in vitro rna transcription  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher in vitro rna transcription
    caIKKβ-DCs induce NK cells to secrete pro-inflammatory cytokines. Cytokine-matured dendritic cells (DCs) were either electroporated with <t>RNA</t> encoding caIKKβ or as a control were mock electroporated. (a) Transfected DCs were co-cultured 2–4 h after <t>electroporation</t> with fresh autologous peripheral blood mononuclear cells (PBMCs) at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml). As controls, PBMCs and DCs were cultured alone. Secretion of IL-12p70, TNFα, and IFNγ was measured in the supernatant by Cytometric Bead Array after 24 h and 48 h of co-incubation. Average cytokine concentrations with SEM are shown from 7 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S3 . (b) Transfected DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) or 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml). As controls, NK cells and DCs were cultured alone. Cytokine secretion was measured as described in (a). Average cytokine concentrations are shown from 5 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S4 . p values were calculated to the respective mock condition with the paired Student’s t test, **** p ⩽ 0.0001, *** p ⩽ 0.001, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1.
    In Vitro Rna Transcription, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in vitro rna transcription/product/Thermo Fisher
    Average 99 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    in vitro rna transcription - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells"

    Article Title: NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells

    Journal: Therapeutic Advances in Medical Oncology

    doi: 10.1177/1758835919891622

    caIKKβ-DCs induce NK cells to secrete pro-inflammatory cytokines. Cytokine-matured dendritic cells (DCs) were either electroporated with RNA encoding caIKKβ or as a control were mock electroporated. (a) Transfected DCs were co-cultured 2–4 h after electroporation with fresh autologous peripheral blood mononuclear cells (PBMCs) at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml). As controls, PBMCs and DCs were cultured alone. Secretion of IL-12p70, TNFα, and IFNγ was measured in the supernatant by Cytometric Bead Array after 24 h and 48 h of co-incubation. Average cytokine concentrations with SEM are shown from 7 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S3 . (b) Transfected DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) or 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml). As controls, NK cells and DCs were cultured alone. Cytokine secretion was measured as described in (a). Average cytokine concentrations are shown from 5 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S4 . p values were calculated to the respective mock condition with the paired Student’s t test, **** p ⩽ 0.0001, *** p ⩽ 0.001, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1.
    Figure Legend Snippet: caIKKβ-DCs induce NK cells to secrete pro-inflammatory cytokines. Cytokine-matured dendritic cells (DCs) were either electroporated with RNA encoding caIKKβ or as a control were mock electroporated. (a) Transfected DCs were co-cultured 2–4 h after electroporation with fresh autologous peripheral blood mononuclear cells (PBMCs) at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml). As controls, PBMCs and DCs were cultured alone. Secretion of IL-12p70, TNFα, and IFNγ was measured in the supernatant by Cytometric Bead Array after 24 h and 48 h of co-incubation. Average cytokine concentrations with SEM are shown from 7 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S3 . (b) Transfected DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) or 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml). As controls, NK cells and DCs were cultured alone. Cytokine secretion was measured as described in (a). Average cytokine concentrations are shown from 5 (24 h) or 4 (48 h) different donors; for original data see Supplemental Table S4 . p values were calculated to the respective mock condition with the paired Student’s t test, **** p ⩽ 0.0001, *** p ⩽ 0.001, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1.

    Techniques Used: Transfection, Cell Culture, Electroporation, Incubation

    Stimulation of peripheral blood mononuclear cells (PBMCs) with caIKKβ-DCs leads to activation of both NK cells and CD8 + T cells. Cytokine-matured dendritic cells (DCs) were electroporated either with caIKKβ-RNA or, as a control, were mock electroporated. Transfected DCs were then either loaded with a CD8 + T-cell epitope from the melanoma antigen MelanA (MelA pept) or were left untreated (no pept). These DCs were co-cultured with fresh autologous PMBCs at a ratio of 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMC/ml) and incubated for 1 week. (a) MelanA-specific CD8 + T cells were measured by peptide-HLA-tetramer staining. To identify CD8 + T cells the gating strategy shown in Supplemental Figure S8A – E was used. The percentage of MelanA-specific CD8 + T cells out of all CD8 + T cells was calculated. Dot plots from a representative donor out of four individual donors is shown; for all original data, see Supplemental Table S7 . (b) The expression of CD69 on NK cells (using the gating strategy shown in Supplemental Figure S8A – D to identify NK cells) was determined for each condition via flow cytometry. The average MFI of four different donors with the SEM is shown; for original data, see Supplemental Table S8 . p values were calculated to the respective mock condition with paired Student’s t test. ** p ⩽ 0.01, * p ⩽ 0.05.
    Figure Legend Snippet: Stimulation of peripheral blood mononuclear cells (PBMCs) with caIKKβ-DCs leads to activation of both NK cells and CD8 + T cells. Cytokine-matured dendritic cells (DCs) were electroporated either with caIKKβ-RNA or, as a control, were mock electroporated. Transfected DCs were then either loaded with a CD8 + T-cell epitope from the melanoma antigen MelanA (MelA pept) or were left untreated (no pept). These DCs were co-cultured with fresh autologous PMBCs at a ratio of 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMC/ml) and incubated for 1 week. (a) MelanA-specific CD8 + T cells were measured by peptide-HLA-tetramer staining. To identify CD8 + T cells the gating strategy shown in Supplemental Figure S8A – E was used. The percentage of MelanA-specific CD8 + T cells out of all CD8 + T cells was calculated. Dot plots from a representative donor out of four individual donors is shown; for all original data, see Supplemental Table S7 . (b) The expression of CD69 on NK cells (using the gating strategy shown in Supplemental Figure S8A – D to identify NK cells) was determined for each condition via flow cytometry. The average MFI of four different donors with the SEM is shown; for original data, see Supplemental Table S8 . p values were calculated to the respective mock condition with paired Student’s t test. ** p ⩽ 0.01, * p ⩽ 0.05.

