in fusion hd cloning system  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    In Fusion HD Cloning System
    Description:
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    Catalog Number:
    639692
    Price:
    None
    Size:
    96 Rxns
    Category:
    Legacy cloning kits and systems Legacy cloning products Cloning
    Buy from Supplier


    Structured Review

    TaKaRa in fusion hd cloning system
    Schematic representation of the construction of a gene replacement cassette. (A) Construction of a disruption and replacement cassette using restriction enzyme- and ligase-dependent <t>cloning.</t> HPH , hygromycin B phosphotransferase . (B) Construct used for FUM1 (8.1 kb) disruption <t>in</t> Fusarium fujikuroi created using the <t>In-Fusion</t> cloning <t>system.</t> NPTII , neomycin phosphotransferase . * The marks indicate clones exhibiting expected results. (C) Comparison of the construction systems used in these experiments for targeted gene deletion in fungi.
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    https://www.bioz.com/result/in fusion hd cloning system/product/TaKaRa
    Average 99 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    in fusion hd cloning system - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi"

    Article Title: Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi

    Journal: The Plant Pathology Journal

    doi: 10.5423/PPJ.OA.12.2015.0263

    Schematic representation of the construction of a gene replacement cassette. (A) Construction of a disruption and replacement cassette using restriction enzyme- and ligase-dependent cloning. HPH , hygromycin B phosphotransferase . (B) Construct used for FUM1 (8.1 kb) disruption in Fusarium fujikuroi created using the In-Fusion cloning system. NPTII , neomycin phosphotransferase . * The marks indicate clones exhibiting expected results. (C) Comparison of the construction systems used in these experiments for targeted gene deletion in fungi.
    Figure Legend Snippet: Schematic representation of the construction of a gene replacement cassette. (A) Construction of a disruption and replacement cassette using restriction enzyme- and ligase-dependent cloning. HPH , hygromycin B phosphotransferase . (B) Construct used for FUM1 (8.1 kb) disruption in Fusarium fujikuroi created using the In-Fusion cloning system. NPTII , neomycin phosphotransferase . * The marks indicate clones exhibiting expected results. (C) Comparison of the construction systems used in these experiments for targeted gene deletion in fungi.

    Techniques Used: Clone Assay, Construct

    Fusarium cyclin C1 ( FCC1 ) disruption in the Fusarium fujikuroi strain B14 using the In-Fusion cloning system. (A) Strategies for FCC1 disruption by homologous recombination. (B) Amplification of the three primary products: the 5′ flanking region of FCC1 , neomycin phosphotransferase ( NPTII ), and the 3′ flanking region of FCC1 . (C) Verification of the constructs prior to target gene disruption. (D) PCR screening results from the selected transformants using specific primers. P, positive control. (E) Southern blot analysis of wild-type and fcc1 mutants.
    Figure Legend Snippet: Fusarium cyclin C1 ( FCC1 ) disruption in the Fusarium fujikuroi strain B14 using the In-Fusion cloning system. (A) Strategies for FCC1 disruption by homologous recombination. (B) Amplification of the three primary products: the 5′ flanking region of FCC1 , neomycin phosphotransferase ( NPTII ), and the 3′ flanking region of FCC1 . (C) Verification of the constructs prior to target gene disruption. (D) PCR screening results from the selected transformants using specific primers. P, positive control. (E) Southern blot analysis of wild-type and fcc1 mutants.

    Techniques Used: Clone Assay, Homologous Recombination, Amplification, Construct, Polymerase Chain Reaction, Positive Control, Southern Blot

    Related Articles

    Clone Assay:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. ..

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech). .. To maintain complexity, five ligation reactions were carried out and used for 18 independent bacterial transformations with LB-carbenicillin selection.

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: .. Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan). .. We cloned a 1,940 bp sequence upstream from the Ce-ctl-3 start codon for Ce-Pctl-3 , and a 1,600 bp sequence between Ce-ctl-3 and Ce-ctl-1 CDS (coding sequences) for Ce-Pctl-1 .

