Structured Review

Bio-Rad iscript cdna synthesis kit
Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 3427 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
Average 99 stars, based on 3427 article reviews
Price from $9.99 to $1999.99
iscript cdna synthesis kit - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Centrifugation:

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: After centrifugation at 12000 × g for 10 minutes, the interphase was collected for DNA extraction while the RNA in the aqueous phase was precipitated with isopropanol, washed in 75% ethanol and then resuspended in 20 μ l RNAse-free water for storage at -80°C. .. Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions.

Synthesized:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). ..

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: .. Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad). .. Q-RT-PCR was performed using SoFast EvagGreen Supermix (BioRad) with cDNA corresponding to 50ng of total RNA and 500nM primers in a 20μl volume.

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: .. RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad). .. Quantitative PCR was performed in triplicate using 2× SYBR Green PCR Master Mix (Absource Biotools).

Quantitative RT-PCR:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). ..

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol. .. Gene expression was examined by quantitative RT-PCR (qRT-PCR) using IQ™ SYBR Green Supermix.

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: Paragraph title: Quantitative RT-PCR (Q-RT-PCR) ... Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad).

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: .. RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. All qRT-PCR samples were run in triplicate and expression was normalized to Gapdh and represented as fold change over relevant control samples.

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: Paragraph title: qRT-PCR analyses ... RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad).

Real-time Polymerase Chain Reaction:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). ..

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: Paragraph title: 2.3. RNA Extraction, Reverse Transcription and Quantitative Reverse Transcription-PCR (QPCR) ... Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Endophytes alleviate the elevated CO2-dependent decrease in photosynthesis in rice, particularly under nitrogen limitation
Article Snippet: .. The isolated mRNAs were mixed with a master reaction mixture containing fluorescent dyes (iQ SyBR Green Supermix, Bio-Rad Laboratories) prior to cDNA synthesis using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories) and were then loaded into a real-time qPCR thermocycler (Chromo 4 System, Bio-Rad Laboratories). .. The relative gene expression of rbcS was calculated according to .

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions. .. Real-time PCR was performed starting from 10 ng of cDNA, using a PCR mix containing TaqMan® Universal PCR Master Mix and Assays-on-Demand Gene expression probes (Life Technologies, Waltham, MA, USA) for SCX (scleraxis; Hs03054634_g1), COL1A1 (collagen type I alpha 1 chain; Hs01076777_m1), COL3A1 (collagen type III alpha 1 chain; Hs00943809_m1), MMP1 (metalloproteinase-1; Hs00899658_m1), MMP3 (metalloproteinase-3; Hs00968305_m1), and PTGS2 (cyclooxygenase-2; Hs00153133_m1).

Article Title: Activation of a Bovine Mammary Epithelial Cell Line by Ruminant-Associated Staphylococcus aureus is Lineage Dependent
Article Snippet: Total RNA Extraction and Reverse Transcription Transcription levels of TNFα, SAA3, NF-κB and TLR-2 genes of PS in response to randomly selected CC151 (n = 4), CC479 (n = 4) and CC133 (n = 4) isolates were measured using quantitative real-time PCR (qPCR). .. Five hours after removal of bacteria, RNA was extracted directly from monolayers within the 12-well plates using the RNeasy Micro Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions and converted to cDNA using the iSCRIPT cDNA Synthesis Kit (BioRad, Hercules, CA, USA).

Article Title: Inflammation and TGF-β Signaling Differ between Abdominal Aneurysms and Occlusive Disease
Article Snippet: .. Total RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, The Netherlands). cDNA samples were subjected to 40 cycles real-time PCR analysis using SYBR Green qPCR Master Mix 2x (Bio-Rad, Veenendaal, The Netherlands) and primers. ..

Article Title: Nedd4 ubiquitylates VDAC2/3 to suppress erastin-induced ferroptosis in melanoma
Article Snippet: .. RNA extraction, cDNA synthesis, and qPCR analysis Total RNA was isolated with the RNeasy Mini Kit (Qiagen 74104), and 1 µg of total RNA was used for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-rad). .. Quantitative PCRs were carried out using iQ SYBR Green Master Mix (Bio-rad).