    Techniques Used: Activation Assay, Transfection, Cell Culture, Incubation, Staining, Expressing, Flow Cytometry, Cytometry

    Cell–cell interaction is necessary for best NK-cell activation by caIKKβ-DCs. (a) Cytokine-matured dendritic cells (DCs) were electroporated with caIKKβ-RNA or, as a negative control, were mock electroporated. A transwell assay was carried out, to analyze whether cell–cell interaction between DCs and NK cells was required, using a membrane allowing transfer of soluble factors while separating cell populations, 2–4 h after electroporation. DCs and fresh autologous peripheral blood mononuclear cells (PBMCs) were either completely separated through a 0.4 µm pore sized membrane (I = mock DCs, II = caIKKβ-DCs) or were co-cultured in the lower compartment (III.2) and separated from further PBMCs in the upper (III.1). Each condition was incubated for 48 h. (b) Surface marker expressions (CD54, CD69, and CD25) on NK cells (using the gating strategy shown in Supplemental Figure S2 ) were determined for each condition as described in (a) by flow cytometry. Average values of 4 (I) or 5 (II and III) different donors with SEM are shown; for original data, see Supplemental Table S5 . (c) The concentrations of IL-12p70, TNFα, and IFNγ in the supernatants from each condition were measured by Cytometric Bead Array. Average values of 4 (I) or 5 (II and III) different donors with SEM are shown; for original data, see Supplemental Table S6 . All donors were analyzed in independent experiments. p values were evaluated using paired Student’s t test, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1 in (b) and (c).
    Figure Legend Snippet: Cell–cell interaction is necessary for best NK-cell activation by caIKKβ-DCs. (a) Cytokine-matured dendritic cells (DCs) were electroporated with caIKKβ-RNA or, as a negative control, were mock electroporated. A transwell assay was carried out, to analyze whether cell–cell interaction between DCs and NK cells was required, using a membrane allowing transfer of soluble factors while separating cell populations, 2–4 h after electroporation. DCs and fresh autologous peripheral blood mononuclear cells (PBMCs) were either completely separated through a 0.4 µm pore sized membrane (I = mock DCs, II = caIKKβ-DCs) or were co-cultured in the lower compartment (III.2) and separated from further PBMCs in the upper (III.1). Each condition was incubated for 48 h. (b) Surface marker expressions (CD54, CD69, and CD25) on NK cells (using the gating strategy shown in Supplemental Figure S2 ) were determined for each condition as described in (a) by flow cytometry. Average values of 4 (I) or 5 (II and III) different donors with SEM are shown; for original data, see Supplemental Table S5 . (c) The concentrations of IL-12p70, TNFα, and IFNγ in the supernatants from each condition were measured by Cytometric Bead Array. Average values of 4 (I) or 5 (II and III) different donors with SEM are shown; for original data, see Supplemental Table S6 . All donors were analyzed in independent experiments. p values were evaluated using paired Student’s t test, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1 in (b) and (c).

    Techniques Used: Activation Assay, Negative Control, Transwell Assay, Electroporation, Cell Culture, Incubation, Marker, Flow Cytometry, Cytometry

    NK cells stimulated with caIKKβ-DCs can kill K562 cells. Cytokine-matured DCs were electroporated either with caIKKβ-RNA or, as a control, were mock electroporated. (a) Transfected dendritic cells (DCs) were co-cultured with fresh autologous peripheral blood mononuclear cells (PBMCs) at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml) and incubated for 1 week. The cytolytic capacity of the resulting cell population was determined in a 51 chromium release assay. The K562 cell line was used as target at the indicated effector to target ratios. Average values ± SEM of three independent donors, each analyzed in triplicates, are shown; for original data see Supplemental Table S9 . (b) Transfected DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) and 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml) and incubated for 1 week. The lytic capacity of the resulting NK cells was determined as depicted in (a). Average values ± SEM of three independent donors, each analyzed in triplicates, are shown; for original data, see Supplemental Table S10 . p values were calculated to the respective mock condition using the paired Student’s t test, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1.
    Figure Legend Snippet: NK cells stimulated with caIKKβ-DCs can kill K562 cells. Cytokine-matured DCs were electroporated either with caIKKβ-RNA or, as a control, were mock electroporated. (a) Transfected dendritic cells (DCs) were co-cultured with fresh autologous peripheral blood mononuclear cells (PBMCs) at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml) and incubated for 1 week. The cytolytic capacity of the resulting cell population was determined in a 51 chromium release assay. The K562 cell line was used as target at the indicated effector to target ratios. Average values ± SEM of three independent donors, each analyzed in triplicates, are shown; for original data see Supplemental Table S9 . (b) Transfected DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) and 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml) and incubated for 1 week. The lytic capacity of the resulting NK cells was determined as depicted in (a). Average values ± SEM of three independent donors, each analyzed in triplicates, are shown; for original data, see Supplemental Table S10 . p values were calculated to the respective mock condition using the paired Student’s t test, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p values of 0.05 ⩽ p ⩽ 0.1.