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions. .. After preparing the HA-tagged expression vectors, we verified that the sequences of the inserted EBV genes were identical to the sequences in the database (v01555.2).

    Article Title: Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi
    Article Snippet: .. Primer design for Fusarium cyclin C1 gene (FCC1 ) and FUM1 deletions To generate target gene deletion mutants using the In-Fusion® HD Cloning system (Clontech Laboratories Inc., Mountain View, CA, USA), primers were designed using a primer design tool developed by In-Fusion® HD Cloning. .. To successfully clone any DNA fragment, the primers used must be designed to share an overlap of at least 15 homologous bases between the end of the linearized vector and/or the desired fragment.

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ). .. Plasmids pRPS- Rrub-cbbM and pRPS- Rpal-cbbM contain the wild type R. rubrum and Rhodopseudomonas palustris form II Rubisco gene ( cbbM ), respectively, cloned into pRPS-MCS3 as described previously ( , ).

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech). .. The full-length clones were confirmed by bi-directional Sanger sequencing.

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech). .. Yeast Plasmid Purification Purification of plasmids directly from yeast cells was performed using a modified method [ ].

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. ..

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech) .. GST tagged BRD4 ET domain (3 ug), purified from E. coli, were incubated with GST-sepharose 4B beads (#17-0756-01; GE Healthcare) for 2 hours at 4°C.

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: .. For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions. ..

    Centrifugation:

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA). .. Transformants complementing uracil requirement were isolated and cultivated in uracil-defective minimum medium (0.67% yeast nitrogen base without amino acids (Difco Laboratories, Detroit, MI, USA), 0.19% yeast synthetic drop out medium without uracil (Thermo Fisher Scientific), 4% d -raffinose (Thermo Fisher Scientific) at 28 °C for 6 h. The crtIBY1 gene was expressed by addition of galactose (Thermo Fisher Scientific) to a final concentration of 2%, followed by further incubation for 16 h. For carotenoid analysis, cells from a 50-mL culture were collected by centrifugation (3500 rpm, 10 min, 4 °C), washed with water, and freeze-dried.

    Amplification:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. ..

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: Next, a complex library of random barcodes was inserted as follows: 20 nmoles of a 200-mer oligo , including a high complexity 15-base degenerate region, was amplified by 20 rounds of PCR using Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with BC_F and BC_R primers ( ) at a final concentration of 20 pM each. .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech).

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: The ORF sequences of the EBV genome were amplified from B95-8 EBV-BAC ( ) by PCR using PrimeSTAR Max polymerase (TaKaRa) and the appropriate primers, with overlapping nucleotides. .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions.

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: We obtained full-length EXOSC3 constructs (all exons and intervening introns) by PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB; ) from genomic DNA of a normal subject and the proband of Family 6 (harboring mutation c.475-12A > G). .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: The eGFP gene was amplified using primers eGFP/F and eGFP/R. .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech).

    Selection:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech). .. To maintain complexity, five ligation reactions were carried out and used for 18 independent bacterial transformations with LB-carbenicillin selection.

    Construct:

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: To make reporter constructs, all PCRs were performed with Takara PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Japan). .. Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan).

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: For example, to construct the BGLF2 expression vector, the primers AAACGGGCCCTCTAGA ATGGCATCCGCCGCGAACAG and CGTATGGGTAGAATTC ATAAGAATGTAAGACCTGAC were used, with the sequences in boldface representing the ends of the vector fragment. .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions.

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: Plasmids pRPS-6301, pRPS-6301-F97L, and pRPS-6301-D103V were constructed by cloning Synechococcus sp. 6301 form I Rubisco large and small subunit genes ( rbcLS ) into pRPS-MCS3 without or with the large subunit mutations F97L and D103V, respectively, as described previously ( ). .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ).