Article Title: Deficiency of T cell CD40L has minor beneficial effects on obesity-induced metabolic dysfunction
Article Snippet: All RNA was reverse transcribed to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Lunteren, The Netherlands). .. Quantitative PCR was performed with a SYBR green PCR kit (Applied Biosystems, Waltham) on a ViiA7 real-time PCR system (Applied Biosystems).

Article Title: Wnt-3a Induces Cytokine Release in Human Mast Cells
Article Snippet: .. Quantitative PCR (qPCR) and RNA Sequencing (RNAseq) For qPCR, RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA was prepared using an iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using TaqMan™ Gene Expression master mix (Thermo Fisher Scientific) on a CFX96 Real-Time System (Bio-Rad). .. The following primers were used: Hs02800695_m1 (HPRT1), Hs00174103_m1 (CXCL8), Hs04187715_m1 (CCL8), Hs00171147_m1 (CCL7), Hs01099660_g1 (CXCL5), Hs00234142_m1 (CCL3), and TaqMan Array Human WNT Pathway (all from Thermo Fisher Scientific).

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad). .. Quantitative PCR was performed in triplicate using 2× SYBR Green PCR Master Mix (Absource Biotools).

Incubation:

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: Briefly, the spleens were minced in RPMI 1640 (Sigma-Aldrich) and forced gently through a 70 μm cell-strainer nylon mesh using a sterile syringe plunger and centrifuged at 400 g for 5 min. After washing once using cold PBS, spleen cells were incubated in 2 ml 0.83% NH4 Cl for 5 min, then placed in 20 ml PBS, centrifuged at 400 g for 5 min and then resuspended in RPMI 1640. .. The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol.

Article Title: Pathogenicity island excision during an infection by Salmonella enterica serovar Enteritidis is required for crossing the intestinal epithelial barrier in mice to cause systemic infection
Article Snippet: After 5 min of incubation at room temperature (RT), gDNA was pelleted at 21,000 x g 10 min at 4°C, the supernatant was removed, and the pellet was resuspended in 50μL of nuclease-free (NF) water (AMBION, Invitrogen). .. RNA extraction from bacteria was carried out with TRIzol as described by the manufacturer and reverse transcription was performed using iScript cDNA Synthesis Kit (Biorad) which was prepared according to the manufacturer´s instructions.

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: .. Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad). .. Q-RT-PCR was performed using SoFast EvagGreen Supermix (BioRad) with cDNA corresponding to 50ng of total RNA and 500nM primers in a 20μl volume.

Expressing:

Article Title: Restoring colistin sensitivity in colistin-resistant E. coli: Combinatorial use of MarR inhibitor with efflux pump inhibitor
Article Snippet: To discern the effect of expression efflux pump genes in colistin resistant U3790, we performed semi-quantitative gene expression studies by amplifying acrA, acrB and tolC genes in U3790. .. Total RNA from the bacterial strains were isolated using Aurum™ total RNA mini kit (Bio Rad). cDNA conversion was done using the iScript™ cDNA synthesis kit (Bio Rad).

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). .. Gene expression was quantified using iTaq Universal SYBR green super mix using CFX384 Real-Time System (Bio-Rad).

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol. .. Gene expression was examined by quantitative RT-PCR (qRT-PCR) using IQ™ SYBR Green Supermix.

Article Title: Endophytes alleviate the elevated CO2-dependent decrease in photosynthesis in rice, particularly under nitrogen limitation
Article Snippet: Paragraph title: Gene expression analysis using dye-based qPCR ... The isolated mRNAs were mixed with a master reaction mixture containing fluorescent dyes (iQ SyBR Green Supermix, Bio-Rad Laboratories) prior to cDNA synthesis using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories) and were then loaded into a real-time qPCR thermocycler (Chromo 4 System, Bio-Rad Laboratories).

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: Paragraph title: 2.3. RNA Isolation and Gene Expression ... Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions.

