iq sybr green supermix  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    iQ SYBR Green Supermix
    Description:
    2 5 ml 2 x 1 25 ml 2x qPCR mix contains dNTPs iTaq DNA polymerase MgCl2 SYBR Green I enhancers stabilizers fluorescein for 100 x 50 µl reactions education use only
    Catalog Number:
    1708880EDU
    Price:
    None
    Category:
    PCR Instrumentation
    Buy from Supplier


    Structured Review

    Bio-Rad iq sybr green supermix
    iQ SYBR Green Supermix
    2 5 ml 2 x 1 25 ml 2x qPCR mix contains dNTPs iTaq DNA polymerase MgCl2 SYBR Green I enhancers stabilizers fluorescein for 100 x 50 µl reactions education use only
    https://www.bioz.com/result/iq sybr green supermix/product/Bio-Rad
    Average 99 stars, based on 9463 article reviews
    Price from $9.99 to $1999.99
    iq sybr green supermix - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Effect of small interfering RNAs on matrix metalloproteinase 1 expression"

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression

    Journal: Biotechnology Reports

    doi: 10.1016/j.btre.2014.07.003

    Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).
    Figure Legend Snippet: Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

    Techniques Used: Real-time Polymerase Chain Reaction, Concentration Assay, Incubation, Synthesized, Expressing, SYBR Green Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    2) Product Images from "Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation"

    Article Title: Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation

    Journal: Diabetes

    doi: 10.2337/db10-1262

    Diabetes decreases Klotho protein and message in db/db mice. Kidney cortex from eight control mice and eight db/db mice were lysed in radioimmunoprecipitation assay buffer for protein or in trizol reagent for RNA extraction. A : Representative Western blots probed with anti-Klotho antibody ( upper panel ) and normalized to β-actin as loading controls ( lower panel ). B : Immunoblotted Klotho and respective β-actin bands from eight mice were quantified using a Licor Image Analyzer and normalized to β-actin. Data are means ± SD of normalized arbitrary scan values. C : A decline in Klotho transcript, as measured by semiquantitative real-time PCR, is shown. Relative quantification of Klotho mRNA was performed using a MyiQ Single-Color Real-Time PCR Detection System and iQ SYBR Green Supermix, according to the manufacturer’s instructions. Data were analyzed using the Δ C T method in reference to GAPDH. n = 8 controls; n = 8 db/db mice. Significantly different from controls by Student t test: * P
    Figure Legend Snippet: Diabetes decreases Klotho protein and message in db/db mice. Kidney cortex from eight control mice and eight db/db mice were lysed in radioimmunoprecipitation assay buffer for protein or in trizol reagent for RNA extraction. A : Representative Western blots probed with anti-Klotho antibody ( upper panel ) and normalized to β-actin as loading controls ( lower panel ). B : Immunoblotted Klotho and respective β-actin bands from eight mice were quantified using a Licor Image Analyzer and normalized to β-actin. Data are means ± SD of normalized arbitrary scan values. C : A decline in Klotho transcript, as measured by semiquantitative real-time PCR, is shown. Relative quantification of Klotho mRNA was performed using a MyiQ Single-Color Real-Time PCR Detection System and iQ SYBR Green Supermix, according to the manufacturer’s instructions. Data were analyzed using the Δ C T method in reference to GAPDH. n = 8 controls; n = 8 db/db mice. Significantly different from controls by Student t test: * P

    Techniques Used: Mouse Assay, Radio Immunoprecipitation, RNA Extraction, Western Blot, Real-time Polymerase Chain Reaction, SYBR Green Assay

    3) Product Images from "Development and validation of a quantitative real-time polymerase chain assay for universal detection of the White Spot Syndrome Virus in marine crustaceans"

    Article Title: Development and validation of a quantitative real-time polymerase chain assay for universal detection of the White Spot Syndrome Virus in marine crustaceans

    Journal: Virology Journal

    doi: 10.1186/1743-422X-10-186

    Performance comparison of two different commercial kits for WSSV detection by qPCR. The solid line represents iQ SYBR® Green supermix (Biorad) amplification, whereas the dashed line represents amplification using GoTaq qPCR Master mix (Promega). No differences were detected.
    Figure Legend Snippet: Performance comparison of two different commercial kits for WSSV detection by qPCR. The solid line represents iQ SYBR® Green supermix (Biorad) amplification, whereas the dashed line represents amplification using GoTaq qPCR Master mix (Promega). No differences were detected.