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: We obtained full-length EXOSC3 constructs (all exons and intervening introns) by PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB; ) from genomic DNA of a normal subject and the proband of Family 6 (harboring mutation c.475-12A > G). .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: To construct the GFP-tagged PVY clone (The pCB-2μ-PVY-intron-GFP), we utilized two BglII restriction sites located in the PVY NIb gene and vector backbone to linearize the plasmid pCB-2μ-PVY-intron. .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech).

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: To examine the role of RVxF binding motif, mutated constructs (KSVSF to KSASA for PF3D7_0919900, and the introduction of a stop in the second position of the KKVRF motif for PF3D7_0220000) were obtained by a PCR-based site-directed mutagenesis approach using the wild pQE30-PF3D7_0919900 and pETDuet-PF3D7_0220000 constructions as templates, the primers mentioned in Additional file : Table S6 and Isis DNA polymerase (MP Biomedicals). .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    CTL Assay:

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: B . xylophilus ctl-1 and -2 cDNAs were fused with C . elegans ctl-1 or -3 promoters and ligated into the gfp vector pPD95.77 (kindly provided by A. .. Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan).

    Incubation:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: NCI-H508 cells were seeded at 500.000 cells per well in a 6-well plate and incubated at 37°C and 5% CO2 for 48 hours. .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid.

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was obtained using polymerase chain reaction containing 0.15 μg of genomic DNA, 1 unit of KOD FX neo (Toyobo, Osaka, Japan), 0.4 mM of each deoxynucleotide (dNTP), and 0.3 μM of each oligo DNA primer (5’-CAGTGTGCTGGAATTATGGCGCGCAGGGCGTCG-3’ and 5’-GATATCTGCAGAATTTCAGGCA TTCTTGTACAGCGGGAGC-3’) (Fasmac, Kanagawa, Japan) in 50 μL with incubation at 94 °C for 2 min and then 30 cycles of 98 °C for 10 s, 70 °C for 30 s, and 68 °C for 2 min. .. The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA).

    In Silico:

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: For Pips from in silico screening, the A/T rich regions or acidic amino acids were eliminatory to avoid a lack of expression in E.coli . .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    Expressing:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. ..

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: For example, to construct the BGLF2 expression vector, the primers AAACGGGCCCTCTAGA ATGGCATCCGCCGCGAACAG and CGTATGGGTAGAATTC ATAAGAATGTAAGACCTGAC were used, with the sequences in boldface representing the ends of the vector fragment. .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions.

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: plasmid pRPS-MCS3 ( ) is composed of the broad spectrum host plasmid pBBR1-MCS3 containing the R. rubrum cbb promoter and cbbR regulatory gene for expression of Rubisco genes in trans in the R. rubrum host strains. .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ).

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. ..

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: For bacterial expression of GST-ET domain, cDNA sequences were PCR cloned into a pGEX-4T1 vector (#28-9545-49; GE Healthcare). .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: .. For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions. ..

    Western Blot:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. .. Protein expression from the VTI1A-TCF4 expression plasmid was verified by Western Blot, see .

    Transformation Assay:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies). .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech).

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA). .. Stellar competent Escherichia coli cells (Clontech Laboratories) were transformed using a heat shock method.

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. .. The constructions obtained were checked by sequencing and transformed in One Shot® BL21 Star™ (DE3) Chemically Competent E. coli cells (Life Technologies) for expression.

    Transfection:

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: Assessing the functional impact on EXOSC3 splicing of an intronic variant c.475-12A > G We investigated the functional impact of the intronic variant c.475-12A > G on splicing using semi-quantitative RT-PCR in transfected cells. .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: For retroviral and transfection-based expression of NSD3-short, a PIG vector was used containing the human NSD3-short cDNA with a C-terminal 3XFLAG ( , Molecular Cell). .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Sequencing:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. ..

