDNA synthesis kit. Using LMP1 specific primers, Q-PCR was carried out and data analyzed using the ΔΔCt method. Data shown is the average ± SD from three independent experiments. (** represents p value of
Figure Legend Snippet: Immunoblot and Q-RT-PCR analysis of LMP1 expression in SNK6 following inhibition of EBV-BART9 miRNA. ( A ) SNK6 cells were transfected with anti-EBV-BART9 miRNA or Scramble control miRNA and cell lysates prepared 96 hours post-transfection. LMP1 protein expression was analyzed in immunoblots. When compared to cells transfected with control miRNA and normalized to β-actin loading control, quantification of immunoblots showed that BART9 inhibition reduced LMP1 protein levels by ∼50%. ( B ) SNK6 cells were transfected with control or anti-EBV-BART9 miRNA and samples collected every 24 hours in a time-course experiment. Cell lysates were prepared and immunoblot analysis carried out to determine LMP1 expression. Quantification of LMP1 levels using Image J as described above showed that LMP1 protein levels are reduced only at later time-point. ( C ) SNK6 cells were transfected with either anti-EBV-BART9 or control miRNA and cells collected 96 hours post-transfection. Total RNA was extracted and cDNA synthesized using iScript cDNA synthesis kit. Using LMP1 specific primers, Q-PCR was carried out and data analyzed using the ΔΔCt method. Data shown is the average ± SD from three independent experiments. (** represents p value of

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Inhibition, Transfection, Western Blot, Synthesized, Polymerase Chain Reaction

2) Product Images from "Effect of small interfering RNAs on matrix metalloproteinase 1 expression"

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression

Journal: Biotechnology Reports

doi: 10.1016/j.btre.2014.07.003

Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).
Figure Legend Snippet: Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

Techniques Used: Real-time Polymerase Chain Reaction, Concentration Assay, Incubation, Synthesized, Expressing, SYBR Green Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction

3) Product Images from "PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica"

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2018.02447

Transcript analysis of PGE2 receptors in THP-1 macrophages during S. Typhimurium and Y. enterocolitica infection. THP-1 macrophages (2.5 × 10 5 ) were infected for 2 h with (A) S. Typhimurium or (B) Y. enterocolitica at an MOI of 50:1. Total RNA was extracted using a PureLink RNA mini kit, and cDNA was generated using the iScript system (Bio-Rad). RT-PCR was performed using SYBR green on a CFX96 Real-Time System (Bio-Rad) targeting prostanoid receptors EP1, EP2, EP3, EP4, and GAPDH as a reference gene. Resulting data were then normalized to GAPDH mRNA levels, and uninfected samples served as a baseline for fold change determination using the ΔΔCt method. Resulting data is representative of three biological replicates and three technical replicates and represents the mean fold change ± SD. One-way ANOVA test with Tukey’s multiple testing correction was used to establish statistical significance. p -values were indicated as follows: ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001; ∗∗∗∗ p ≤ 0.0001.
Figure Legend Snippet: Transcript analysis of PGE2 receptors in THP-1 macrophages during S. Typhimurium and Y. enterocolitica infection. THP-1 macrophages (2.5 × 10 5 ) were infected for 2 h with (A) S. Typhimurium or (B) Y. enterocolitica at an MOI of 50:1. Total RNA was extracted using a PureLink RNA mini kit, and cDNA was generated using the iScript system (Bio-Rad). RT-PCR was performed using SYBR green on a CFX96 Real-Time System (Bio-Rad) targeting prostanoid receptors EP1, EP2, EP3, EP4, and GAPDH as a reference gene. Resulting data were then normalized to GAPDH mRNA levels, and uninfected samples served as a baseline for fold change determination using the ΔΔCt method. Resulting data is representative of three biological replicates and three technical replicates and represents the mean fold change ± SD. One-way ANOVA test with Tukey’s multiple testing correction was used to establish statistical significance. p -values were indicated as follows: ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001; ∗∗∗∗ p ≤ 0.0001.