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Amplification

    4) Product Images from "Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)"

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0088409

    qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .
    Figure Legend Snippet: qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Nucleic Acid Electrophoresis, Amplification, Agarose Gel Electrophoresis, Isolation

    5) Product Images from "Transcriptomic and proteomic analyses of the Aspergillus fumigatus hypoxia response using an oxygen-controlled fermenter"

    Article Title: Transcriptomic and proteomic analyses of the Aspergillus fumigatus hypoxia response using an oxygen-controlled fermenter

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-13-62

    RT-PCR of novel transcripts affected by hypoxia . A. Four transcripts (Afu3g14170 ( hxtA ), Afu2g09590 ( udpA ), Afu3g11590 ( atg11 ), Afu5g00900 ( rgsA )) that were significantly increased using real time RT-PCR. B. Three transcripts (Afu5g12510 ( afeA ), Afu6g05160 ( azf1 ), Afu1g03210 ( flbD )), that were significantly decreased using real time RT-PCR. All reactions were performed on BioRad MyIQ real-time PCR detection system with IQ SYBR green supermix. The ΔΔC t method was used to combine three biological and 2 technical replicates for each transcript, using β-tubulin as the housekeeping gene for comparison.
    Figure Legend Snippet: RT-PCR of novel transcripts affected by hypoxia . A. Four transcripts (Afu3g14170 ( hxtA ), Afu2g09590 ( udpA ), Afu3g11590 ( atg11 ), Afu5g00900 ( rgsA )) that were significantly increased using real time RT-PCR. B. Three transcripts (Afu5g12510 ( afeA ), Afu6g05160 ( azf1 ), Afu1g03210 ( flbD )), that were significantly decreased using real time RT-PCR. All reactions were performed on BioRad MyIQ real-time PCR detection system with IQ SYBR green supermix. The ΔΔC t method was used to combine three biological and 2 technical replicates for each transcript, using β-tubulin as the housekeeping gene for comparison.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Hypoxia affects transcript levels of enzymes involved in glycolysis consistent with fermentation and cell wall components . A. KEGG pathway heat map representation of genes involved in glycolysis. Microarray datasets include three biological and two technical replicates. Microarrays compare wild type Aspergillus fumigatus strain CBS144.89 at the indicated times after exposure to hypoxic conditions to the time point immediately prior to hypoxia exposure (0 hours) using the median value from all replicates. Yellow indicates transcript level is higher in hypoxia. Scale indicates degree of change. B. RT-PCR of Glyceraldehyde-3-phosphate-dehydrogenase supported the observation that this was one of the most abundant hypoxia responsive transcripts in the microarray, as well as in the proteomics analysis. C. Six genes in the glycolysis pathway in Aspergillus fumigatus . Transcript levels of 6-phosophofructokinase, hexokinase A and pyruvate kinase were not dramatically altered. Transcript levels of phosphoglycerate kinase and glucokinase A are 2 to 4-fold increased in response to hypoxia. Aldehyde dehydrogense A transcript level was significantly decreased at 6, 12 and 24 hours. All RT-PCRs were performed on BioRad MyIQ real-time PCR detection system with IQ SYBR green supermix. The ΔΔC t method was used to combine all biological and technical replicates for each transcript, using β-tubulin as the housekeeping gene for comparison. D. Heat map representation of cell wall component transcripts that were compiled from literature [ 36 ]. Both microarray datasets include three biological and two technical replicates, and compare wild type Aspergillus fumigatus strain CBS144.89 at the indicated times after exposure to hypoxic conditions to the time point immediately prior to hypoxia exposure (0 hours) using the median value from all replicates. Yellow indicates transcript level is higher in hypoxia.
    Figure Legend Snippet: Hypoxia affects transcript levels of enzymes involved in glycolysis consistent with fermentation and cell wall components . A. KEGG pathway heat map representation of genes involved in glycolysis. Microarray datasets include three biological and two technical replicates. Microarrays compare wild type Aspergillus fumigatus strain CBS144.89 at the indicated times after exposure to hypoxic conditions to the time point immediately prior to hypoxia exposure (0 hours) using the median value from all replicates. Yellow indicates transcript level is higher in hypoxia. Scale indicates degree of change. B. RT-PCR of Glyceraldehyde-3-phosphate-dehydrogenase supported the observation that this was one of the most abundant hypoxia responsive transcripts in the microarray, as well as in the proteomics analysis. C. Six genes in the glycolysis pathway in Aspergillus fumigatus . Transcript levels of 6-phosophofructokinase, hexokinase A and pyruvate kinase were not dramatically altered. Transcript levels of phosphoglycerate kinase and glucokinase A are 2 to 4-fold increased in response to hypoxia. Aldehyde dehydrogense A transcript level was significantly decreased at 6, 12 and 24 hours. All RT-PCRs were performed on BioRad MyIQ real-time PCR detection system with IQ SYBR green supermix. The ΔΔC t method was used to combine all biological and technical replicates for each transcript, using β-tubulin as the housekeeping gene for comparison. D. Heat map representation of cell wall component transcripts that were compiled from literature [ 36 ]. Both microarray datasets include three biological and two technical replicates, and compare wild type Aspergillus fumigatus strain CBS144.89 at the indicated times after exposure to hypoxic conditions to the time point immediately prior to hypoxia exposure (0 hours) using the median value from all replicates. Yellow indicates transcript level is higher in hypoxia.