    Techniques Used: Transfection, Cell Culture, Incubation, Release Assay

    Stimulation with caIKKβ-transfected mature dendritic cells (DCs) results in the upregulation of activation markers on NK cells. Cytokine-matured DCs were electroporated either with caIKKβ-RNA or as a control were mock electroporated. (a) Transfected DCs were co-cultured with fresh autologous peripheral blood mononuclear cells (PBMCs) 2–4 h after electroporation at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml). To determine background levels, PBMCs were cultured alone. Cells were harvested after 24 h or 48 h and the expression of the surface markers CD54, CD69, and CD25 was determined via flow cytometry (using the gating strategy shown in Supplemental Figure S2 ). All values show the upregulation of each surface marker, calculated relative to the mean fluorescence intensity (MFI) of PBMCs alone. The average fold induction of four different donors with the SEM is shown; for original data, see Supplemental Table S1 . Each donor was analyzed in independent experiments. (b) DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) or 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml). To determine background levels, NK cells were cultured alone. Cells were analyzed as described in (a). Average fold induction (relative to MFI of NK cells alone) is shown from four different donors with SEM; for original data see Supplemental Table S2 . p values were calculated to the respective mock condition with the paired Student’s t test using the specific MFI values, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p value of 0.05 ⩽ p ⩽ 0.1.
    Figure Legend Snippet: Stimulation with caIKKβ-transfected mature dendritic cells (DCs) results in the upregulation of activation markers on NK cells. Cytokine-matured DCs were electroporated either with caIKKβ-RNA or as a control were mock electroporated. (a) Transfected DCs were co-cultured with fresh autologous peripheral blood mononuclear cells (PBMCs) 2–4 h after electroporation at a ratio of 1:2 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 6 PBMCs/ml) or 1:10 (final concentrations: 2 × 10 5 DCs/ml and 2 × 10 6 PBMCs/ml). To determine background levels, PBMCs were cultured alone. Cells were harvested after 24 h or 48 h and the expression of the surface markers CD54, CD69, and CD25 was determined via flow cytometry (using the gating strategy shown in Supplemental Figure S2 ). All values show the upregulation of each surface marker, calculated relative to the mean fluorescence intensity (MFI) of PBMCs alone. The average fold induction of four different donors with the SEM is shown; for original data, see Supplemental Table S1 . Each donor was analyzed in independent experiments. (b) DCs were co-cultured with fresh autologous NK cells at a ratio of 5:1 (final concentrations: 1 × 10 6 DCs/ml and 2 × 10 5 NK cells/ml) or 1:1 (final concentrations: 1 × 10 6 DCs/ml and 1 × 10 6 NK cells/ml). To determine background levels, NK cells were cultured alone. Cells were analyzed as described in (a). Average fold induction (relative to MFI of NK cells alone) is shown from four different donors with SEM; for original data see Supplemental Table S2 . p values were calculated to the respective mock condition with the paired Student’s t test using the specific MFI values, ** p ⩽ 0.01, * p ⩽ 0.05, numbers indicate p value of 0.05 ⩽ p ⩽ 0.1.

    Techniques Used: Transfection, Activation Assay, Cell Culture, Electroporation, Expressing, Flow Cytometry, Cytometry, Marker, Fluorescence

    Related Articles

    Clone Assay:

    Article Title: A Hepatitis C Virus Envelope Polymorphism Confers Resistance to Neutralization by Polyclonal Sera and Broadly Neutralizing Monoclonal Antibodies
    Article Snippet: The insertions were cloned into the digested HCVcc backbone using In-Fusion cloning. .. Linear DNA was used for in vitro RNA transcription with a T7 MEGAscript kit (Ambion).

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: In short, the 3’UTRs of ULBP2 (both sense and antisense) was cloned into pBluescriptII vector. .. In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA).

    Article Title: Organism-Specific rRNA Capture System for Application in Next-Generation Sequencing
    Article Snippet: Preparation of RNA probes by in vitro transcription Probe-incorporated plasmid DNA was linearized with Bam HI (New England Biolabs) locating at the 5’ end of the cloned rRNA sequence. .. In vitro RNA transcription was done using MEGAscript® SP6 kit (Ambion).

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: This 142-bp fragment was cloned into a standard pMA-T vector (Life Technologies, USA). .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Article Title: Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa
    Article Snippet: The TRV and BSMV infectious cDNA clones were described previously., To inoculate plants with TRV and TVCV, Agrobacterium cultures expressing full-length virus constructs under control of the 35 S promoter were infiltrated into leaves of N. benthamiana . .. Preparation of BSMV cDNA template, in vitro RNA transcription using the mMessage mMachine T7 kit (Ambion), and inoculation of plants were as described earlier.

