Structured Review

Unigene irf8
Western blot analysis of NCoA3 and <t>IRF8</t> proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Irf8, supplied by Unigene, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/irf8/product/Unigene
Average 91 stars, based on 6 article reviews
Price from $9.99 to $1999.99
irf8 - by Bioz Stars, 2020-09
91/100 stars

Images

1) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

2) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

3) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

4) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

5) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

6) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

7) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

8) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

9) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

10) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

11) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

12) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

13) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

14) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

15) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

16) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

17) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

18) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

19) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

20) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

21) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

22) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

23) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

24) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

25) Product Images from "Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency"

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

Journal: Retrovirology

doi: 10.1186/1742-4690-2-73

Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
Figure Legend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

Techniques Used: Western Blot, Expressing, SDS Page, Software

IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.
Figure Legend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

Techniques Used: Activation Assay, Expressing, Luciferase, Activity Assay

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.
Figure Legend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

Techniques Used: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.
Figure Legend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

Related Articles

Dominant Negative Mutation:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. The pIRF8 expression vector (pcDNAmycHis-ICSBP) and dominant negative construct pIRF8-DBD, which contains the DNA binding domain of IRF8, were a kind gift of B.Z. ..

Quantitative RT-PCR:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. Concerning IRF8 , real-time RT-PCR showed a 14.96 ± 4.85 fold decrease in 24 h NaB-treated U1 cells (Figure ) in correlation with the microarray ratio previously obtained. .. Downregulation of IRF8 gene expression is also observed following 48 h NaB-treatment of U1 cells (22.06 ± 11.29 fold decrease) (Figure ).

Microarray:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. Concerning IRF8 , real-time RT-PCR showed a 14.96 ± 4.85 fold decrease in 24 h NaB-treated U1 cells (Figure ) in correlation with the microarray ratio previously obtained. .. Downregulation of IRF8 gene expression is also observed following 48 h NaB-treatment of U1 cells (22.06 ± 11.29 fold decrease) (Figure ).

other:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: The sequences of the primers used were (5' to 3'): NCoA3 forward CTTTGGGCATTCCTGAACTTGTC, NCoA3 reverse GCCTCATCACCGCAGCAC, IRF8 forward GGAGTGCGGTCGCTCTGAAA, IRF8 reverse GTCGTAGGTGGTGTACCCCGTCA, Cyclophilin A forward AGTGGTTGGATGGCAAGC, Cyclophilin A reverse GATTCTAGGATACTGCGAGCAAA.

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: Like ACH-2 and unlike U1 cells, the T CD4+ lymphocytic J1.1 and the promonocytic OM10.1 cell lines did not express IRF8 (data not shown).

Construct:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. The pIRF8 expression vector (pcDNAmycHis-ICSBP) and dominant negative construct pIRF8-DBD, which contains the DNA binding domain of IRF8, were a kind gift of B.Z. ..

Expressing:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. IRF8 is a transcription factor that binds to ISRE and regulates expression of genes stimulated by IFNs (reviewed in [ ]). .. IRF8 is able to both activate and repress gene transcription depending on the target gene.

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. The pIRF8 expression vector (pcDNAmycHis-ICSBP) and dominant negative construct pIRF8-DBD, which contains the DNA binding domain of IRF8, were a kind gift of B.Z. ..

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. We will now investigate the involvement of NCoA3 and IRF8 to regulate viral expression in primary cells such as resting T CD4+ lymphocytes or macrophages. .. Conclusion Additional experiments are currently underway to validate the biological relevance of the differential expression of IRF8 and NCoA3 genes in latency maintenance and reactivation.

Binding Assay:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. The pIRF8 expression vector (pcDNAmycHis-ICSBP) and dominant negative construct pIRF8-DBD, which contains the DNA binding domain of IRF8, were a kind gift of B.Z. ..