    Techniques Used: Microarray, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, SYBR Green Assay

    6) Product Images from "Altered Retinoic Acid Metabolism in Diabetic Mouse Kidney Identified by 18O Isotopic Labeling and 2D Mass Spectrometry"

    Article Title: Altered Retinoic Acid Metabolism in Diabetic Mouse Kidney Identified by 18O Isotopic Labeling and 2D Mass Spectrometry

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0011095

    Real time-PCR of retinoid binding proteins and atRA-related nuclear receptors. Relative quantification of select mRNA was performed using a MyiQ Single-Color Real-Time PCR Detection System and iQ SYBR Green Supermix according to the manufacturer's instructions. All primers were purchased from SABiosciences, Inc. Data were analyzed using the ΔCT method in reference to cyclophillin or GAPDH. Controls, n = 7; db/db , n = 6. Significantly different from controls by Student's t-test: * p
    Figure Legend Snippet: Real time-PCR of retinoid binding proteins and atRA-related nuclear receptors. Relative quantification of select mRNA was performed using a MyiQ Single-Color Real-Time PCR Detection System and iQ SYBR Green Supermix according to the manufacturer's instructions. All primers were purchased from SABiosciences, Inc. Data were analyzed using the ΔCT method in reference to cyclophillin or GAPDH. Controls, n = 7; db/db , n = 6. Significantly different from controls by Student's t-test: * p

    Techniques Used: Real-time Polymerase Chain Reaction, Binding Assay, SYBR Green Assay

    7) Product Images from "Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)"

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0088409

    qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .
    Figure Legend Snippet: qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Nucleic Acid Electrophoresis, Amplification, Agarose Gel Electrophoresis, Isolation

    8) Product Images from "Embryonic Expression and Function of the Xenopus Ink4d Cyclin D-Dependent Kinase Inhibitor"

    Article Title: Embryonic Expression and Function of the Xenopus Ink4d Cyclin D-Dependent Kinase Inhibitor