Techniques Used: Infection, Generated, Reverse Transcription Polymerase Chain Reaction, SYBR Green Assay

4) Product Images from "Immunoprecipitation of Tri-methylated Capped RNA"

Article Title: Immunoprecipitation of Tri-methylated Capped RNA

Journal:

doi: 10.21769/BioProtoc.2717

RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.
Figure Legend Snippet: RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

Techniques Used: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Incubation, Flow Cytometry, Methylation, Nucleic Acid Electrophoresis

Related Articles

Amplification:

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation
Article Snippet: Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD) following manufacturer’s instructions and as described previously [ ]. cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). .. The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 (BACE1 gene ) (Hs01121195_m1) and mouse Bace1 (Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like Growth Factor 1 expression in the brain
Article Snippet: Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD). cDNA was obtained by reverse transcribing 1μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit" (BioRad, Hercules, CA).The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human Leptin ( LEP ) (Hs00174877_m1), mouse leptin ( Lep ) (Mm00434759_m1), human IGF1 ( IGF1 ) (Hs01547656_m1), and mouse IGF1 ( Igf1 ) (Mm00439560_m1). .. The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Synthesized:

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
Article Snippet: After transfection for 24 h, total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, California, USA) with the RNA quality (UV reader, 260/280 ratio > 1.7) and triplicate assessment by using microplate (BioTeck, USA). .. First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer. .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared.

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: For analysis of mRNA levels of PGE2 receptors, SOCS3, MRS1, and COX-2, RNA was extracted from cells by using a PureLink RNA Mini Kit (Thermo Fisher). .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System. .. Fold change and statistical significance were determined , and the expression data were normalized to the expression of RPL37A.

Article Title: NAFLD causes selective CD4+ T lymphocyte loss and promotes hepatocarcinogenesis
Article Snippet: RNA isolation and Real-Time PCR RNA was extracted from frozen tissues with RNeasyMini Kit (Qiagen). .. Complementary DNA was synthesized by iScript™ cDNA synthesis kit (BioRad). .. Sequence of primers used for quantitative RT-PCR can be obtained from authors.

Article Title: A gut microbial factor modulates locomotor behavior in Drosophila
Article Snippet: 1 μg of RNA was reverse transcribed using iScript cDNA Synthesis Kit, according to manufacturer’s protocol (Bio-Rad) and diluted to 10 ng/μL based on the input concentration of total RNA. .. 1 μg of RNA was reverse transcribed using iScript cDNA Synthesis Kit, according to manufacturer’s protocol (Bio-Rad) and diluted to 10 ng/μL based on the input concentration of total RNA.

Article Title: Synapse elimination and learning rules coregulated by MHC Class I H2-Db
Article Snippet: H2-Db specific RT-PCR bands from KbDb; NSEDb+ were confirmed by sequencing following cloning into pCR2.1®-TOPO® TA vector (Life Technology Corporation, NY). .. RNA was extracted from each thalamus and cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad). .. Gene expression was analyzed with Taqman Gene Expression Assays (Applied Biosystems) for H2-D1/H2-K1 (Mm04208017_mH) and housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase; Mm99999915_g1).

Article Title: DKK2 imparts tumor immunity evasion through β-catenin-independent suppression of cytotoxic immune cell activation
Article Snippet: Quantitative RT-PCR Total RNAs were isolated from cells using the RNeasy Plus Mini Kit (QIAGEN). .. Complementary DNAs were synthesized from the RNAs using the iScript cDNA Synthesis Kit (Bio-Rad). .. Quantitative PCR was done using the iTaq Universal SYBR Green Supermix (Bio-Rad).

Quantitative RT-PCR:

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation
Article Snippet: Paragraph title: Quantitative real time RT-PCR analysis ... Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD) following manufacturer’s instructions and as described previously [ ]. cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA).

Article Title: Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like Growth Factor 1 expression in the brain
Article Snippet: The leptin and IGF-1 levels were measured in quadruplet (n=4, four biological replicates with three technical replicates within each biological replicate). .. Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD). cDNA was obtained by reverse transcribing 1μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit" (BioRad, Hercules, CA).The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human Leptin ( LEP ) (Hs00174877_m1), mouse leptin ( Lep ) (Mm00434759_m1), human IGF1 ( IGF1 ) (Hs01547656_m1), and mouse IGF1 ( Igf1 ) (Mm00439560_m1). .. The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: Paragraph title: Transcript Analysis by RT-qPCR ... The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System.