Article Title: Inflammation and TGF-β Signaling Differ between Abdominal Aneurysms and Occlusive Disease
Article Snippet: 2.1.7. qPCR Analysis Expression data of COL11A, Adiponectin, CXCL13, SLC7A5, and FDC-SP were analyzed in diseased aortic tissue ( ). .. Total RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, The Netherlands). cDNA samples were subjected to 40 cycles real-time PCR analysis using SYBR Green qPCR Master Mix 2x (Bio-Rad, Veenendaal, The Netherlands) and primers.

Article Title: Nedd4 ubiquitylates VDAC2/3 to suppress erastin-induced ferroptosis in melanoma
Article Snippet: RNA extraction, cDNA synthesis, and qPCR analysis Total RNA was isolated with the RNeasy Mini Kit (Qiagen 74104), and 1 µg of total RNA was used for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-rad). .. The gene expression levels were normalized to actin.

Article Title: Deficiency of T cell CD40L has minor beneficial effects on obesity-induced metabolic dysfunction
Article Snippet: Paragraph title: Gene expression analysis ... All RNA was reverse transcribed to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Lunteren, The Netherlands).

Article Title: Wnt-3a Induces Cytokine Release in Human Mast Cells
Article Snippet: .. Quantitative PCR (qPCR) and RNA Sequencing (RNAseq) For qPCR, RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA was prepared using an iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using TaqMan™ Gene Expression master mix (Thermo Fisher Scientific) on a CFX96 Real-Time System (Bio-Rad). .. The following primers were used: Hs02800695_m1 (HPRT1), Hs00174103_m1 (CXCL8), Hs04187715_m1 (CCL8), Hs00171147_m1 (CCL7), Hs01099660_g1 (CXCL5), Hs00234142_m1 (CCL3), and TaqMan Array Human WNT Pathway (all from Thermo Fisher Scientific).

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. All qRT-PCR samples were run in triplicate and expression was normalized to Gapdh and represented as fold change over relevant control samples.

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad). .. Expression of each gene was calculated using the 2−ΔΔCt method.

Transformation Assay:

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. Normalized RSEM expression data were log2 transformed for visualization.

Activation Assay:

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions. .. The results were normalized against the mean expression of two housekeeping genes: YWHAZ (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta, Hs03044281_g1) and ACTB (β -actin, Hs99999903_m1) identified in a previous study [ ].

Cell Culture:

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: Cells were then washed with PBS twice and cultured in fresh regular culture media without any drugs for different periods of time. .. Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: Isolated splenocytes were stimulated with 5 μg/ml recombinant AgBR1 or BSA and cultured with serum-free RPMI medium for 6 h and 24 h. Total RNA was extracted by the RNeasy Mini Kit (QIAGEN) according to the instructions. .. The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol.

Generated:

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: .. The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol. .. Gene expression was examined by quantitative RT-PCR (qRT-PCR) using IQ™ SYBR Green Supermix.

Sequencing:

Article Title: Restoring colistin sensitivity in colistin-resistant E. coli: Combinatorial use of MarR inhibitor with efflux pump inhibitor
Article Snippet: Paragraph title: Whole genome sequencing ... Total RNA from the bacterial strains were isolated using Aurum™ total RNA mini kit (Bio Rad). cDNA conversion was done using the iScript™ cDNA synthesis kit (Bio Rad).

Recombinant:

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: Paragraph title: Splenocyte stimulation with recombinant AgBR1 ... The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol.

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: Treatment groups included DMEM Complete alone or DMEM Complete with 100ng/ml recombinant murine Mst1 (R & D 6244-MS). .. Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad).

DNA Extraction:

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: After centrifugation at 12000 × g for 10 minutes, the interphase was collected for DNA extraction while the RNA in the aqueous phase was precipitated with isopropanol, washed in 75% ethanol and then resuspended in 20 μ l RNAse-free water for storage at -80°C. .. Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions.

Nucleic Acid Electrophoresis:

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: Quantitative RT-PCR (Q-RT-PCR) RNA was extracted from pancreata using Trizol (Invitrogen) and quality checked by gel electrophoresis. .. Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad).