    Journal: Cell & developmental biology

    doi: 10.4172/2168-9296.1000133

    Expression of Xl -Ink4d during Xenopus laevis development. Embryos were staged according Xenopus laevis normal tables of development [ 27 ] and RNA was harvested at the indicated stages. (a) Reverse transcription PCR was performed on total RNA from staged embryos to amplify Xl-Ink4d1 , cyclin-D1 , Cdk4 and ODC transcripts. Trace [α 32 P]-dCTP was added to the reactions and the PCR products were separated by gel electrophoresis. (b) Relative quantitative real-time PCR analysis of Xl-Ink4d1 mRNA levels was performed using iQ SYBR Green Supermix (Bio-Rad), run and detected using an iCycler thermocycler (Bio-Rad). (c) In situ hybridization (ISH) for Xl-Ink4d1 expression during early embryonic development. Xl-Ink4d1 expression is detected at low levels in the dorsal anterior region of the developing tadpole. Stage 19 (i–iii); (i) dorsal view, (ii) anterior view, (iii) posterior view. Stage 22 (iv–vi); (iv) lateral view, (v) dorsal view, (vi) anterior view. Stage 32 (vii), trunk somites (S), eye (E) and head (H). (d) Immunoblotting of Xl- Ink4d from whole embryo lysates at the indicated stages using a polyclonal antibody directed against the C -terminus of the protein. Embryos microinjected with synthesized Xl-Ink4d1 mRNA were harvested and run as a positive control (+).
    Figure Legend Snippet: Expression of Xl -Ink4d during Xenopus laevis development. Embryos were staged according Xenopus laevis normal tables of development [ 27 ] and RNA was harvested at the indicated stages. (a) Reverse transcription PCR was performed on total RNA from staged embryos to amplify Xl-Ink4d1 , cyclin-D1 , Cdk4 and ODC transcripts. Trace [α 32 P]-dCTP was added to the reactions and the PCR products were separated by gel electrophoresis. (b) Relative quantitative real-time PCR analysis of Xl-Ink4d1 mRNA levels was performed using iQ SYBR Green Supermix (Bio-Rad), run and detected using an iCycler thermocycler (Bio-Rad). (c) In situ hybridization (ISH) for Xl-Ink4d1 expression during early embryonic development. Xl-Ink4d1 expression is detected at low levels in the dorsal anterior region of the developing tadpole. Stage 19 (i–iii); (i) dorsal view, (ii) anterior view, (iii) posterior view. Stage 22 (iv–vi); (iv) lateral view, (v) dorsal view, (vi) anterior view. Stage 32 (vii), trunk somites (S), eye (E) and head (H). (d) Immunoblotting of Xl- Ink4d from whole embryo lysates at the indicated stages using a polyclonal antibody directed against the C -terminus of the protein. Embryos microinjected with synthesized Xl-Ink4d1 mRNA were harvested and run as a positive control (+).

    Techniques Used: Expressing, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Real-time Polymerase Chain Reaction, SYBR Green Assay, In Situ Hybridization, Synthesized, Positive Control

    9) Product Images from "α1-Microglobulin Binds Illuminated Flavins and Has a Protective Effect Against Sublethal Riboflavin-Induced Damage in Retinal Epithelial Cells"

    Article Title: α1-Microglobulin Binds Illuminated Flavins and Has a Protective Effect Against Sublethal Riboflavin-Induced Damage in Retinal Epithelial Cells

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2020.00295

    The effects of illuminated riboflavin and A1M on the relative mRNA levels of (A) p21 and (B) HMOX1 in ARPE19 cells. The cells were treated with riboflavin with or without A1M and illuminated with a fluorescent lamp (1200 lumen) at a distance of 0.2 m. The mRNA expression was measured with iQ SYBR Green Supermix (Bio-Rad). Primers were obtained from Eurofins Scientific. Raw data were obtained as Ct-values, which were normalized to the Ct-values of the house-keeping gene GAPDH (= ΔCt). The expression is relative to the control samples (= ΔΔ Ct ) and is shown as fold change (2 –ΔΔ Ct ). Statistical comparisons between samples were performed with one-way ANOVA with Sidak multiple comparison test. * p
    Figure Legend Snippet: The effects of illuminated riboflavin and A1M on the relative mRNA levels of (A) p21 and (B) HMOX1 in ARPE19 cells. The cells were treated with riboflavin with or without A1M and illuminated with a fluorescent lamp (1200 lumen) at a distance of 0.2 m. The mRNA expression was measured with iQ SYBR Green Supermix (Bio-Rad). Primers were obtained from Eurofins Scientific. Raw data were obtained as Ct-values, which were normalized to the Ct-values of the house-keeping gene GAPDH (= ΔCt). The expression is relative to the control samples (= ΔΔ Ct ) and is shown as fold change (2 –ΔΔ Ct ). Statistical comparisons between samples were performed with one-way ANOVA with Sidak multiple comparison test. * p

    Techniques Used: Expressing, SYBR Green Assay

    Related Articles

    SYBR Green Assay:

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ]. .. QRT-PCR primers were designed by using Primer Express v2.0 software (Applied Biosystems, Foster City, CA, USA).

    Article Title: Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation
    Article Snippet: .. A total of 2 µL cDNA products were amplified in a 20-µL reaction system containing 10 µL iQ SYBR Green Supermix (Bio-Rad) and 400 nmol/L primer mixture. ..