Article Title: LncRNA-Dependent Mechanisms of Androgen Receptor-regulated Gene Activation Programs
Article Snippet: Paragraph title: RNA isolation and qRT–PCR ... First-strand cDNA synthesis from total RNA was carried out using iScript™ cDNA Synthesis Kit (Bio-Rad).

Article Title: DKK2 imparts tumor immunity evasion through β-catenin-independent suppression of cytotoxic immune cell activation
Article Snippet: Paragraph title: Quantitative RT-PCR ... Complementary DNAs were synthesized from the RNAs using the iScript cDNA Synthesis Kit (Bio-Rad).

SYBR Green Assay:

Article Title: Immunoprecipitation of Tri-methylated Capped RNA
Article Snippet: Creative Diagnostics has a rabbit anti-TMG antibody (Anti-m3G-cap polyclonal antibody, Creative Diagnostics, catalog number: DPAB29202) that would be similar to the one we previously used but the experimental conditions have to be re-evaluated. .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes) .. Micropipettes (Gilson, model: Pipetman® L, catalog number: F167370) Forma™ Steri-Cycle™ CO2 Incubator (Thermo Scientific, model: Forma™ Steri-Cycle™ CO2 Incubators, catalog number: 370) −80 °C freeze Sorvall™ Legend™ Micro 21R Microcentrifuge (Thermo Fisher Scientific, model: Sorvall™ Legend™ Micro 21R, catalog number: 75002490) Eppendorf™ Thermomixer™ R (Eppendorf, model: Thermomixer R, catalog number: 05-412-401) Labquake™ Tube Shaker/Rotator (Thermo Fisher Scientific, catalog number: C4152110Q) Sorvall™ ST 40R Centrifuge (Thermo Fisher Scientific, model: Sorvall™ ST 40R, catalog number: 75004525) NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDrop™ 2000, catalog number: ND-2000) T100™ Thermal Cycler (Bio-Rad Laboratories, catalog number: 1861096) CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855200) UV transilluminator

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad). .. Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad) was used with the following settings: 45 cycles of 15 seconds of denaturation at 95°C, and 1 minute of primer annealing and elongation at 60°C.

Expressing:

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation
Article Snippet: Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD) following manufacturer’s instructions and as described previously [ ]. cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). .. The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 (BACE1 gene ) (Hs01121195_m1) and mouse Bace1 (Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like Growth Factor 1 expression in the brain
Article Snippet: Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD). cDNA was obtained by reverse transcribing 1μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit" (BioRad, Hercules, CA).The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human Leptin ( LEP ) (Hs00174877_m1), mouse leptin ( Lep ) (Mm00434759_m1), human IGF1 ( IGF1 ) (Hs01547656_m1), and mouse IGF1 ( Igf1 ) (Mm00439560_m1). .. The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
Article Snippet: 2.9 The expression of MMP1 mRNA was analyzed by real time-PCR assay. .. First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer.

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: For analysis of mRNA levels of PGE2 receptors, SOCS3, MRS1, and COX-2, RNA was extracted from cells by using a PureLink RNA Mini Kit (Thermo Fisher). .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System. .. Fold change and statistical significance were determined , and the expression data were normalized to the expression of RPL37A.

Article Title: Redirecting abiraterone metabolism to fine tune prostate cancer anti-androgen therapy
Article Snippet: Paragraph title: Gene expression and immunoblotting ... RNA extraction and cDNA synthesis were performed with the GenElute Mammalian Total RNA miniprep kit (Sigma-Aldrich) and iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) respectively.

Article Title: NAFLD causes selective CD4+ T lymphocyte loss and promotes hepatocarcinogenesis
Article Snippet: Complementary DNA was synthesized by iScript™ cDNA synthesis kit (BioRad). .. Complementary DNA was synthesized by iScript™ cDNA synthesis kit (BioRad).

Article Title: Synapse elimination and learning rules coregulated by MHC Class I H2-Db
Article Snippet: RNA was extracted from each thalamus and cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad). .. Gene expression was analyzed with Taqman Gene Expression Assays (Applied Biosystems) for H2-D1/H2-K1 (Mm04208017_mH) and housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase; Mm99999915_g1).