    Amplification:

    Article Title: A Hepatitis C Virus Envelope Polymorphism Confers Resistance to Neutralization by Polyclonal Sera and Broadly Neutralizing Monoclonal Antibodies
    Article Snippet: E1E2 insertions were amplified from library plasmids using primers HCVcc_E1E2_1R (GAGGTTCTCCAAAGCCGCCTCCGC) and HCVcc E1E2_1F (TGTGCCCGCTTCAGCCTACCAAG). .. Linear DNA was used for in vitro RNA transcription with a T7 MEGAscript kit (Ambion).

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: Positions +1060 to +1396 of the HIV-2 genome were amplified using forward primer (5′- TAATACGACTCACTATA GGTCATTCGGTGTTCACCTG-3′) and reverse primer (5′-CATCTCCCACAATCTTCTACC-3′). .. In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol.

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: For the soaking and microinjection methods, dsRNA was generated as follows: DNA fragments were amplified from the dsRNA expression vector containing a part of the coding region of the targeting gene by PCR, using T7 primer. .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion).

    DNA Synthesis:

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. Minus-strand DNA synthesis was initiated on the RNA templates using a using a 21-nucleotide (nt) DNA primer complementary to the 18-nt primer binding site (PBS) sequence with 3 additional nucleotides at its 5′ end (HIV-1, 5′-CAAGTCCCTGTTCGGGCGCCA-3′, and HIV-2, 5′-CAAGTCCCTGTTCAGGCGCCA-3′).

    Mass Spectrometry:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: Paragraph title: RNA affinity purification and mass spectrometry ... In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA).

    Article Title: NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells
    Article Snippet: In vitro RNA transcription and electroporation of DCs In vitro transcription of mRNA was carried out using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technologies, Carlsbad, CA, USA) and purified with an RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocols. .. In a total volume of 100 µl, 6 × 106 DCs were electroporated with 30 µg caIKK-RNA or 5 µg EGFP-RNA or as a control mock electroporated using a square-wave pulse, 1 ms, and 1250 V/cm as recently described in detail.

    Construct:

    Article Title: Using ?C31 integrase to mediate insertion of DNA in Xenopus Embryos
    Article Snippet: However, permission to use HS4 insulator sequences and HS4 insulator constructs needs to be obtained from Dr. Gary Felsenfeld ( ) (and see and ). .. In vitro RNA transcription: T7 mMessage machine (Ambion, Austin, TX).

    Article Title: Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa
    Article Snippet: Paragraph title: Viruses and virus-based constructs ... Preparation of BSMV cDNA template, in vitro RNA transcription using the mMessage mMachine T7 kit (Ambion), and inoculation of plants were as described earlier.

    SDS-Gel:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA). .. After purification and elution of proteins that bound specifically to the RNAs, a SDS gel analysis was performed and specific bands detected with Coomassie Brilliant Blue G-250 (Sigma Aldrich, Israel).

    Incubation:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA). .. The biotinylated RNAs were coupled with streptavidin-sepharose beads (GE Healthcare, UK) and incubated with cytoplasmic extracts prepared from 80% confluent RKO cells for at least 12 hr.

    Article Title: Organism-Specific rRNA Capture System for Application in Next-Generation Sequencing
    Article Snippet: In vitro RNA transcription was done using MEGAscript® SP6 kit (Ambion). .. The reaction mixture containing 1 µg of linearized plasmid DNA, 2 µl of each of 10 mM ATP, CTP, GTP, 0.5 µl of 10 mM UTP, 1.5 µl 10 mM Bio-11-UTP (Ambion) and 2 µl RNA polymerase was incubated at 37°C for 12 hours.

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. For annealing, 50 ng of RNA template was incubated with 10 ng of labeled DNA primer in 15 μl annealing buffer (83 mM Tris-HCl, pH 7.5, 125 mM KCl) for 10 min at 65°C, followed by snap cooling on ice.

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the reinfection assay, 10-fold diluted CVB (MOI 0.1 ∼ 0.0001) was added to each well and the cultures were incubated at 37°C for 2 d. To measure cell viability after virus infection, a modified 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assay was performed as previously described ( ). .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol.

    Infection:

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. RNA was extracted from infected DBT cells at 8 h postinfection using RNeasy Mini (Qiagen), and cDNA was generated using an RT2 first-strand kit (Qiagen).

    Expressing:

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: For the soaking and microinjection methods, dsRNA was generated as follows: DNA fragments were amplified from the dsRNA expression vector containing a part of the coding region of the targeting gene by PCR, using T7 primer. .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion).

    Article Title: Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa
    Article Snippet: The TRV and BSMV infectious cDNA clones were described previously., To inoculate plants with TRV and TVCV, Agrobacterium cultures expressing full-length virus constructs under control of the 35 S promoter were infiltrated into leaves of N. benthamiana . .. Preparation of BSMV cDNA template, in vitro RNA transcription using the mMessage mMachine T7 kit (Ambion), and inoculation of plants were as described earlier.

    Modification:

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the reinfection assay, 10-fold diluted CVB (MOI 0.1 ∼ 0.0001) was added to each well and the cultures were incubated at 37°C for 2 d. To measure cell viability after virus infection, a modified 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assay was performed as previously described ( ). .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol.

    RNA Binding Assay:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: RNA affinity purification and mass spectrometry The interactions between RNA and RNA-binding proteins were analyzed by RNA affinity purification as previously described ( ). .. In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA).

