in fusion hd ecodry cloning system  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    In Fusion HD EcoDry Cloning System
    Description:
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    Catalog Number:
    639688
    Price:
    None
    Size:
    96 Rxns
    Category:
    Legacy cloning kits and systems Legacy cloning products Cloning
    Buy from Supplier


    Structured Review

    TaKaRa in fusion hd ecodry cloning system
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    https://www.bioz.com/result/in fusion hd ecodry cloning system/product/TaKaRa
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    in fusion hd ecodry cloning system - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA. ..

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: .. Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. Full-length LXRα and RXRα were cloned from cDNA fragments (Source BioScience clone IRATp970C0271, Gene ID: 7376 and clone IOH39435, Gene ID: 6256) into pBIND vector (Promega).

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: .. Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions. .. Deletion construct ΔEx17 was made using specific primers.

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The DNA sequences of gCTRP9 were inserted into prokaryotic expression vector pET45b (Novagen, Billerica, MA) using an In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories, Mountain View, CA). .. DE3 bacteria carrying gCTRP9 plasmids were cultured in LB broth, and gCTRP9 protein was purified by Ni-NTA column resin under native conditions, as previously reported ( ).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Article Title: The role of nuclear lamin B1 in cell proliferation and senescence
    Article Snippet: .. For overexpressing GFP and GFP-LB1, the retrovirus vectors pQCXIP-GFP and pQCXIP-GFP-myc-Hs LMNB1 were prepared using In-Fusion HD EcoDry cloning system (Clontech). .. The DNA fragments of GFP and GFP-myc-Hs LMNB1 with BamHI was PCR-amplified using pEGFP-C1 (Clontech) and pEGFP-myc-Hs LMNB1 ). pRb was inactivated by expression of HPV E7 from pLXSN-16E7 with pLXSN as a control (both provided by Dr. D. Galloway, Fred Hutchinson Cancer Research Center).

    Amplification:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: To complement the ubp5 Δ mutant, a genomic DNA fragment containing ORF, promoter and terminator region was amplified using primers Re0104-F and Re0104-R. .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: The 3’UTR of PDZ-RhoGEF mRNA was amplified from cortical neurons by RT-PCR and cloned into TOPO TA cloning vector (Invitrogen) for sequencing. .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: Fragment amplification was performed using Phusion® High-Fidelity DNA Polymerase (New England BioLabs). .. Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions.

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: Finally, the ZmUbi1 promoter was amplified from the B73 genome, and a hygromycin-resistance gene and its terminator were amplified from pCambia2300. .. These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    Synthesized:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: The synthesized cDNA was used to amplify gCTRP9 (AA 194-333) or full-length CTRP9 (fCTRP9) gene by CloneAmp HiFi PCR Premix (Clontech Laboratories, Mountain View, CA). .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: SpCas9 nickase fused with PmCDA1 and UGI and appended to a 35S terminator was synthesized and digested with SnaBI and AvrII (fragment 3). .. These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    TA Cloning:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: The 3’UTR of PDZ-RhoGEF mRNA was amplified from cortical neurons by RT-PCR and cloned into TOPO TA cloning vector (Invitrogen) for sequencing. .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Construct:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: Paragraph title: Plasmid constructs ... 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: .. Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions. .. Deletion construct ΔEx17 was made using specific primers.

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: Four additional fragments, detailed below, were generated, fused and inserted into the modified backbone to produce the SpCas9-pBE basic construct. .. These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    Incubation:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. In short, increasing amounts of protein were combined with 0.1 mg/ml BSA, 66.7 nM DNA probe, and EMSA buffer (10 mM Tris–HCl pH 7.4, 50 mM KCl, 0.5 mM MgCl2 , 0.1 mM EDTA, 5% glycerol) and incubated at room temperature for 30 min before running on a 1% agarose gel in 1X TAE at 4°C.

    Luciferase:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA. ..

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. For reporter gene analysis, HEK293T cells were co-transfected with the pGL4.31–LXRE–Luc, pBIND–LXRα and pBIND–RXRα in 0.25% Lipofectamine (Invitrogen) for 4 h and subsequently treated with 10 µM T0901317 or 0.1% DMSO for 24 h. Reporter activity was determined with Dual Luciferase Reporter System (Promega).