Article Title: EHMT1 controls brown adipose cell fate and thermogenesis through the PRDM16 complex
Article Snippet: Paragraph title: Gene expression analysis ... Reverse transcription reactions were performed using IScript cDNA synthesis kit (Bio-Rad).

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad). .. Real-time PCR was done with 1 µl cDNA plus 12.5 µl of 2× iQ™ SYBR Green Supermix (Bio-Rad) and 0.5 µl (10 µM) specific primers: mE-selectin 1 (5′-GGA CAC CAC AAA TCC CAG TCT G-3′) and mE-selectin 2 (5′- TCG CAG GAG AAC TCA CAA CTG G-3′); mP-selectin 1 (5′-AAG ATG CCT GGC TAC TGG ACA C-3′) and mP-selecin 2 (5′-CAA GAG GCT GAA CGC AGG TCA T-3′); mβ-actin 1 (5’-CAT TGC TGA CAG GAT GCA GAA GG-3’) and mβ-actin 2 (5’-TGC TGG AAG GTG GAC AGT GAG G-3’).

Western Blot:

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System. .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System.

Activated Clotting Time Assay:

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Flow Cytometry:

Article Title: Immunoprecipitation of Tri-methylated Capped RNA
Article Snippet: Creative Diagnostics has a rabbit anti-TMG antibody (Anti-m3G-cap polyclonal antibody, Creative Diagnostics, catalog number: DPAB29202) that would be similar to the one we previously used but the experimental conditions have to be re-evaluated. .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes) .. Micropipettes (Gilson, model: Pipetman® L, catalog number: F167370) Forma™ Steri-Cycle™ CO2 Incubator (Thermo Scientific, model: Forma™ Steri-Cycle™ CO2 Incubators, catalog number: 370) −80 °C freeze Sorvall™ Legend™ Micro 21R Microcentrifuge (Thermo Fisher Scientific, model: Sorvall™ Legend™ Micro 21R, catalog number: 75002490) Eppendorf™ Thermomixer™ R (Eppendorf, model: Thermomixer R, catalog number: 05-412-401) Labquake™ Tube Shaker/Rotator (Thermo Fisher Scientific, catalog number: C4152110Q) Sorvall™ ST 40R Centrifuge (Thermo Fisher Scientific, model: Sorvall™ ST 40R, catalog number: 75004525) NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDrop™ 2000, catalog number: ND-2000) T100™ Thermal Cycler (Bio-Rad Laboratories, catalog number: 1861096) CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855200) UV transilluminator

Transferring:

Article Title: Immunoprecipitation of Tri-methylated Capped RNA
Article Snippet: 1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-129) 15 ml conical centrifuge tubes (DNase-/RNase-free) (Corning, catalog number: 430052) Gilson™ EXPERT™ University Fit pipette filter tips (Gilson, catalog numbers: F1731031, F1733031, F1735031, F1737031) Gel-loading pipet tips (Fisher Scientific, catalog number: 02-707-139) Large-orifice pipet tips (Fisher Scientific, catalog number: 02-707-134) Sterile polystyrene disposable serological pipettes (Greiner Bio One International, catalog number: 710180) Serological pipettes 2 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11C) 5 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11D) 10 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11E) 25 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11) 150 cm2 vented tissue culture treated flasks (Corning, Falcon® , catalog number: 355001) 100 mm TC-treated cell culture dish (Corning, Falcon® , catalog number: 353033) Cell scrapers (Fisher Scientific, catalog number: 08-100-242) HFF cells (obtained from the Yale Skin Disease Research Center) (Alternative source of HFF cells from ATCC: Hs27 (ATCC, catalog number: CRL-1634)) DMEM (Sigma-Aldrich, catalog number: D7777) Minimum essential medium (MEM) non-essential amino acids, 100× (Thermo Fisher Scientific, catalog number: 11140076) 0.05% trypsin-EDTA with phenol red (Thermo Fisher Scientific, catalog number: 25300054) 10× PBS (Sigma-Aldrich, catalog number: P5493) Nuclease-free water (not DEPC-Treated) (Thermo Fisher Scientific, catalog number: AM9937) TRIzol™ Reagent (Thermo Fisher Scientific, catalog number: 15596026) RNase AWAY™ Surface Decontaminant (Thermo Fisher Scientific, catalog number: 7002) Chloroform (Sigma-Aldrich, catalog number: C2432) Ethanol, molecular biology grade (Fisher Scientific, catalog number: BP2818-500) Isopropanol, molecular biology grade (Fisher Scientific, catalog number: BP26184) GlycoBlue™ Coprecipitant (15 mg/ml) (Thermo Fisher Scientific, catalog number: AM9516) TURBO DNA-free™ Kit (Thermo Fisher Scientific, catalog number: AM1907) Anti-m3G-cap, rabbit polyclonal, antiserum (Synaptic Systems)* Note: *Synaptic Systems discontinued the production of the Anti-m3G-cap, rabbit polyclonal, antiserum. .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