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan). .. We cloned a 1,940 bp sequence upstream from the Ce-ctl-3 start codon for Ce-Pctl-3 , and a 1,600 bp sequence between Ce-ctl-3 and Ce-ctl-1 CDS (coding sequences) for Ce-Pctl-1 .

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: For construction of EBV gene expression vectors, we prepared the following oligonucleotides: AATTC TACCCATACGATGTTCCAGATTACGCT TAAG and GATCCTTA AGCGTAATCTGGAACATCGTATGGGTA G. (The underlined nucleotides indicate the HA sequence.) .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions.

    Article Title: Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi
    Article Snippet: Primer design for Fusarium cyclin C1 gene (FCC1 ) and FUM1 deletions To generate target gene deletion mutants using the In-Fusion® HD Cloning system (Clontech Laboratories Inc., Mountain View, CA, USA), primers were designed using a primer design tool developed by In-Fusion® HD Cloning. .. Thus, a primer will consist of a homologous sequence of 15 to 30 bases at the 5′-end and a gene-specific sequence at the 3′-end.

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech). .. The full-length clones were confirmed by bi-directional Sanger sequencing.

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech). .. Yeast Plasmid Purification Purification of plasmids directly from yeast cells was performed using a modified method [ ].

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. .. The constructions obtained were checked by sequencing and transformed in One Shot® BL21 Star™ (DE3) Chemically Competent E. coli cells (Life Technologies) for expression.

    Ligation:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech). .. To maintain complexity, five ligation reactions were carried out and used for 18 independent bacterial transformations with LB-carbenicillin selection.

    Protease Inhibitor:

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. .. The expression of His6-Pips was carried out in the presence of 0.5 mM IPTG at 37 °C for 2 h. Cells were harvested in sonication buffer (20 mM Tris, 500 mM NaCl, 6 M Guanidine, 20 mM Imidazole and protease inhibitor cocktail (Roche), pH 7.5).

    Cell Culture:

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: Paragraph title: Cell Culture and Plasmids ... All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Generated:

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech). .. Two days after transfection, RNA was extracted by using TRIzol Reagent (Invitrogen). cDNA was generated using Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science) and BGH reverse primer located upstream of the BGH polyadenylation signal on pcDNA3.1/Zeo(+) (Invitrogen; ).

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: Point mutations were generated by overlap PCR. .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: Expression plasmids for GA-KRas (S17N), GA-KRas (Q61L), B1-KRas (S17N), B1-KRas (Q61L), GA-KRas (wild-type), GA-HRas (wild-type), GA-NRas (wild-type), RA-KRas (wild-type), and RA-HRas (wild-type) were generated by inserting each mutant or wild-type K, H, N –Ras into Bsr GI and Bam HI sites of GA-C1, RA-C1, or B3-C1 vectors, respectively. .. For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions.

    Polymerase Chain Reaction:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: Next, a complex library of random barcodes was inserted as follows: 20 nmoles of a 200-mer oligo , including a high complexity 15-base degenerate region, was amplified by 20 rounds of PCR using Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with BC_F and BC_R primers ( ) at a final concentration of 20 pM each. .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech).

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan). .. Fusion genes created in this experiments were Pctl-1 ::Bxy-ctl-1 ::gfp and Pctl-3 ::Bxy-ctl-2 ::gfp , and PCR primer sequences are listed in .

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: The ORF sequences of the EBV genome were amplified from B95-8 EBV-BAC ( ) by PCR using PrimeSTAR Max polymerase (TaKaRa) and the appropriate primers, with overlapping nucleotides. .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions.

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was obtained using polymerase chain reaction containing 0.15 μg of genomic DNA, 1 unit of KOD FX neo (Toyobo, Osaka, Japan), 0.4 mM of each deoxynucleotide (dNTP), and 0.3 μM of each oligo DNA primer (5’-CAGTGTGCTGGAATTATGGCGCGCAGGGCGTCG-3’ and 5’-GATATCTGCAGAATTTCAGGCA TTCTTGTACAGCGGGAGC-3’) (Fasmac, Kanagawa, Japan) in 50 μL with incubation at 94 °C for 2 min and then 30 cycles of 98 °C for 10 s, 70 °C for 30 s, and 68 °C for 2 min. .. The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA).