    Article Title: The Use of Nanotrap Particles Technology in Capturing HIV-1 Virions and Viral Proteins from Infected Cells
    Article Snippet: .. PCR reaction mixtures were prepared using 2 µl of undiluted, 10−1 or 10−2 diluted cDNA, 300 nm of each primer: Gag1483-F ( 5′-AAGGGGAAGTGACATAGCAG-3′ ) and Gag1625-R: ( 5′-GCTGGTAGGGCTATACATTCTTAC-3′ ), and the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA), to amplify 143 nt fragments of HIV-1 gag gene. ..

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Article Title: Expression Analysis of the T-Cell-Targeting Chemokines CXCL9 and CXCL10 in Mice and Humans with Endothelial Infections Caused by Rickettsiae of the Spotted Fever Group
    Article Snippet: .. The primers used for real-time PCR with SYBRgreen (IQ SYBR green supermix; Bio-Rad, Hercules, CA) are presented in Table 1 . .. Optimal magnesium concentrations obtaining efficiencies close to 100% were determined experimentally.

    Amplification:

    Article Title: Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation
    Article Snippet: .. A total of 2 µL cDNA products were amplified in a 20-µL reaction system containing 10 µL iQ SYBR Green Supermix (Bio-Rad) and 400 nmol/L primer mixture. ..

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Synthesized:

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Mutagenesis:

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Quantitative RT-PCR:

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ]. .. QRT-PCR primers were designed by using Primer Express v2.0 software (Applied Biosystems, Foster City, CA, USA).

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Real-time Polymerase Chain Reaction:

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Article Title: Expression Analysis of the T-Cell-Targeting Chemokines CXCL9 and CXCL10 in Mice and Humans with Endothelial Infections Caused by Rickettsiae of the Spotted Fever Group
    Article Snippet: .. The primers used for real-time PCR with SYBRgreen (IQ SYBR green supermix; Bio-Rad, Hercules, CA) are presented in Table 1 . .. Optimal magnesium concentrations obtaining efficiencies close to 100% were determined experimentally.

    Expressing:

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Polymerase Chain Reaction:

    Article Title: The Use of Nanotrap Particles Technology in Capturing HIV-1 Virions and Viral Proteins from Infected Cells
    Article Snippet: .. PCR reaction mixtures were prepared using 2 µl of undiluted, 10−1 or 10−2 diluted cDNA, 300 nm of each primer: Gag1483-F ( 5′-AAGGGGAAGTGACATAGCAG-3′ ) and Gag1625-R: ( 5′-GCTGGTAGGGCTATACATTCTTAC-3′ ), and the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA), to amplify 143 nt fragments of HIV-1 gag gene. ..

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Produced:

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Plasmid Preparation:

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad iq sybr green super mix
    ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of <t>B6,</t> CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ <t>SYBR®</t> green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.
    Iq Sybr Green Super Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 10231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iq sybr green super mix/product/Bio-Rad
    Average 99 stars, based on 10231 article reviews
    Price from $9.99 to $1999.99
    iq sybr green super mix - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.

    Journal: Nucleic Acids Research

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans

    doi: 10.1093/nar/gki705

    Figure Lengend Snippet: ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.

    Article Snippet: Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Mutagenesis, Diagnostic Assay, Quantitative RT-PCR, Amplification, SYBR Green Assay

    ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P

    Journal: Nutrition & Metabolism

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo

    doi: 10.1186/1743-7075-11-54

    Figure Lengend Snippet: ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P

    Article Snippet: Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight

    Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

    Journal: Biotechnology Reports

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression

    doi: 10.1016/j.btre.2014.07.003

    Figure Lengend Snippet: Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

    Article Snippet: For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared.