    Transformation Assay:

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: Plasmid DNA was transformed in Top10 competent Escherichia coli cells according to the manufacturer's instructions (Life Technologies). .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Electroporation:

    Article Title: NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells
    Article Snippet: .. In vitro RNA transcription and electroporation of DCs In vitro transcription of mRNA was carried out using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technologies, Carlsbad, CA, USA) and purified with an RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocols. .. The RNA used for electroporation encoded a constitutively active mutant of IKKβ, which activates the classical NF-κB pathway.

    Transfection:

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol. .. Transfection was performed with 50 ng of replicon RNA per well with the Lipofectamine 2000 (Thermo Fisher Scientific) reagent.

    Article Title: A replication-competent foot-and-mouth disease virus expressing a luciferase reporter
    Article Snippet: .. 2.3 In vitro RNA transcription and transfection RNA was transcribed from infectious copy plasmids using the MEGAscript T7 kit (Ambion). .. After RNA synthesis was complete, the in vitro transcription reactions were treated with 1 μl of RNase-free DNase (Ambion) at 37 °C for 15 min to degrade the DNA templates and the RNA was purified using the MEGAclear kit (Ambion).

    Article Title: Design, Construction and Evaluation of 1a/JFH1 HCV Chimera by Replacing the Intergenotypic Variable Region
    Article Snippet: In vitro RNA transcription was performed with a MEGAscript T7 kit (Ambion, Germany) according to the manufacturer’s recommendations. .. After DNase I treatment, RNA was used for transfection ( ).

    Ligation:

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: .. The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. The supernatant was harvested 36 h postelectroporation, and plaque assay was performed as described previously ( ).

    Introduce:

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: To introduce mutations into MHV A59, we used a previously described method ( ). .. The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells.

    Generated:

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: For the soaking and microinjection methods, dsRNA was generated as follows: DNA fragments were amplified from the dsRNA expression vector containing a part of the coding region of the targeting gene by PCR, using T7 primer. .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion).

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. RNA was extracted from infected DBT cells at 8 h postinfection using RNeasy Mini (Qiagen), and cDNA was generated using an RT2 first-strand kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: The HIV-2 molecular clone ROD9 and the HIV-1 molecular clone pNL4.3 were used as templates for the PCR amplification and subsequent in vitro transcription. .. In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol.

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion). .. The final concentration of dsRNA for each gene in the soaking buffer was 2 μg/μL and in the injection buffer was 1 μg/μL.

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. PCR was performed using replicase primers , and purified PCR product was sequenced (amino acids 747 to 848).

    Article Title: Identification of common and cell type specific LXXLL motif EcR cofactors using a bioinformatics refined candidate RNAi screen in Drosophila melanogaster cell lines
    Article Snippet: PCR was performed using 1 μM of the appropriate cofactor primer, 1.1 μg DNA and Platinum Taq. .. In vitro RNA transcription was performed using MEGAscript T7 kit (Ambion) according to the manufacturer's instructions.

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: Purification was performed with a QIAquick PCR quantification kit (Qiagen) and eluted in 30 μl of prewarmed elution buffer. .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Affinity Purification:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: Paragraph title: RNA affinity purification and mass spectrometry ... In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA).

    Binding Assay:

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. Minus-strand DNA synthesis was initiated on the RNA templates using a using a 21-nucleotide (nt) DNA primer complementary to the 18-nt primer binding site (PBS) sequence with 3 additional nucleotides at its 5′ end (HIV-1, 5′-CAAGTCCCTGTTCGGGCGCCA-3′, and HIV-2, 5′-CAAGTCCCTGTTCAGGCGCCA-3′).

    MTT Assay:

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the reinfection assay, 10-fold diluted CVB (MOI 0.1 ∼ 0.0001) was added to each well and the cultures were incubated at 37°C for 2 d. To measure cell viability after virus infection, a modified 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assay was performed as previously described ( ). .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol.

    Plaque Assay:

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. The supernatant was harvested 36 h postelectroporation, and plaque assay was performed as described previously ( ).

    Mutagenesis:

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: Paragraph title: Generating Ubl-2 mutant viruses. ... The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells.

    Article Title: NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells
    Article Snippet: In vitro RNA transcription and electroporation of DCs In vitro transcription of mRNA was carried out using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technologies, Carlsbad, CA, USA) and purified with an RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocols. .. The RNA used for electroporation encoded a constitutively active mutant of IKKβ, which activates the classical NF-κB pathway.

    Isolation:

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: Plasmid isolation was achieved with a PureLink HiPure plasmid filter purification kit (Invitrogen), and the DNA pellet was resuspended in 200 μl of Tris-EDTA buffer. .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Labeling:

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. The DNA primer was 5′ end labeled with [γ-32 P]ATP and T4 polynucleotide kinase (NEB) and purified using NucAway columns (Ambion).

    Purification:

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA). .. After purification and elution of proteins that bound specifically to the RNAs, a SDS gel analysis was performed and specific bands detected with Coomassie Brilliant Blue G-250 (Sigma Aldrich, Israel).

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: .. In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. Minus-strand DNA synthesis was initiated on the RNA templates using a using a 21-nucleotide (nt) DNA primer complementary to the 18-nt primer binding site (PBS) sequence with 3 additional nucleotides at its 5′ end (HIV-1, 5′-CAAGTCCCTGTTCGGGCGCCA-3′, and HIV-2, 5′-CAAGTCCCTGTTCAGGCGCCA-3′).