Cell Culture:

Article Title: Immunoprecipitation of Tri-methylated Capped RNA
Article Snippet: 1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-129) 15 ml conical centrifuge tubes (DNase-/RNase-free) (Corning, catalog number: 430052) Gilson™ EXPERT™ University Fit pipette filter tips (Gilson, catalog numbers: F1731031, F1733031, F1735031, F1737031) Gel-loading pipet tips (Fisher Scientific, catalog number: 02-707-139) Large-orifice pipet tips (Fisher Scientific, catalog number: 02-707-134) Sterile polystyrene disposable serological pipettes (Greiner Bio One International, catalog number: 710180) Serological pipettes 2 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11C) 5 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11D) 10 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11E) 25 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11) 150 cm2 vented tissue culture treated flasks (Corning, Falcon® , catalog number: 355001) 100 mm TC-treated cell culture dish (Corning, Falcon® , catalog number: 353033) Cell scrapers (Fisher Scientific, catalog number: 08-100-242) HFF cells (obtained from the Yale Skin Disease Research Center) (Alternative source of HFF cells from ATCC: Hs27 (ATCC, catalog number: CRL-1634)) DMEM (Sigma-Aldrich, catalog number: D7777) Minimum essential medium (MEM) non-essential amino acids, 100× (Thermo Fisher Scientific, catalog number: 11140076) 0.05% trypsin-EDTA with phenol red (Thermo Fisher Scientific, catalog number: 25300054) 10× PBS (Sigma-Aldrich, catalog number: P5493) Nuclease-free water (not DEPC-Treated) (Thermo Fisher Scientific, catalog number: AM9937) TRIzol™ Reagent (Thermo Fisher Scientific, catalog number: 15596026) RNase AWAY™ Surface Decontaminant (Thermo Fisher Scientific, catalog number: 7002) Chloroform (Sigma-Aldrich, catalog number: C2432) Ethanol, molecular biology grade (Fisher Scientific, catalog number: BP2818-500) Isopropanol, molecular biology grade (Fisher Scientific, catalog number: BP26184) GlycoBlue™ Coprecipitant (15 mg/ml) (Thermo Fisher Scientific, catalog number: AM9516) TURBO DNA-free™ Kit (Thermo Fisher Scientific, catalog number: AM1907) Anti-m3G-cap, rabbit polyclonal, antiserum (Synaptic Systems)* Note: *Synaptic Systems discontinued the production of the Anti-m3G-cap, rabbit polyclonal, antiserum. .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

Generated:

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: Next, cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher) and expression of genes COX-1, COX-2, DAGL, MGGL (MAGL), PLA-2, and TXBSA was measured by using two-step quantitative real-time polymerase chain reaction (RT-qPCR), performed on a Stratagene MXP3005 using SYBRGreen reagents (Bio-Rad). .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System.

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Plasma creatinine (mg/dl) was determined with an enzymatic method with minor modifications from the manufacturer’s protocol (twice the volume of sample and standard, and using two-fold serial dilution of the calibrator (standard) provided in the kit; Diazyme Laboratories) that we have validated by using LC-MS . .. Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: At indicated time points, viral load of skin was examined by quantitative real-time PCR, as described previously . .. Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad). .. Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad) was used with the following settings: 45 cycles of 15 seconds of denaturation at 95°C, and 1 minute of primer annealing and elongation at 60°C.