RNA Sequencing Assay:

Article Title: Wnt-3a Induces Cytokine Release in Human Mast Cells
Article Snippet: .. Quantitative PCR (qPCR) and RNA Sequencing (RNAseq) For qPCR, RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA was prepared using an iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using TaqMan™ Gene Expression master mix (Thermo Fisher Scientific) on a CFX96 Real-Time System (Bio-Rad). .. The following primers were used: Hs02800695_m1 (HPRT1), Hs00174103_m1 (CXCL8), Hs04187715_m1 (CCL8), Hs00171147_m1 (CCL7), Hs01099660_g1 (CXCL5), Hs00234142_m1 (CCL3), and TaqMan Array Human WNT Pathway (all from Thermo Fisher Scientific).

Isolation:

Article Title: Restoring colistin sensitivity in colistin-resistant E. coli: Combinatorial use of MarR inhibitor with efflux pump inhibitor
Article Snippet: .. Total RNA from the bacterial strains were isolated using Aurum™ total RNA mini kit (Bio Rad). cDNA conversion was done using the iScript™ cDNA synthesis kit (Bio Rad). .. Both RNA and cDNA was quantified using Qubit fluorimeter (Invitrogen).

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: Isolated splenocytes were stimulated with 5 μg/ml recombinant AgBR1 or BSA and cultured with serum-free RPMI medium for 6 h and 24 h. Total RNA was extracted by the RNeasy Mini Kit (QIAGEN) according to the instructions. .. The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol.

Article Title: Endophytes alleviate the elevated CO2-dependent decrease in photosynthesis in rice, particularly under nitrogen limitation
Article Snippet: .. The isolated mRNAs were mixed with a master reaction mixture containing fluorescent dyes (iQ SyBR Green Supermix, Bio-Rad Laboratories) prior to cDNA synthesis using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories) and were then loaded into a real-time qPCR thermocycler (Chromo 4 System, Bio-Rad Laboratories). .. The relative gene expression of rbcS was calculated according to .

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: Paragraph title: 2.3. RNA Isolation and Gene Expression ... Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions.

Article Title: Nedd4 ubiquitylates VDAC2/3 to suppress erastin-induced ferroptosis in melanoma
Article Snippet: .. RNA extraction, cDNA synthesis, and qPCR analysis Total RNA was isolated with the RNeasy Mini Kit (Qiagen 74104), and 1 µg of total RNA was used for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-rad). .. Quantitative PCRs were carried out using iQ SYBR Green Master Mix (Bio-rad).

Article Title: Wnt-3a Induces Cytokine Release in Human Mast Cells
Article Snippet: Quantitative PCR (qPCR) and RNA Sequencing (RNAseq) For qPCR, RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA was prepared using an iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using TaqMan™ Gene Expression master mix (Thermo Fisher Scientific) on a CFX96 Real-Time System (Bio-Rad). .. For RNAseq, RNA was extracted using Arcturus PicoPure RNA Isolation Kit (Thermo Fisher Scientific).

Article Title: MST1R Kinase Accelerates Pancreatic Cancer Progression Via Effects on both Epithelial Cells and Macrophages
Article Snippet: .. Cells were incubated for the indicated times or overnight, after which time RNA was isolated using Trizol, then treated with DNAase1 (Invitrogen). cDNA was synthesized from 1 μg of RNA using iScript cDNA Synthesis Kit (BioRad). .. Q-RT-PCR was performed using SoFast EvagGreen Supermix (BioRad) with cDNA corresponding to 50ng of total RNA and 500nM primers in a 20μl volume.

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: .. RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. All qRT-PCR samples were run in triplicate and expression was normalized to Gapdh and represented as fold change over relevant control samples.

RNA Extraction:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). ..

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: Paragraph title: 2.3. RNA Extraction, Reverse Transcription and Quantitative Reverse Transcription-PCR (QPCR) ... Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Activation of a Bovine Mammary Epithelial Cell Line by Ruminant-Associated Staphylococcus aureus is Lineage Dependent
Article Snippet: Paragraph title: 2.5. Total RNA Extraction and Reverse Transcription ... Five hours after removal of bacteria, RNA was extracted directly from monolayers within the 12-well plates using the RNeasy Micro Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions and converted to cDNA using the iSCRIPT cDNA Synthesis Kit (BioRad, Hercules, CA, USA).