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol. .. The in vitro transcribed replicon RNA was purified using the TRIzol LS reagent (Invitrogen).

    Article Title: Using ?C31 integrase to mediate insertion of DNA in Xenopus Embryos
    Article Snippet: Plasmid Purification Kits: Qiaprep Spin Miniprep Kit, HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA). .. In vitro RNA transcription: T7 mMessage machine (Ambion, Austin, TX).

    Article Title: Structural and phenotypic analysis of Chikungunya virus RNA replication elements
    Article Snippet: In vitro RNA transcription 2 μg of Not I linearized cDNA plasmid, was used as template for the production of 5′ capped and uncapped RNA in vitro using SP6 mMessageMachine and MEGAscript kits, respectively (Thermo Fisher Scientific), according to the manufacturer's instructions. .. Following transcription, DNA template was removed by DNase 1 (Thermo Fisher Scientific) digestion and the RNA purified using RNeasy mini-kit columns (Qiagen).

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: Plasmids encoding the complete virus genome were digested with restriction enzymes, gel purified, and ligated using T4 ligase at 16°C overnight. .. The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells.

    Article Title: A replication-competent foot-and-mouth disease virus expressing a luciferase reporter
    Article Snippet: 2.3 In vitro RNA transcription and transfection RNA was transcribed from infectious copy plasmids using the MEGAscript T7 kit (Ambion). .. After RNA synthesis was complete, the in vitro transcription reactions were treated with 1 μl of RNase-free DNase (Ambion) at 37 °C for 15 min to degrade the DNA templates and the RNA was purified using the MEGAclear kit (Ambion).

    Article Title: Identification of common and cell type specific LXXLL motif EcR cofactors using a bioinformatics refined candidate RNAi screen in Drosophila melanogaster cell lines
    Article Snippet: In vitro RNA transcription was performed using MEGAscript T7 kit (Ambion) according to the manufacturer's instructions. .. All product sizes were verified by running on a 1% agarose gel (data not shown). dsRNA was purified using Multiscreen PCR plates (Millipore) according to the manufacturer's instructions.

    Article Title: NF-κB activation triggers NK-cell stimulation by monocyte-derived dendritic cells
    Article Snippet: .. In vitro RNA transcription and electroporation of DCs In vitro transcription of mRNA was carried out using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technologies, Carlsbad, CA, USA) and purified with an RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocols. .. The RNA used for electroporation encoded a constitutively active mutant of IKKβ, which activates the classical NF-κB pathway.

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: Purification was performed with a QIAquick PCR quantification kit (Qiagen) and eluted in 30 μl of prewarmed elution buffer. .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Sequencing:

    Article Title: Organism-Specific rRNA Capture System for Application in Next-Generation Sequencing
    Article Snippet: Preparation of RNA probes by in vitro transcription Probe-incorporated plasmid DNA was linearized with Bam HI (New England Biolabs) locating at the 5’ end of the cloned rRNA sequence. .. In vitro RNA transcription was done using MEGAscript® SP6 kit (Ambion).

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: Positions +1 to +368 of the HIV-1 genome were amplified using a forward primer containing the T7 RNA polymerase promoter sequence (5′- TAATACGACTCACTATAG GGTCTCTCTGGTTAGACCAG-3′; italics indicate the T7 sequence) and reverse primer (5′-CATCTCTCTCCTTCTAGCCTC-3′). .. In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol.

    Spectroscopy:

    Article Title: Structural and phenotypic analysis of Chikungunya virus RNA replication elements
    Article Snippet: In vitro RNA transcription 2 μg of Not I linearized cDNA plasmid, was used as template for the production of 5′ capped and uncapped RNA in vitro using SP6 mMessageMachine and MEGAscript kits, respectively (Thermo Fisher Scientific), according to the manufacturer's instructions. .. RNA integrity was confirmed by denaturing agarose gel electrophoresis and quantified by NanoDrop spectroscopy.

    Injection:

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion). .. The final concentration of dsRNA for each gene in the soaking buffer was 2 μg/μL and in the injection buffer was 1 μg/μL.

    Plasmid Preparation:

    Article Title: A Hepatitis C Virus Envelope Polymorphism Confers Resistance to Neutralization by Polyclonal Sera and Broadly Neutralizing Monoclonal Antibodies
    Article Snippet: To make HCVcc RNA, 2 μg plasmid DNA was linearized using XbaI (New England BioLabs). .. Linear DNA was used for in vitro RNA transcription with a T7 MEGAscript kit (Ambion).

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: In short, the 3’UTRs of ULBP2 (both sense and antisense) was cloned into pBluescriptII vector. .. In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA).

    Article Title: Organism-Specific rRNA Capture System for Application in Next-Generation Sequencing
    Article Snippet: Preparation of RNA probes by in vitro transcription Probe-incorporated plasmid DNA was linearized with Bam HI (New England Biolabs) locating at the 5’ end of the cloned rRNA sequence. .. In vitro RNA transcription was done using MEGAscript® SP6 kit (Ambion).

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol. .. The in vitro transcribed replicon RNA was purified using the TRIzol LS reagent (Invitrogen).