Plasmid Preparation:

Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency
Article Snippet: .. The pIRF8 expression vector (pcDNAmycHis-ICSBP) and dominant negative construct pIRF8-DBD, which contains the DNA binding domain of IRF8, were a kind gift of B.Z. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Unigene irf8
    Western blot analysis of NCoA3 and <t>IRF8</t> proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.
    Irf8, supplied by Unigene, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/irf8/product/Unigene
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    irf8 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: Western blot analysis of NCoA3 and IRF8 proteins expression . Nuclear extract (100 μg) from U1, ACH-2, J1.1 and OM10.1 treated (+) or not (-) with NaB for 24 h were resolved by SDS-PAGE and immunoblotted with anti-NCoA3 or anti-IRF8 antibody, as indicated. The amount of protein was normalized using anti-actin antibody. Figures below NCoA3 immunoblot indicated the results of the quantification using Image Tool (Syngene) software of the ratio NCoA3/actin upon NaB-treatment (+) versus NCoA3/actin non-treated (-). Results are representative of three independent experiments.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Western Blot, Expressing, SDS Page, Software

    IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: IRF8 represses the IRF1-mediated activation of the HIV-1 ISRE element . HEK293 cells were cotransfected with pISRE-TK-luc (250 ng, solid bars) or pISREmut-TK-luc (250 ng, white bars) with (+) or without (-) pIRF1 (250 ng), pIRF8 (1–2.5 μg), or pIRF8-DBD (1 μg) expression vectors. NLI (normalized luciferase index) were measured after 24 h and the activation folds compared to the basal activity of the pISRE-TK-luc or pISREmut-TK-luc were determined. Results represent the means of five independent experiments.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Activation Assay, Expressing, Luciferase, Activity Assay

    Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells and the IRF8 decrease fold (B) in U1 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

    Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in NaB-treated U937 and CEM cells . Total RNAs were isolated from U937 or CEM cells treated or not with NaB for 24 h and 48 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U937 (solid bars) or CEM (white bars) cells and the IRF8 decrease fold (B) in U937 cells treated with NaB for 24 h and 48 h compared to non-treated (NT) cells were determined. Results represent the means of five independent experiments performed in duplicate.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

    Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: Real-time RT-PCR analysis of NCoA3 and IRF8 mRNAs expression in PMA- or TSA-treated U1 and ACH-2 cells . Total RNAs were isolated from U1 or ACH-2 cells treated or not with PMA for 24 h and 48 h or TSA for 24 h and real-time PCR were performed on cDNAs using gene specific primers for NCoA3 , IRF8 or Cyclophilin A . NCoA3 and IRF8 expressions were normalized to the expression of Cyclophilin A . The NCoA3 increase fold (A) in U1 (solid bars) or ACH-2 (white bars) cells treated with PMA for 24 h and 48 h and the IRF8 decrease fold (B) in U1 cells treated with PMA or TSA for 24 h compared to non-treated (NT) cells were determined. Results represent the means of three independent experiments performed in duplicate.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Quantitative RT-PCR, Expressing, Isolation, Real-time Polymerase Chain Reaction

    Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

    Journal: Retrovirology

    Article Title: Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency

    doi: 10.1186/1742-4690-2-73

    Figure Lengend Snippet: Analysis of HIV gag , NCoA3 , and IRF8 mRNA expression after NaB stimulation on U1 and ACH-2 cells . U1 (A and B) and ACH-2 (C) cells were stimulated with 10 mM NaB and 5.10 6 cells were taken at t = 0, 4, 8, 16, 24, 48 h for RNA extraction to perform qRT-PCR. NCoA3 (A and C), IRF8 (B) and gag (A, B and C) mRNA contents were measured. Cylophilin A was used as internal standard. Results represent a representative experiment performed in duplicate.

    Article Snippet: These results show that IRF8 represses the ISRE-TK promoter transcription through the ISRE element from the HIV-1 promoter, as expected [ ].

    Techniques: Expressing, RNA Extraction, Quantitative RT-PCR