Article Title: Pathogenicity island excision during an infection by Salmonella enterica serovar Enteritidis is required for crossing the intestinal epithelial barrier in mice to cause systemic infection
Article Snippet: .. RNA extraction from bacteria was carried out with TRIzol as described by the manufacturer and reverse transcription was performed using iScript cDNA Synthesis Kit (Biorad) which was prepared according to the manufacturer´s instructions. .. Quantitative real-time qPCR To quantify ROD21 excision, quantitative real-time PCR (qPCR) was performed using TaqMan probes and TaqMan Fast Advanced Master Mix, according to the manufacturer’s instructions for 20μL of reaction mixture.

Article Title: Nedd4 ubiquitylates VDAC2/3 to suppress erastin-induced ferroptosis in melanoma
Article Snippet: .. RNA extraction, cDNA synthesis, and qPCR analysis Total RNA was isolated with the RNeasy Mini Kit (Qiagen 74104), and 1 µg of total RNA was used for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-rad). .. Quantitative PCRs were carried out using iQ SYBR Green Master Mix (Bio-rad).

Mouse Assay:

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: Splenocyte stimulation with recombinant AgBR1 Splenocytes were isolated from C57BL/6 mice. .. The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol.

Polymerase Chain Reaction:

Article Title: Restoring colistin sensitivity in colistin-resistant E. coli: Combinatorial use of MarR inhibitor with efflux pump inhibitor
Article Snippet: Total RNA from the bacterial strains were isolated using Aurum™ total RNA mini kit (Bio Rad). cDNA conversion was done using the iScript™ cDNA synthesis kit (Bio Rad). .. The obtained PCR product was quantified using ImageJ software.

Article Title: Autologous Microfragmented Adipose Tissue Reduces the Catabolic and Fibrosis Response in an In Vitro Model of Tendon Cell Inflammation
Article Snippet: Total RNA from each sample was transcribed to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) as per manufacturer's instructions. .. Real-time PCR was performed starting from 10 ng of cDNA, using a PCR mix containing TaqMan® Universal PCR Master Mix and Assays-on-Demand Gene expression probes (Life Technologies, Waltham, MA, USA) for SCX (scleraxis; Hs03054634_g1), COL1A1 (collagen type I alpha 1 chain; Hs01076777_m1), COL3A1 (collagen type III alpha 1 chain; Hs00943809_m1), MMP1 (metalloproteinase-1; Hs00899658_m1), MMP3 (metalloproteinase-3; Hs00968305_m1), and PTGS2 (cyclooxygenase-2; Hs00153133_m1).

Article Title: Activation of a Bovine Mammary Epithelial Cell Line by Ruminant-Associated Staphylococcus aureus is Lineage Dependent
Article Snippet: Five hours after removal of bacteria, RNA was extracted directly from monolayers within the 12-well plates using the RNeasy Micro Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions and converted to cDNA using the iSCRIPT cDNA Synthesis Kit (BioRad, Hercules, CA, USA). .. For qPCR, a three-step PCR protocol was used: An initial 10 min denaturation at 95 °C, followed by 40 cycles with 15 s of denaturation at 95 °C, 30 s annealing at primer specific temperature, and 30 s of elongation at 72 °C.

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: .. RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. All qRT-PCR samples were run in triplicate and expression was normalized to Gapdh and represented as fold change over relevant control samples.

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad). .. Quantitative PCR was performed in triplicate using 2× SYBR Green PCR Master Mix (Absource Biotools).

Software:

Article Title: Restoring colistin sensitivity in colistin-resistant E. coli: Combinatorial use of MarR inhibitor with efflux pump inhibitor
Article Snippet: Total RNA from the bacterial strains were isolated using Aurum™ total RNA mini kit (Bio Rad). cDNA conversion was done using the iScript™ cDNA synthesis kit (Bio Rad). .. The obtained PCR product was quantified using ImageJ software.

SYBR Green Assay:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). ..

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). .. Gene expression was quantified using iTaq Universal SYBR green super mix using CFX384 Real-Time System (Bio-Rad).

Article Title: Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice
Article Snippet: The cDNA was generated with iScript cDNA Synthesis Kit (Bio-rad) according to manufacturer’s protocol. .. Gene expression was examined by quantitative RT-PCR (qRT-PCR) using IQ™ SYBR Green Supermix.