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ). .. Plasmids pRPS- Rrub-cbbM and pRPS- Rpal-cbbM contain the wild type R. rubrum and Rhodopseudomonas palustris form II Rubisco gene ( cbbM ), respectively, cloned into pRPS-MCS3 as described previously ( , ).

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: We obtained full-length EXOSC3 constructs (all exons and intervening introns) by PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB; ) from genomic DNA of a normal subject and the proband of Family 6 (harboring mutation c.475-12A > G). .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech). .. Yeast Plasmid Purification Purification of plasmids directly from yeast cells was performed using a modified method [ ].

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: To examine the role of RVxF binding motif, mutated constructs (KSVSF to KSASA for PF3D7_0919900, and the introduction of a stop in the second position of the KKVRF motif for PF3D7_0220000) were obtained by a PCR-based site-directed mutagenesis approach using the wild pQE30-PF3D7_0919900 and pETDuet-PF3D7_0220000 constructions as templates, the primers mentioned in Additional file : Table S6 and Isis DNA polymerase (MP Biomedicals). .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: For bacterial expression of GST-ET domain, cDNA sequences were PCR cloned into a pGEX-4T1 vector (#28-9545-49; GE Healthcare). .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: .. For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions. ..

    Sonication:

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions. .. The expression of His6-Pips was carried out in the presence of 0.5 mM IPTG at 37 °C for 2 h. Cells were harvested in sonication buffer (20 mM Tris, 500 mM NaCl, 6 M Guanidine, 20 mM Imidazole and protease inhibitor cocktail (Roche), pH 7.5).

    Recombinant:

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: Paragraph title: Recombinant proteins expression and purification ... For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    Mutagenesis:

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions. .. Mutagenesis of the BGLF2 expression vector or other gene products was performed by PCR using the appropriate primers and then confirmed by sequencing.

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: We obtained full-length EXOSC3 constructs (all exons and intervening introns) by PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB; ) from genomic DNA of a normal subject and the proband of Family 6 (harboring mutation c.475-12A > G). .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: To examine the role of RVxF binding motif, mutated constructs (KSVSF to KSASA for PF3D7_0919900, and the introduction of a stop in the second position of the KKVRF motif for PF3D7_0220000) were obtained by a PCR-based site-directed mutagenesis approach using the wild pQE30-PF3D7_0919900 and pETDuet-PF3D7_0220000 constructions as templates, the primers mentioned in Additional file : Table S6 and Isis DNA polymerase (MP Biomedicals). .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: Expression plasmids for GA-KRas (S17N), GA-KRas (Q61L), B1-KRas (S17N), B1-KRas (Q61L), GA-KRas (wild-type), GA-HRas (wild-type), GA-NRas (wild-type), RA-KRas (wild-type), and RA-HRas (wild-type) were generated by inserting each mutant or wild-type K, H, N –Ras into Bsr GI and Bam HI sites of GA-C1, RA-C1, or B3-C1 vectors, respectively. .. For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions.

    Isolation:

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA). .. Transformants complementing uracil requirement were isolated and cultivated in uracil-defective minimum medium (0.67% yeast nitrogen base without amino acids (Difco Laboratories, Detroit, MI, USA), 0.19% yeast synthetic drop out medium without uracil (Thermo Fisher Scientific), 4% d -raffinose (Thermo Fisher Scientific) at 28 °C for 6 h. The crtIBY1 gene was expressed by addition of galactose (Thermo Fisher Scientific) to a final concentration of 2%, followed by further incubation for 16 h. For carotenoid analysis, cells from a 50-mL culture were collected by centrifugation (3500 rpm, 10 min, 4 °C), washed with water, and freeze-dried.