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: For the soaking and microinjection methods, dsRNA was generated as follows: DNA fragments were amplified from the dsRNA expression vector containing a part of the coding region of the targeting gene by PCR, using T7 primer. .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion).

    Article Title: Using ?C31 integrase to mediate insertion of DNA in Xenopus Embryos
    Article Snippet: Paragraph title: 2.1. Plasmids and Plasmid Preparation Reagents ... In vitro RNA transcription: T7 mMessage machine (Ambion, Austin, TX).

    Article Title: Structural and phenotypic analysis of Chikungunya virus RNA replication elements
    Article Snippet: .. In vitro RNA transcription 2 μg of Not I linearized cDNA plasmid, was used as template for the production of 5′ capped and uncapped RNA in vitro using SP6 mMessageMachine and MEGAscript kits, respectively (Thermo Fisher Scientific), according to the manufacturer's instructions. .. Following transcription, DNA template was removed by DNase 1 (Thermo Fisher Scientific) digestion and the RNA purified using RNeasy mini-kit columns (Qiagen).

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: Briefly, plasmid encoding the MHV B subclone was mutagenized using primers described in . .. The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells.

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: Plasmid DNA was linearized with the restriction enzyme PvuII (Fermentas, Belgium) using 1 μl of DNA, 2 μl of buffer G, 15 μl of H2 O, and 2 μl of PvuII (10 U/μl) for 1 h at 37°C. .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases.

    Article Title: Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa
    Article Snippet: Preparation of BSMV cDNA template, in vitro RNA transcription using the mMessage mMachine T7 kit (Ambion), and inoculation of plants were as described earlier. .. TGMV plasmids (p0191 and p0192) were mixed in a 1:1 ratio and mechanically inoculated onto plants as described previously using 1.25 µg of each plasmid per leaf.

    Agarose Gel Electrophoresis:

    Article Title: Structural and phenotypic analysis of Chikungunya virus RNA replication elements
    Article Snippet: In vitro RNA transcription 2 μg of Not I linearized cDNA plasmid, was used as template for the production of 5′ capped and uncapped RNA in vitro using SP6 mMessageMachine and MEGAscript kits, respectively (Thermo Fisher Scientific), according to the manufacturer's instructions. .. RNA integrity was confirmed by denaturing agarose gel electrophoresis and quantified by NanoDrop spectroscopy.

    Article Title: Identification of common and cell type specific LXXLL motif EcR cofactors using a bioinformatics refined candidate RNAi screen in Drosophila melanogaster cell lines
    Article Snippet: In vitro RNA transcription was performed using MEGAscript T7 kit (Ambion) according to the manufacturer's instructions. .. All product sizes were verified by running on a 1% agarose gel (data not shown). dsRNA was purified using Multiscreen PCR plates (Millipore) according to the manufacturer's instructions.

    In Vitro:

    Article Title: A Hepatitis C Virus Envelope Polymorphism Confers Resistance to Neutralization by Polyclonal Sera and Broadly Neutralizing Monoclonal Antibodies
    Article Snippet: .. Linear DNA was used for in vitro RNA transcription with a T7 MEGAscript kit (Ambion). .. RNA cleanup was performed using a RNeasy minikit (Qiagen) and quantified using NanoDrop.

    Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
    Article Snippet: .. In vitro RNA transcription was performed using the MEGAscript T7 transcription kit (Life Technologies, CA, USA) after linearization of the plasmids with PspOMI restriction enzyme (Thermo Scientific (Fermentas), MA, USA). .. Around 10 percent of totally incorporated UTPs were Biotin-16-UTPs (GE Healthcare, UK).

    Article Title: Organism-Specific rRNA Capture System for Application in Next-Generation Sequencing
    Article Snippet: .. In vitro RNA transcription was done using MEGAscript® SP6 kit (Ambion). .. The reaction mixture containing 1 µg of linearized plasmid DNA, 2 µl of each of 10 mM ATP, CTP, GTP, 0.5 µl of 10 mM UTP, 1.5 µl 10 mM Bio-11-UTP (Ambion) and 2 µl RNA polymerase was incubated at 37°C for 12 hours.

    Article Title: Mutation V111I in HIV-2 Reverse Transcriptase Increases the Fitness of the Nucleoside Analogue-Resistant K65R and Q151M Viruses
    Article Snippet: .. In vitro RNA transcription was mediated using the T-7 Megascript kit (Ambion), and RNA was purified using the Megaclear kit (Ambion) according to the manufacturer's protocol. .. Minus-strand DNA synthesis was initiated on the RNA templates using a using a 21-nucleotide (nt) DNA primer complementary to the 18-nt primer binding site (PBS) sequence with 3 additional nucleotides at its 5′ end (HIV-1, 5′-CAAGTCCCTGTTCGGGCGCCA-3′, and HIV-2, 5′-CAAGTCCCTGTTCAGGCGCCA-3′).

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol. .. The in vitro transcribed replicon RNA was purified using the TRIzol LS reagent (Invitrogen).

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: .. PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion). .. The final concentration of dsRNA for each gene in the soaking buffer was 2 μg/μL and in the injection buffer was 1 μg/μL.

    Article Title: Using ?C31 integrase to mediate insertion of DNA in Xenopus Embryos
    Article Snippet: .. In vitro RNA transcription: T7 mMessage machine (Ambion, Austin, TX). ..