    Activity Assay:

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. For reporter gene analysis, HEK293T cells were co-transfected with the pGL4.31–LXRE–Luc, pBIND–LXRα and pBIND–RXRα in 0.25% Lipofectamine (Invitrogen) for 4 h and subsequently treated with 10 µM T0901317 or 0.1% DMSO for 24 h. Reporter activity was determined with Dual Luciferase Reporter System (Promega).

    Expressing:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA. ..

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: Paxillin LD1 (residues 3–15), LD2 (residues 144–156), LD3 (residues 216–228), LD4 (residues 265–276), and LD5 (residues 333–345) in pGEX-2TK (Amersham) for prokaryotic expression were a gift from Dr. C Turner (State University of New York at Syracuse). .. Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The DNA sequences of gCTRP9 were inserted into prokaryotic expression vector pET45b (Novagen, Billerica, MA) using an In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories, Mountain View, CA). .. DE3 bacteria carrying gCTRP9 plasmids were cultured in LB broth, and gCTRP9 protein was purified by Ni-NTA column resin under native conditions, as previously reported ( ).

    Article Title: The role of nuclear lamin B1 in cell proliferation and senescence
    Article Snippet: For silencing the expression of LB1, we prepared the retrovirus vectors pSilencer-HsLMNB1shRNA-T3, pSilencer-HsLMNB1shRNA-T4, and pSilencer-Scrambled (used as a control) according to the manufacturer's instructions (Ambion). pSilencer 5.1-H1 Retro precut with HindIII and BamHI was ligated with the target sequences for silencing LB1 ( ). .. For overexpressing GFP and GFP-LB1, the retrovirus vectors pQCXIP-GFP and pQCXIP-GFP-myc-Hs LMNB1 were prepared using In-Fusion HD EcoDry cloning system (Clontech).

    Modification:

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: Four additional fragments, detailed below, were generated, fused and inserted into the modified backbone to produce the SpCas9-pBE basic construct. .. These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    Transformation Assay:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: The purified PCR fragments were reduced to a 2 µl volume and precipitated onto 10 µl gold microparticles (0.6 µm; Bio-Rad) for biolistic transformation . .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech).

    Hybridization:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. Reconstitution was confirmed by PCR and Southern hybridization.

    Transfection:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: Paragraph title: CTRP9 gene cloning, protein purification, and 3T3-L1 cell transfection. ... The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Southern Blot:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: Positive transformants identified by PCR screening were further confirmed by Southern blot analysis. .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech).

    Cell Culture:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: DE3 bacteria carrying gCTRP9 plasmids were cultured in LB broth, and gCTRP9 protein was purified by Ni-NTA column resin under native conditions, as previously reported ( ). .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: The 3’UTR of PDZ-RhoGEF mRNA was amplified from cortical neurons by RT-PCR and cloned into TOPO TA cloning vector (Invitrogen) for sequencing. .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Generated:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: Four additional fragments, detailed below, were generated, fused and inserted into the modified backbone to produce the SpCas9-pBE basic construct. .. These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    Sequencing:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: The 3’UTR of PDZ-RhoGEF mRNA was amplified from cortical neurons by RT-PCR and cloned into TOPO TA cloning vector (Invitrogen) for sequencing. .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA.

    Recombinant:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Mutagenesis:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: Paragraph title: Construction of DUB Mutant Strains and Reconstitution ... This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech).

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Electrophoretic Mobility Shift Assay:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Purification:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: The purified PCR fragments were reduced to a 2 µl volume and precipitated onto 10 µl gold microparticles (0.6 µm; Bio-Rad) for biolistic transformation . .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech).

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: DE3 bacteria carrying gCTRP9 plasmids were cultured in LB broth, and gCTRP9 protein was purified by Ni-NTA column resin under native conditions, as previously reported ( ). .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Protein Purification:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: Paragraph title: CTRP9 gene cloning, protein purification, and 3T3-L1 cell transfection. ... The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Polymerase Chain Reaction:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: The synthesized cDNA was used to amplify gCTRP9 (AA 194-333) or full-length CTRP9 (fCTRP9) gene by CloneAmp HiFi PCR Premix (Clontech Laboratories, Mountain View, CA). .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories).