Polymerase Chain Reaction:

Article Title: Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas
Article Snippet: Paragraph title: RT-real time PCR for EBV mRNAs ... Briefly, 10 ng of cellular RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad) in a 20 µl reaction using the manufacturer's protocol.

Article Title: G-protein independent coupling of the MC4R to Kir 7.1 in hypothalamic neurons
Article Snippet: Paragraph title: Quantitiative PCR ... One microgram of purified total RNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA).

Cellular Antioxidant Activity Assay:

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad). .. Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad) was used with the following settings: 45 cycles of 15 seconds of denaturation at 95°C, and 1 minute of primer annealing and elongation at 60°C.

Isolation:

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation
Article Snippet: Aβ1 - 42 levels in the mouse cortex and hippocampus were normalized to total protein content in the samples (pg/mg protein). .. Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD) following manufacturer’s instructions and as described previously [ ]. cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). .. The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 (BACE1 gene ) (Hs01121195_m1) and mouse Bace1 (Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like Growth Factor 1 expression in the brain
Article Snippet: The leptin and IGF-1 levels were measured in quadruplet (n=4, four biological replicates with three technical replicates within each biological replicate). .. Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD). cDNA was obtained by reverse transcribing 1μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit" (BioRad, Hercules, CA).The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human Leptin ( LEP ) (Hs00174877_m1), mouse leptin ( Lep ) (Mm00434759_m1), human IGF1 ( IGF1 ) (Hs01547656_m1), and mouse IGF1 ( Igf1 ) (Mm00439560_m1). .. The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Article Title: Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas
Article Snippet: Total RNA was isolated using RNeasy mini kit (Qiagen) and RT-real-time-PCR assays carried out for quantification of LMP1 and α-tubulin levels using the Bio-Rad MyIQ single color detection system. .. Briefly, 10 ng of cellular RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad) in a 20 µl reaction using the manufacturer's protocol.

Article Title: NAFLD causes selective CD4+ T lymphocyte loss and promotes hepatocarcinogenesis
Article Snippet: Paragraph title: RNA isolation and Real-Time PCR ... Complementary DNA was synthesized by iScript™ cDNA synthesis kit (BioRad).

Article Title: A gut microbial factor modulates locomotor behavior in Drosophila
Article Snippet: Paragraph title: RNA isolation and quantitative real-time PCR. ... 1 μg of RNA was reverse transcribed using iScript cDNA Synthesis Kit, according to manufacturer’s protocol (Bio-Rad) and diluted to 10 ng/μL based on the input concentration of total RNA.

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Plasma creatinine (mg/dl) was determined with an enzymatic method with minor modifications from the manufacturer’s protocol (twice the volume of sample and standard, and using two-fold serial dilution of the calibrator (standard) provided in the kit; Diazyme Laboratories) that we have validated by using LC-MS . .. Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Article Title: EHMT1 controls brown adipose cell fate and thermogenesis through the PRDM16 complex
Article Snippet: Total RNA was isolated from tissues using Trizol (Invitrogen) or RiboZol reagents (AMRESCO) following the manufacturer’s protocol. .. Reverse transcription reactions were performed using IScript cDNA synthesis kit (Bio-Rad).

Article Title: LncRNA-Dependent Mechanisms of Androgen Receptor-regulated Gene Activation Programs
Article Snippet: Paragraph title: RNA isolation and qRT–PCR ... First-strand cDNA synthesis from total RNA was carried out using iScript™ cDNA Synthesis Kit (Bio-Rad).

Article Title: DKK2 imparts tumor immunity evasion through β-catenin-independent suppression of cytotoxic immune cell activation
Article Snippet: Quantitative RT-PCR Total RNAs were isolated from cells using the RNeasy Plus Mini Kit (QIAGEN). .. Complementary DNAs were synthesized from the RNAs using the iScript cDNA Synthesis Kit (Bio-Rad).

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Paragraph title: Isolation of mRNA and real-time PCR ... Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad).

Transfection:

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
Article Snippet: After transfection for 24 h, total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, California, USA) with the RNA quality (UV reader, 260/280 ratio > 1.7) and triplicate assessment by using microplate (BioTeck, USA). .. First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer.