Article Title: Endophytes alleviate the elevated CO2-dependent decrease in photosynthesis in rice, particularly under nitrogen limitation
Article Snippet: .. The isolated mRNAs were mixed with a master reaction mixture containing fluorescent dyes (iQ SyBR Green Supermix, Bio-Rad Laboratories) prior to cDNA synthesis using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories) and were then loaded into a real-time qPCR thermocycler (Chromo 4 System, Bio-Rad Laboratories). .. The relative gene expression of rbcS was calculated according to .

Article Title: Activation of a Bovine Mammary Epithelial Cell Line by Ruminant-Associated Staphylococcus aureus is Lineage Dependent
Article Snippet: Five hours after removal of bacteria, RNA was extracted directly from monolayers within the 12-well plates using the RNeasy Micro Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions and converted to cDNA using the iSCRIPT cDNA Synthesis Kit (BioRad, Hercules, CA, USA). .. Quantitative real-time PCR (qPCR) Master-mix was prepared as follows: 5 µL Iq Sybr green Master-mix (Biorad), 1 µL of forward and reverse primers each (final concentration 100 nM), 1 µL of demineralized water and 2 µL of 1:20 diluted cDNA.

Article Title: Inflammation and TGF-β Signaling Differ between Abdominal Aneurysms and Occlusive Disease
Article Snippet: .. Total RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, The Netherlands). cDNA samples were subjected to 40 cycles real-time PCR analysis using SYBR Green qPCR Master Mix 2x (Bio-Rad, Veenendaal, The Netherlands) and primers. ..

Article Title: Nedd4 ubiquitylates VDAC2/3 to suppress erastin-induced ferroptosis in melanoma
Article Snippet: RNA extraction, cDNA synthesis, and qPCR analysis Total RNA was isolated with the RNeasy Mini Kit (Qiagen 74104), and 1 µg of total RNA was used for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-rad). .. Quantitative PCRs were carried out using iQ SYBR Green Master Mix (Bio-rad).

Article Title: Deficiency of T cell CD40L has minor beneficial effects on obesity-induced metabolic dysfunction
Article Snippet: All RNA was reverse transcribed to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Lunteren, The Netherlands). .. Quantitative PCR was performed with a SYBR green PCR kit (Applied Biosystems, Waltham) on a ViiA7 real-time PCR system (Applied Biosystems).

Article Title: Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1MET/APR-246
Article Snippet: RNA was then extracted using RNEasy Mini kit (Qiagen), and cDNA was synthesized from 1 µg of RNA using iScript cDNA synthesis kit (Bio-Rad). .. Quantitative PCR was performed in triplicate using 2× SYBR Green PCR Master Mix (Absource Biotools).

Negative Control:

Article Title: IL-36γ Augments Host Defense and Immune Responses in Human Female Reproductive Tract Epithelial Cells
Article Snippet: RNA Extraction and Quantitative Real-Time PCR Analysis RNA was extracted from 3-D endocervical and 3-D vaginal EC using the Qiagen RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA by reverse transcription (iScript cDNA Synthesis Kit, Bio-Rad) and analyzed by qRT-PCR. qRT-PCR was performed with an Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies) using customized primers purchased from IDT (Integrated DNA Technologies, Coralville, IA, USA) and iTAQ Universal SYBR Green Supermix (Bio-Rad). .. Relative transcript levels were determined using a GAPDH housekeeping gene transcript and are reported as fold relative to negative control unless otherwise noted.