    Subcloning:

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ). .. Plasmids pRPS- Rrub-cbbM and pRPS- Rpal-cbbM contain the wild type R. rubrum and Rhodopseudomonas palustris form II Rubisco gene ( cbbM ), respectively, cloned into pRPS-MCS3 as described previously ( , ).

    Purification:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: The cells were harvested and total RNA was purified with Total RNA Kit I (Omega Bio-tek, #R5834-02). .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid.

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: Paragraph title: Recombinant proteins expression and purification ... For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: Assessing the functional impact on EXOSC3 splicing of an intronic variant c.475-12A > G We investigated the functional impact of the intronic variant c.475-12A > G on splicing using semi-quantitative RT-PCR in transfected cells. .. The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    shRNA:

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: For shRNA-based competition assays in RN2 cells, the LMN-mCherry shRNA retroviral vectors were used (MSCV-miR30-shRNA-PGKp-NeoR-IRES-mCherry). .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Plasmid Preparation:

    Article Title: The VTI1A-TCF4 colon cancer fusion protein is a dominant negative regulator of Wnt signaling and is transcriptionally regulated by intestinal homeodomain factor CDX2
    Article Snippet: .. The cDNA was amplified with VTI1A-TCF4 sequence specific primers and gel-purified VTI1A-TCF7L2 sequence was cloned into NheI digested pLVX-CherryPicker2 vector (Clontech, #632581) using the In-Fusion cloning system (Clontech, #639649) resulting in the VTI1A-TCF4 fusion protein expression plasmid. ..

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: Bacterial transformants were selected on LB-carbenicillin plates and analyzed by restriction digest to identify the repaired plasmid. .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech).

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: B . xylophilus ctl-1 and -2 cDNAs were fused with C . elegans ctl-1 or -3 promoters and ligated into the gfp vector pPD95.77 (kindly provided by A. .. Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan).

    Article Title: BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection
    Article Snippet: .. The linearized pcDNA-HA vector and each EBV ORF were linked using the In-Fusion cloning system (TaKaRa), according to the manufacturer’s instructions. .. After preparing the HA-tagged expression vectors, we verified that the sequences of the inserted EBV genes were identical to the sequences in the database (v01555.2).

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: .. The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA). .. Stellar competent Escherichia coli cells (Clontech Laboratories) were transformed using a heat shock method.

    Article Title: Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi
    Article Snippet: Primer design for Fusarium cyclin C1 gene (FCC1 ) and FUM1 deletions To generate target gene deletion mutants using the In-Fusion® HD Cloning system (Clontech Laboratories Inc., Mountain View, CA, USA), primers were designed using a primer design tool developed by In-Fusion® HD Cloning. .. To successfully clone any DNA fragment, the primers used must be designed to share an overlap of at least 15 homologous bases between the end of the linearized vector and/or the desired fragment.

    Article Title: In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways * Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Di
    Article Snippet: .. The form III Rubisco gene ( rcbL ) of Methanococcoides burtonii strain DSM6242 was cloned from genomic DNA (gift of Dr. Kevin Sowers) into pCR-BluntII-TOPO (Invitrogen) using primers (ATGAGTTTAATCTATGAGG and TTATCTATTCAAATAGAACTC), followed by subcloning into PstI- and XbaI- (New England Biolabs) digested pRPS-MCS3 using the In-Fusion cloning system (Clontech) and primers (TTGATATCGAATTCCTGCAGATGAGTTTAATCTATGAGGACCTGGTAAAATCG and TGGCGGCCGCTCTAGATTATCTATTCAAATAGAACTCGATCGCTTCTGC) to create plasmid pRPS-MBR ( ). .. Plasmids pRPS- Rrub-cbbM and pRPS- Rpal-cbbM contain the wild type R. rubrum and Rhodopseudomonas palustris form II Rubisco gene ( cbbM ), respectively, cloned into pRPS-MCS3 as described previously ( , ).