Article Title: Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas
Article Snippet: The controls transfected were either Scramble-miRNA (Exiqon) or Precursor-Negative Control (Pre-NegCtrl) (Applied Biosystems), respectively, as described above. .. Briefly, 10 ng of cellular RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad) in a 20 µl reaction using the manufacturer's protocol.

Mouse Assay:

Article Title: Autism-like phenotype and risk gene-RNA deadenylation by CPEB4 mis-splicing
Article Snippet: Total tissue RNA was extracted from prefrontal cortex - BA8/9 of CTRL (n = 15) and idiopathic ASD patients (n = 16) and striatum, cortex or forebrain from Control, CPEB4 KOGT /+, TgCPEB4∆4, CPEB4 KO/+ and TgCPEB4∆4:CPEB4 KOGT /+, mice using the Maxwell® 16 LEV simplyRNA Tissue Kit (Promega, AS1280). .. Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Bio-Rad, PN170-8891) following manufacturer´s instructions.

Chloramphenicol Acetyltransferase Assay:

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Purification:

Article Title: G-protein independent coupling of the MC4R to Kir 7.1 in hypothalamic neurons
Article Snippet: To remove genomic DNA, On-Column DNase Digestion was performed using an RNase-Free DNase Set (QIAGEN). .. One microgram of purified total RNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). .. Q-PCR primers were designed by Beacon Designer 7.0 (Premier Biosoft International, Palo Alto, CA) to minimize primer self-dimerization, and primer sequences are indicated below.

RNA Extraction:

Article Title: Autism-like phenotype and risk gene-RNA deadenylation by CPEB4 mis-splicing
Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Bio-Rad, PN170-8891) following manufacturer´s instructions.

Article Title: Redirecting abiraterone metabolism to fine tune prostate cancer anti-androgen therapy
Article Snippet: Cells were starved with phenol red-free and serum free-medium for at least 48 h before treatment with the indicated drugs and/or androgens. .. RNA extraction and cDNA synthesis were performed with the GenElute Mammalian Total RNA miniprep kit (Sigma-Aldrich) and iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) respectively. .. Quantitative PCR (qPCR) analysis was conducted in triplicate in an ABI 7500 Real-Time PCR machine (Applied Biosystems) using iTaq Fast SYBR Green Supermix with ROX (Bio-Rad) and primers for TMPRSS2 , PSA and RPLPO , as described previously .

Software:

Article Title: Epstein-Barr Virus BART9 miRNA Modulates LMP1 Levels and Affects Growth Rate of Nasal NK T Cell Lymphomas
Article Snippet: Briefly, 10 ng of cellular RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad) in a 20 µl reaction using the manufacturer's protocol. .. PCR reactions were carried out in 96-well format using a Bio-Rad iCycler.

Real-time Polymerase Chain Reaction:

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
Article Snippet: Paragraph title: Quantitative real-time PCR ... First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer.

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: Next, cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher) and expression of genes COX-1, COX-2, DAGL, MGGL (MAGL), PLA-2, and TXBSA was measured by using two-step quantitative real-time polymerase chain reaction (RT-qPCR), performed on a Stratagene MXP3005 using SYBRGreen reagents (Bio-Rad). .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System.

Article Title: NAFLD causes selective CD4+ T lymphocyte loss and promotes hepatocarcinogenesis
Article Snippet: Paragraph title: RNA isolation and Real-Time PCR ... Complementary DNA was synthesized by iScript™ cDNA synthesis kit (BioRad).

Article Title: A gut microbial factor modulates locomotor behavior in Drosophila
Article Snippet: Paragraph title: RNA isolation and quantitative real-time PCR. ... 1 μg of RNA was reverse transcribed using iScript cDNA Synthesis Kit, according to manufacturer’s protocol (Bio-Rad) and diluted to 10 ng/μL based on the input concentration of total RNA.

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Paragraph title: Real-time PCR measurements of Kim-1 , Gapdh and Hif(R1α mRNA in mouse kidneys ... Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer.