    Article Title: Structural and phenotypic analysis of Chikungunya virus RNA replication elements
    Article Snippet: .. In vitro RNA transcription 2 μg of Not I linearized cDNA plasmid, was used as template for the production of 5′ capped and uncapped RNA in vitro using SP6 mMessageMachine and MEGAscript kits, respectively (Thermo Fisher Scientific), according to the manufacturer's instructions. .. Following transcription, DNA template was removed by DNase 1 (Thermo Fisher Scientific) digestion and the RNA purified using RNeasy mini-kit columns (Qiagen).

    Article Title: Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis
    Article Snippet: .. The ligation reaction was isopropanol precipitated, and in vitro RNA transcription was performed using a mMESSAGE mMACHINE kit (Ambion) according to the following protocol: 40.5°C for 25 min, 37.5°C for 50 min, and 40.5°C for 25 min. RNA was electroporated into BHK-R cells, and the electroporated cells were seeded onto DBT cells. .. The supernatant was harvested 36 h postelectroporation, and plaque assay was performed as described previously ( ).

    Article Title: A replication-competent foot-and-mouth disease virus expressing a luciferase reporter
    Article Snippet: .. 2.3 In vitro RNA transcription and transfection RNA was transcribed from infectious copy plasmids using the MEGAscript T7 kit (Ambion). .. After RNA synthesis was complete, the in vitro transcription reactions were treated with 1 μl of RNase-free DNase (Ambion) at 37 °C for 15 min to degrade the DNA templates and the RNA was purified using the MEGAclear kit (Ambion).

    Article Title: Identification of common and cell type specific LXXLL motif EcR cofactors using a bioinformatics refined candidate RNAi screen in Drosophila melanogaster cell lines
    Article Snippet: .. In vitro RNA transcription was performed using MEGAscript T7 kit (Ambion) according to the manufacturer's instructions. .. All product sizes were verified by running on a 1% agarose gel (data not shown). dsRNA was purified using Multiscreen PCR plates (Millipore) according to the manufacturer's instructions.

    Article Title: Design, Construction and Evaluation of 1a/JFH1 HCV Chimera by Replacing the Intergenotypic Variable Region
    Article Snippet: .. In vitro RNA transcription was performed with a MEGAscript T7 kit (Ambion, Germany) according to the manufacturer’s recommendations. .. After DNase I treatment, RNA was used for transfection ( ).

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: .. In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases. .. DNase treatment was performed with 1 μl of Turbo DNase (Ambion) for 15 min at 37°C, and RNA was recovered and eluted in 30 μl of RNase-free water with an RNeasy kit (Qiagen).

    Article Title: Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa
    Article Snippet: .. Preparation of BSMV cDNA template, in vitro RNA transcription using the mMessage mMachine T7 kit (Ambion), and inoculation of plants were as described earlier. .. TGMV plasmids (p0191 and p0192) were mixed in a 1:1 ratio and mechanically inoculated onto plants as described previously using 1.25 µg of each plasmid per leaf.

    Knock-Out:

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: Cells were plated to 96-well plates at 2 × 104 cells per well to test whether knockout cells were resistant to viral infection and whether replication of the CVB subgenomic replicon was inhibited in those cells. .. For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol.

    Concentration Assay:

    Article Title: SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans
    Article Snippet: PCR products were subjected to in vitro RNA transcription using the Megascript T7 kit (Ambion). .. The final concentration of dsRNA for each gene in the soaking buffer was 2 μg/μL and in the injection buffer was 1 μg/μL.

    Article Title: Comparison of the FilmArray RP, Verigene RV+, and Prodesse ProFLU+/FAST+ Multiplex Platforms for Detection of Influenza Viruses in Clinical Samples from the 2011-2012 Influenza Season in Belgium
    Article Snippet: In vitro RNA transcription was performed with a MEGAscript kit according to the manufacturer's instructions (Ambion), generating a RNA fragment of 269 bases. .. From these EQC RNA pools, a 1:10 dilution series was made in extraction buffer 3 (bioMérieux, Netherlands), and the RNA concentration of the 1:20 dilution of the EQC RNA pool was measured using a Quant-iT RNA assay kit (Invitrogen) (average of 5 measurements).

    Lysis:

    Article Title: Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection
    Article Snippet: For the replicon assay, the pLuCVB3 plasmid was linearized with ClaI (New England BioLabs) and used as a template for in vitro RNA transcription performed with a MEGAscript T7 kit (Ambion) as suggested by the manufacturer's protocol. .. At 4 h post-transfection, cells were washed, resuspended in complete growth medium, and incubated at 37°C or lysed in 20 µL of lysis buffer (0 h).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher ercc rna spike in mix
    Ercc Rna Spike In Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ercc rna spike in mix/product/Thermo Fisher
    Average 90 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    ercc rna spike in mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher ion total rna seq kit v2
    Ion Total Rna Seq Kit V2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ion total rna seq kit v2/product/Thermo Fisher
    Average 90 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    ion total rna seq kit v2 - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher murine ribominus transcriptome isolation kits
    Murine Ribominus Transcriptome Isolation Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine ribominus transcriptome isolation kits/product/Thermo Fisher
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    murine ribominus transcriptome isolation kits - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results