RNA Expression:

Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma
Article Snippet: RNA was isolated using the RNeasy Mini Kit (Qiagen) and cDNA was prepared using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) or qScript XLT cDNA SuperMix (Quntabio, Beverly, MA, USA) with 1–2μg of RNA. qRT-PCR was performed using either PerfeCTa mastermix (Quantabio) and the following primers: Kaiso/Zbtb33 – GAACTCCTTGAATGAACAGCGT, CCCAGCAACTGAGAAGAGC (PrimerBank ID 9937986a1), Axin2 – TGCCCACACTAGGCTGACA, TGACTCTCCTTCCAGATCCCA (PrimerBank ID 31982733a1), Pcna – TTTGAGGCACGCCTGATCC, GGAGACGTGAGACGAGTCCAT (PrimerBank ID 7242171a1), Gapdh – CCGCATCTTCTTGTGCA, CGGCCAAATCCGTTCA, or TaqMan Universal PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA) and probes for MTG16 (mouse Cbfa2t3 , Mm00486784_m1; human CBFA2T3 , Hs00602520_m1), Kaiso (human ZBTB33 , Hs00272725_s1) and Gapdh (mouse, Mm99999915_g1; human, Hs02786624_g1). .. For human normal and colorectal cancer RNA expression, Kaiso (ZBTB33 ) and MTG16 (CBFA2T3 ) mRNA expression was queried from Illumina HiSeq and Illumina GA RNASeqV2 data in The Cancer Genome Atlas (TCGA) colon adenocarcinoma (COAD) data set (n = 264 CRC, 39 normal colon).

Knock-Out:

Article Title: Systemic Toxicity Reported for CDK8/19 Inhibitors CCT251921 and MSC2530818 Is Not Due to Target Inhibition
Article Snippet: RNA Extraction, Reverse Transcription and Quantitative Reverse Transcription-PCR (QPCR) To evaluate IC50 values for different CDK8/19 inhibitors, 293 cells (wild-type or with the knockout of CDK8, CDK19 or both CDK8 and CDK19) were seeded in 12-well plates at 3 × 105 cells in 1 mL regular culture media per well, 24 h before treatment. .. Total RNA was extracted using RNAeasy Mini Kit (Qiagen, Germantown, MD, USA) and 1 µg of total RNA was used to generate cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).

Concentration Assay:

Article Title: Activation of a Bovine Mammary Epithelial Cell Line by Ruminant-Associated Staphylococcus aureus is Lineage Dependent
Article Snippet: Five hours after removal of bacteria, RNA was extracted directly from monolayers within the 12-well plates using the RNeasy Micro Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions and converted to cDNA using the iSCRIPT cDNA Synthesis Kit (BioRad, Hercules, CA, USA). .. Quantitative real-time PCR (qPCR) Master-mix was prepared as follows: 5 µL Iq Sybr green Master-mix (Biorad), 1 µL of forward and reverse primers each (final concentration 100 nM), 1 µL of demineralized water and 2 µL of 1:20 diluted cDNA.

Lysis:

Article Title: Pathogenicity island excision during an infection by Salmonella enterica serovar Enteritidis is required for crossing the intestinal epithelial barrier in mice to cause systemic infection
Article Snippet: Homogenized organs were mixed and incubated for 45 min with lysis buffer (Ethanol 19%: Phenol 1%: SDS 0.1%, Merck Millipore) on ice and centrifuged at 8,500 x g for 10 min. .. RNA extraction from bacteria was carried out with TRIzol as described by the manufacturer and reverse transcription was performed using iScript cDNA Synthesis Kit (Biorad) which was prepared according to the manufacturer´s instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Bio-Rad iscript cdna synthesis kit
    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to <t>cDNA</t> using <t>iScript</t> cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.
    Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 3472 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
    Average 90 stars, based on 3472 article reviews
    Price from $9.99 to $1999.99
    iscript cdna synthesis kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Journal: Bio-protocol

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA

    doi: 10.21769/BioProtoc.2717

    Figure Lengend Snippet: RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Article Snippet: Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

    Techniques: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Incubation, Flow Cytometry, Methylation, Nucleic Acid Electrophoresis

    Induction of autophagic genes expression following 4 weeks of nitrite therapy in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of autophagic markers beclin‐1 (A), ATG ‐5 (B), and ATG ‐7 (C). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ATG indicates autophagy related gene; CHF, chronic heart failure.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Induction of autophagic genes expression following 4 weeks of nitrite therapy in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of autophagic markers beclin‐1 (A), ATG ‐5 (B), and ATG ‐7 (C). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ATG indicates autophagy related gene; CHF, chronic heart failure.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Expressing, Mouse Assay, Software