    Article Title: The role of nuclear lamin B1 in cell proliferation and senescence
    Article Snippet: For overexpressing GFP and GFP-LB1, the retrovirus vectors pQCXIP-GFP and pQCXIP-GFP-myc-Hs LMNB1 were prepared using In-Fusion HD EcoDry cloning system (Clontech). .. The DNA fragments of GFP and GFP-myc-Hs LMNB1 with BamHI was PCR-amplified using pEGFP-C1 (Clontech) and pEGFP-myc-Hs LMNB1 ). pRb was inactivated by expression of HPV E7 from pLXSN-16E7 with pLXSN as a control (both provided by Dr. D. Galloway, Fred Hutchinson Cancer Research Center).

    Positron Emission Tomography:

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: His-merlin-N terminus (NT, residues 1–298), His-merlin-C terminus (CT, residues 299–595), His-merlin-NTΔPBD1 (residues 50–70 deleted) constructs in pET-28a (+) (Novagen), and GST-paxillin-full length (FL), GST-paxillin-N terminus (NT, residues 1–325), GST-paxillin-C terminus (CT, residues 326–559) constructs in pGEX-6P – 1 vector (Amersham) for prokaryotic expression – were cloned using standard techniques or as previously described ( ). .. Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions.

    Plasmid Preparation:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. 3’ UTR of PDZ-RhoGEF mRNA shown in was cloned into pmirGlo luciferase miRNA target expression vector (Promega) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GCTCGCTAGCCTCGAGCATCCAGACAACCAGAGTCTGGCC and reverse CGACTCTAGACTCGAGCTGAATATTTAACTTTTCTTTAAA. ..

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: .. Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. Full-length LXRα and RXRα were cloned from cDNA fragments (Source BioScience clone IRATp970C0271, Gene ID: 7376 and clone IOH39435, Gene ID: 6256) into pBIND vector (Promega).

    Article Title: Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with ?1 integrin and actin at the plasma membrane
    Article Snippet: Paragraph title: Plasmid construction ... Deletion constructs (ΔEx2, ΔEx2–3) were made using the In-Fusion®EcoDryTM Cloning System from Clontech following manufacturer's instructions.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The DNA sequences of gCTRP9 were inserted into prokaryotic expression vector pET45b (Novagen, Billerica, MA) using an In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories, Mountain View, CA). .. DE3 bacteria carrying gCTRP9 plasmids were cultured in LB broth, and gCTRP9 protein was purified by Ni-NTA column resin under native conditions, as previously reported ( ).

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: Paragraph title: Plasmid constructs ... cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA.

    Article Title: Multiplex nucleotide editing by high-fidelity Cas9 variants with improved efficiency in rice
    Article Snippet: Paragraph title: Plasmid construction ... These two elements were fused using an Infusion kit (Takara; cat. no. 639686) and digested with AvrII and SbfI to give fragment 4.

    shRNA:

    Article Title: The role of nuclear lamin B1 in cell proliferation and senescence
    Article Snippet: For overexpressing GFP and GFP-LB1, the retrovirus vectors pQCXIP-GFP and pQCXIP-GFP-myc-Hs LMNB1 were prepared using In-Fusion HD EcoDry cloning system (Clontech). .. E1A was used in experiments to induce senescence with RasG12V, since inactivation of pRb by the expression of E7 is not sufficient to prevent cells from undergoing RasG12V-induced premature senescence ( ). p53 was inactivated by expression of p53DD from pBABE-hygro-p53DD with pBABE-hygro as a control (both provided by Dr. Robert Weinberg, Whitehead Institute for Biomedical Research through Addgene) or silenced using pMSCV-hygro-miR30 (p53 shRNA) with pMSCV-hygro as a control (both provided by Dr. Scott Lowe, Cold Spring Harbor Laboratory).