    Techniques: Real-time Polymerase Chain Reaction, Concentration Assay, Incubation, Synthesized, Expressing, SYBR Green Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Relative mRNA levels of EDNs and EDNRs in E18 chicken retina, primary chicken Müller cells and the human MIO-M1 Müller cell line. qRT-PCR analysis of mRNA levels. Bar graphs showing the relative mRNA levels normalized to ß-actin for (A) EDNRA, EDNRB, EDNRB2 and SOX2, and for (B) EDN1, EDN2, EDN3 in chicken E18 retina (Chicken retina), primary chicken Müller cells (Chicken Müller cell) and the human MIO-M1 Müller cell line. Note that EDNRB2 is not found in human. For the MIO-M1 cells the relative mRNA levels of EDNRA and EDNRB are shown. Sox2 is included as an expression reference for the chicken cells. Bar graphs are mean ± SEM, n = 5 (*P

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Relative mRNA levels of EDNs and EDNRs in E18 chicken retina, primary chicken Müller cells and the human MIO-M1 Müller cell line. qRT-PCR analysis of mRNA levels. Bar graphs showing the relative mRNA levels normalized to ß-actin for (A) EDNRA, EDNRB, EDNRB2 and SOX2, and for (B) EDN1, EDN2, EDN3 in chicken E18 retina (Chicken retina), primary chicken Müller cells (Chicken Müller cell) and the human MIO-M1 Müller cell line. Note that EDNRB2 is not found in human. For the MIO-M1 cells the relative mRNA levels of EDNRA and EDNRB are shown. Sox2 is included as an expression reference for the chicken cells. Bar graphs are mean ± SEM, n = 5 (*P

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Quantitative RT-PCR, Expressing

    Expression of HB-EGF in chicken Müller cells and in human MIO-M1 cell line. QRT-PCR analysis of heparin binding epidermal growth factor (HB-EGF), transcription factor SOX2 and cellular retinaldehyde-binding protein (CRALBP) mRNA levels in primary chicken Müller cell and in human MIO-M1 cell cultures. SOX2 and CRALBP were included as expression references known to be expressed in Müller cells. Bar graph showing the relative mRNA levels in relation to β-actin mRNA levels. Bar graph is mean ±SEM, n > 5.

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Expression of HB-EGF in chicken Müller cells and in human MIO-M1 cell line. QRT-PCR analysis of heparin binding epidermal growth factor (HB-EGF), transcription factor SOX2 and cellular retinaldehyde-binding protein (CRALBP) mRNA levels in primary chicken Müller cell and in human MIO-M1 cell cultures. SOX2 and CRALBP were included as expression references known to be expressed in Müller cells. Bar graph showing the relative mRNA levels in relation to β-actin mRNA levels. Bar graph is mean ±SEM, n > 5.

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Expressing, Quantitative RT-PCR, Binding Assay

    Endothelins and their receptors in retina after excitotoxic injury. (A) Schematic tree depicting orthologs and paralogs of the endothelin receptors (EDNRs) in Aves and Mammalia. EDNR2B has only been found in non-mammalian species. The tree is based on Ensembl Gene tree ID: ENSGT00760000119177. (B) Interactions between the endothelins (EDNs), the EDNRB agonist IRL1620 and the EDNRs. (C) Experimental outline. QRT-PCR analysis of (D) EDNRA, EDNRB, EDNRB2 and (E) EDN1, EDN2 and EDN3 mRNA levels in NMDA- or vehicle- (Control) treated eyes. Bar graphs show the relative mRNA levels normalized to ß-actin. Bar graphs are mean ± SEM, n = 6 (control 2 h), n = 5 (NMDA 2 h), n = 6 (control 12 h), n = 5 (NMDA 12 h), n = 6 (control 24 h), n = 6 (NMDA 24 h, (*P

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Endothelins and their receptors in retina after excitotoxic injury. (A) Schematic tree depicting orthologs and paralogs of the endothelin receptors (EDNRs) in Aves and Mammalia. EDNR2B has only been found in non-mammalian species. The tree is based on Ensembl Gene tree ID: ENSGT00760000119177. (B) Interactions between the endothelins (EDNs), the EDNRB agonist IRL1620 and the EDNRs. (C) Experimental outline. QRT-PCR analysis of (D) EDNRA, EDNRB, EDNRB2 and (E) EDN1, EDN2 and EDN3 mRNA levels in NMDA- or vehicle- (Control) treated eyes. Bar graphs show the relative mRNA levels normalized to ß-actin. Bar graphs are mean ± SEM, n = 6 (control 2 h), n = 5 (NMDA 2 h), n = 6 (control 12 h), n = 5 (NMDA 12 h), n = 6 (control 24 h), n = 6 (NMDA 24 h, (*P

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Quantitative RT-PCR