    Effects of nitrite therapy on hypertrophic gene expression in ischemia‐induced CHF mice. Nitrite (100 mg/L) was given in the drinking water during reperfusion. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of ANP (A), BNP (B), and Myh7 (C) using TaqMan PCR assay system. The number inside the bar denotes the number of animals used per experiment. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ANP indicates atrial natriuretic peptide; BNP, brain natriuretic peptide; Myh7, myosin heavy chain beta; PCR, polymerase chain reaction.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Effects of nitrite therapy on hypertrophic gene expression in ischemia‐induced CHF mice. Nitrite (100 mg/L) was given in the drinking water during reperfusion. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of ANP (A), BNP (B), and Myh7 (C) using TaqMan PCR assay system. The number inside the bar denotes the number of animals used per experiment. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ANP indicates atrial natriuretic peptide; BNP, brain natriuretic peptide; Myh7, myosin heavy chain beta; PCR, polymerase chain reaction.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Expressing, Mouse Assay, Aqueous Normal-phase Chromatography, Polymerase Chain Reaction, Software

    Effects of nitrite on cardiac antioxidant gene and protein levels in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of SOD 1 (A), catalase (B), and GPX (C) using TaqMan PCR assay system. (D) represents proteins levels of SOD 1, catalase, and GPX , and (E), (F), and (G) represent the quantitation of the blots in (D). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). CHF indicates chronic heart failure; GPX, glutathione peroxidase; PCR, polymerase chain reaction; SOD1, superoxide dismutase 1.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Effects of nitrite on cardiac antioxidant gene and protein levels in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of SOD 1 (A), catalase (B), and GPX (C) using TaqMan PCR assay system. (D) represents proteins levels of SOD 1, catalase, and GPX , and (E), (F), and (G) represent the quantitation of the blots in (D). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). CHF indicates chronic heart failure; GPX, glutathione peroxidase; PCR, polymerase chain reaction; SOD1, superoxide dismutase 1.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Mouse Assay, Polymerase Chain Reaction, Quantitation Assay, Software

    dsRNA knockdown assays reveal potential histone gene expression regulators. ( A ) Proteins enriched by a dNSAF ratio of 2 and associated with nucleic acids are knocked down by dsRNA over 72 h. cDNA is synthesized with iScript reverse transcriptase with a mixture of poly-A and random hexamer primers. H2A mRNA levels for each knockdown were calculated relative to the nonspecific dsRNA control using Tub84b as a reference gene. Compared with the nonspecific knockdown, CG11844 , vig , and brahma show a negative effect on H2A mRNA expression. ( B ) LisH domain-containing proteins that are enriched in the HisC sample are knocked down by dsRNA as described in A . Compared with the nonspecific knockdown, Smu1 , mahj , and mxc all showed a negative effect on the mRNA expression of H2A. Data plotted are averages and SDs from three separate knockdowns.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: dCas9-targeted locus-specific protein isolation method identifies histone gene regulators

    doi: 10.1073/pnas.1718844115

    Figure Lengend Snippet: dsRNA knockdown assays reveal potential histone gene expression regulators. ( A ) Proteins enriched by a dNSAF ratio of 2 and associated with nucleic acids are knocked down by dsRNA over 72 h. cDNA is synthesized with iScript reverse transcriptase with a mixture of poly-A and random hexamer primers. H2A mRNA levels for each knockdown were calculated relative to the nonspecific dsRNA control using Tub84b as a reference gene. Compared with the nonspecific knockdown, CG11844 , vig , and brahma show a negative effect on H2A mRNA expression. ( B ) LisH domain-containing proteins that are enriched in the HisC sample are knocked down by dsRNA as described in A . Compared with the nonspecific knockdown, Smu1 , mahj , and mxc all showed a negative effect on the mRNA expression of H2A. Data plotted are averages and SDs from three separate knockdowns.

    Article Snippet: Total RNA was extracted and purified using TRIzol reagent (Life Technologies) according to the manufacturer’s protocol. cDNA synthesis was performed with 1 μg of total RNA using the iScript cDNA Synthesis Kit (Bio-Rad) and was diluted 10-fold.

    Techniques: Expressing, Synthesized, Random Hexamer Labeling