    Agarose Gel Electrophoresis:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. In short, increasing amounts of protein were combined with 0.1 mg/ml BSA, 66.7 nM DNA probe, and EMSA buffer (10 mM Tris–HCl pH 7.4, 50 mM KCl, 0.5 mM MgCl2 , 0.1 mM EDTA, 5% glycerol) and incubated at room temperature for 30 min before running on a 1% agarose gel in 1X TAE at 4°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    TaKaRa dsred vegt pbe ds3 utr
    Nanos1 represses <t>VegT</t> translation in PGCs. ( A ) RNA EMSA analysis shows that the Xenopus Pumilio1 RNA-binding domain (Xpum1 RBD) can bind biotin-labeled VegT <t>PBE</t> (1 ng) but not the mutant VegT PBE. This binding reaction was competed by unlabeled VegT PBE. ( B ) Experimental design for results shown in C. Venus-DEADSouth <t>3′UTR</t> and <t>DsRED-DEADSouth</t> 3′UTR are germline lineage tracers. VegT PBE or its mutant was subcloned downstream of the DsRED open reading frame. Nanos1-MO was injected at stage 1. Germline lineage reporters were injected into four germ plasm-containing blastomeres at the 32-cell stage. Embryos were allowed to develop until stage 35 and the fluorescent images were taken from live embryos. ( C ) In vivo fluorescent reporter assay indicates that VegT PBE mediates translational repression of DsRED (red) in PGCs (green). Repression was lost in embryos bearing a PBE mutation or that were depleted of Nanos1. Reporters injected are noted across the top. This experiment was repeated three times. Arrows indicate DsRED signal detected in PGCs. Data from one experiment are presented beneath the images for each group. Scale bars: 50 μm.
    Dsred Vegt Pbe Ds3 Utr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsred vegt pbe ds3 utr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsred vegt pbe ds3 utr - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    TaKaRa in fusion ecodry hd cloning kit
    Nanos1 represses <t>VegT</t> translation in PGCs. ( A ) RNA EMSA analysis shows that the Xenopus Pumilio1 RNA-binding domain (Xpum1 RBD) can bind biotin-labeled VegT <t>PBE</t> (1 ng) but not the mutant VegT PBE. This binding reaction was competed by unlabeled VegT PBE. ( B ) Experimental design for results shown in C. Venus-DEADSouth <t>3′UTR</t> and <t>DsRED-DEADSouth</t> 3′UTR are germline lineage tracers. VegT PBE or its mutant was subcloned downstream of the DsRED open reading frame. Nanos1-MO was injected at stage 1. Germline lineage reporters were injected into four germ plasm-containing blastomeres at the 32-cell stage. Embryos were allowed to develop until stage 35 and the fluorescent images were taken from live embryos. ( C ) In vivo fluorescent reporter assay indicates that VegT PBE mediates translational repression of DsRED (red) in PGCs (green). Repression was lost in embryos bearing a PBE mutation or that were depleted of Nanos1. Reporters injected are noted across the top. This experiment was repeated three times. Arrows indicate DsRED signal detected in PGCs. Data from one experiment are presented beneath the images for each group. Scale bars: 50 μm.
    In Fusion Ecodry Hd Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in fusion ecodry hd cloning kit/product/TaKaRa
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    in fusion ecodry hd cloning kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Nanos1 represses VegT translation in PGCs. ( A ) RNA EMSA analysis shows that the Xenopus Pumilio1 RNA-binding domain (Xpum1 RBD) can bind biotin-labeled VegT PBE (1 ng) but not the mutant VegT PBE. This binding reaction was competed by unlabeled VegT PBE. ( B ) Experimental design for results shown in C. Venus-DEADSouth 3′UTR and DsRED-DEADSouth 3′UTR are germline lineage tracers. VegT PBE or its mutant was subcloned downstream of the DsRED open reading frame. Nanos1-MO was injected at stage 1. Germline lineage reporters were injected into four germ plasm-containing blastomeres at the 32-cell stage. Embryos were allowed to develop until stage 35 and the fluorescent images were taken from live embryos. ( C ) In vivo fluorescent reporter assay indicates that VegT PBE mediates translational repression of DsRED (red) in PGCs (green). Repression was lost in embryos bearing a PBE mutation or that were depleted of Nanos1. Reporters injected are noted across the top. This experiment was repeated three times. Arrows indicate DsRED signal detected in PGCs. Data from one experiment are presented beneath the images for each group. Scale bars: 50 μm.