Article Title: Synapse elimination and learning rules coregulated by MHC Class I H2-Db
Article Snippet: Paragraph title: 8. Taqman qPCR ... RNA was extracted from each thalamus and cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad).

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Paragraph title: Isolation of mRNA and real-time PCR ... Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad).

Negative Control:

Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
Article Snippet: First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

Proximity Ligation Assay:

Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
Article Snippet: Next, cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher) and expression of genes COX-1, COX-2, DAGL, MGGL (MAGL), PLA-2, and TXBSA was measured by using two-step quantitative real-time polymerase chain reaction (RT-qPCR), performed on a Stratagene MXP3005 using SYBRGreen reagents (Bio-Rad). .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System.

Ethanol Precipitation:

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Plasma creatinine (mg/dl) was determined with an enzymatic method with minor modifications from the manufacturer’s protocol (twice the volume of sample and standard, and using two-fold serial dilution of the calibrator (standard) provided in the kit; Diazyme Laboratories) that we have validated by using LC-MS . .. Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Spectrophotometry:

Article Title: Autism-like phenotype and risk gene-RNA deadenylation by CPEB4 mis-splicing
Article Snippet: Quantification and quality of RNA was done on a Nanodrop ND-1000 spectrophotometer and Nanodrop 1000 v.3.7.1 (Thermo Scientific). .. Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Bio-Rad, PN170-8891) following manufacturer´s instructions.

Article Title: EHMT1 controls brown adipose cell fate and thermogenesis through the PRDM16 complex
Article Snippet: Quality of RNA from all the samples was checked by spectrophotometer. .. Reverse transcription reactions were performed using IScript cDNA synthesis kit (Bio-Rad).

Concentration Assay:

Article Title: A gut microbial factor modulates locomotor behavior in Drosophila
Article Snippet: Heads (20 flies per sample) or decapitated bodies (5 flies per sample) were dissected on ice and immediately processed using an Arcturus™ PicoPure™ RNA isolation kit (Applied Biosystems) or a standard TRIzol™-Chloroform protocol (ThermoFisher). .. 1 μg of RNA was reverse transcribed using iScript cDNA Synthesis Kit, according to manufacturer’s protocol (Bio-Rad) and diluted to 10 ng/μL based on the input concentration of total RNA. .. Previously published primer pairs were used to target immune-related gene transcripts , .

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Plasma creatinine (mg/dl) was determined with an enzymatic method with minor modifications from the manufacturer’s protocol (twice the volume of sample and standard, and using two-fold serial dilution of the calibrator (standard) provided in the kit; Diazyme Laboratories) that we have validated by using LC-MS . .. Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

CTG Assay:

Article Title: C1 neurons mediate a stress-induced anti-inflammatory reflex in mice
Article Snippet: Renal mRNA was isolated by following the ethanol-precipitation method, and RNA concentration was determined based on spectrophometric determination of 260/280 ratio. cDNA was generated from the resultant tissue RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) as described by the manufacturer. .. Resultant cDNA was then used to determine relative mRNA expression of Kim-1, Hif-1α, and GAPDH using the iTAC Universal SYBR Green Supermix (Bio-Rad).

Article Title: Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity
Article Snippet: Total RNA was extracted from homogenized skin tissue and cDNA was generated with iScript cDNA synthesis kit (Bio-Rad). .. Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad) was used with the following settings: 45 cycles of 15 seconds of denaturation at 95°C, and 1 minute of primer annealing and elongation at 60°C.

Lysis:

Article Title: G-protein independent coupling of the MC4R to Kir 7.1 in hypothalamic neurons
Article Snippet: Embryos were homogenized in lysis buffer with a sonic dismembrator (model 100, Fisher Scientific, Pittsburgh, PA). .. One microgram of purified total RNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Bio-Rad iscript cdna synthesis kit
    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to <t>cDNA</t> using <t>iScript</t> cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.
    Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    iscript cdna synthesis kit - by Bioz Stars, 2019-12
    83/100 stars
      Buy from Supplier

    Image Search Results


    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Journal:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA

    doi: 10.21769/BioProtoc.2717

    Figure Lengend Snippet: RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Article Snippet: Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

    Techniques: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Incubation, Flow Cytometry, Methylation, Nucleic Acid Electrophoresis