    Journal: Development (Cambridge, England)

    Article Title: Xenopus Nanos1 is required to prevent endoderm gene expression and apoptosis in primordial germ cells

    doi: 10.1242/dev.079608

    Figure Lengend Snippet: Nanos1 represses VegT translation in PGCs. ( A ) RNA EMSA analysis shows that the Xenopus Pumilio1 RNA-binding domain (Xpum1 RBD) can bind biotin-labeled VegT PBE (1 ng) but not the mutant VegT PBE. This binding reaction was competed by unlabeled VegT PBE. ( B ) Experimental design for results shown in C. Venus-DEADSouth 3′UTR and DsRED-DEADSouth 3′UTR are germline lineage tracers. VegT PBE or its mutant was subcloned downstream of the DsRED open reading frame. Nanos1-MO was injected at stage 1. Germline lineage reporters were injected into four germ plasm-containing blastomeres at the 32-cell stage. Embryos were allowed to develop until stage 35 and the fluorescent images were taken from live embryos. ( C ) In vivo fluorescent reporter assay indicates that VegT PBE mediates translational repression of DsRED (red) in PGCs (green). Repression was lost in embryos bearing a PBE mutation or that were depleted of Nanos1. Reporters injected are noted across the top. This experiment was repeated three times. Arrows indicate DsRED signal detected in PGCs. Data from one experiment are presented beneath the images for each group. Scale bars: 50 μm.

    Article Snippet: VegT 3′UTR (296 nt, 2336-2631) containing the PBE (UGUAAAUA) was subcloned downstream of the DsRED open reading frame to produce DsRED- VegT PBE-DS3′UTR (In-Fusion HD EcoDry Cloning System, Clontech).

    Techniques: RNA Binding Assay, Labeling, Mutagenesis, Binding Assay, Injection, In Vivo, Reporter Assay

    VegT RNA is stabilized in PGCs after Nanos1 knockdown. ( A ) VegT PBE mediates the degradation of the reporter message DsRED. PGCs were detected by either WISH for Xpat (top panels) or for DsRED antisense probe (bottom panels) in tailbud stage 31 embryos. Note that the DsRED reporter with a PBE was specifically degraded. Arrows indicate PGCs. ( B ) Real-time PCR analysis of VegT expression at stages 8 and 10. Expression of VegT in Nanos1 knockdown samples was normalized to that of wild-type samples. Real-time PCR was performed in duplicate, and experiments were repeated three times and showed a similar pattern. Error bars indicate s.e. P -value by unpaired Student’s t -test.

    Journal: Development (Cambridge, England)

    Article Title: Xenopus Nanos1 is required to prevent endoderm gene expression and apoptosis in primordial germ cells

    doi: 10.1242/dev.079608

    Figure Lengend Snippet: VegT RNA is stabilized in PGCs after Nanos1 knockdown. ( A ) VegT PBE mediates the degradation of the reporter message DsRED. PGCs were detected by either WISH for Xpat (top panels) or for DsRED antisense probe (bottom panels) in tailbud stage 31 embryos. Note that the DsRED reporter with a PBE was specifically degraded. Arrows indicate PGCs. ( B ) Real-time PCR analysis of VegT expression at stages 8 and 10. Expression of VegT in Nanos1 knockdown samples was normalized to that of wild-type samples. Real-time PCR was performed in duplicate, and experiments were repeated three times and showed a similar pattern. Error bars indicate s.e. P -value by unpaired Student’s t -test.

    Article Snippet: VegT 3′UTR (296 nt, 2336-2631) containing the PBE (UGUAAAUA) was subcloned downstream of the DsRED open reading frame to produce DsRED- VegT PBE-DS3′UTR (In-Fusion HD EcoDry Cloning System, Clontech).

    Techniques: Real-time Polymerase Chain Reaction, Expressing