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech). .. Yeast Plasmid Purification Purification of plasmids directly from yeast cells was performed using a modified method [ ].

    Article Title: Structural Mechanism of Transcriptional Regulator NSD3 Recognition by the ET Domain of BRD4
    Article Snippet: For bacterial expression of GST-ET domain, cDNA sequences were PCR cloned into a pGEX-4T1 vector (#28-9545-49; GE Healthcare). .. All of the cloning procedures were performed using the In-Fusion cloning system (#638909; Clontech)

    Article Title: Intensiometric biosensors visualize the activity of multiple small GTPases in vivo
    Article Snippet: Paragraph title: Plasmid construction ... For the generation of GA-GA and B3-B3 expression vectors, PCR-amplified GA and B3 were inserted into Bsr GI site of GA-C1 and B3-C1, respectively, using In-Fusion cloning system (Clontech) according to the manufacturer’s instructions.

    Functional Assay:

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: Paragraph title: 2.10. Functional Assay of crtIBY ... The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA).

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: Paragraph title: Assessing the functional impact on EXOSC3 splicing of an intronic variant c.475-12A > G ... The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Binding Assay:

    Article Title: Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
    Article Snippet: To examine the role of RVxF binding motif, mutated constructs (KSVSF to KSASA for PF3D7_0919900, and the introduction of a stop in the second position of the KKVRF motif for PF3D7_0220000) were obtained by a PCR-based site-directed mutagenesis approach using the wild pQE30-PF3D7_0919900 and pETDuet-PF3D7_0220000 constructions as templates, the primers mentioned in Additional file : Table S6 and Isis DNA polymerase (MP Biomedicals). .. For the expression of Pips, the pETDuet-1 (Novagen) or pQE30 (Qiagen) expression system and the In-Fusion HD Cloning system (Clontech) were used according to the supplier’s instructions.

    In Vitro:

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: .. All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech). .. Yeast Plasmid Purification Purification of plasmids directly from yeast cells was performed using a modified method [ ].

    Transgenic Assay:

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: Paragraph title: Transgenic C . elegans construction ... Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan).

    Concentration Assay:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: Next, a complex library of random barcodes was inserted as follows: 20 nmoles of a 200-mer oligo , including a high complexity 15-base degenerate region, was amplified by 20 rounds of PCR using Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with BC_F and BC_R primers ( ) at a final concentration of 20 pM each. .. The DNA from 24 separate reactions was pooled and ligated to the linearized pCL2 at its unique Sma I site using the In-Fusion HD Cloning System (Clontech).

    Article Title: Catalases Induction in High Virulence Pinewood Nematode Bursaphelenchus xylophilus under Hydrogen Peroxide-Induced Stress
    Article Snippet: Fire, Stanford University) with In-Fusion HD Cloning system (Takara Bio Inc., Japan). .. Each reporter construct (100 μg/ml) was co-injected with an equal concentration of pDP#MM016B into the gonadal arms of unc-119(ed3) adult hermaphrodites to obtain KHA149 {unc-119(ed3)III; chuEx149[Pctl-1 ::Bxy-ctl-1 ::gfp , pDP#MM016B]} , KHA150 {unc-119(ed3)III; chuEx150[Pctl-1 ::Bxy-ctl-1 ::gfp , pDP#MM016B]} , KHA151 {unc-119(ed3)III; chuEx151[Pctl-3 ::Bxy-ctl-2 ::gfp , pDP#MM016B]} , and KHA152 {unc-119(ed3)III; chuEx152[Pctl-3 ::Bxy-ctl-2 ::gfp , pDP#MM016B]} .

    Article Title: A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105
    Article Snippet: The crtIBY1 gene was ligated to the EcoRI-digested vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) using the In-fusion HD system (Clontech Laboratories, Mountain View, CA, USA). .. Transformants complementing uracil requirement were isolated and cultivated in uracil-defective minimum medium (0.67% yeast nitrogen base without amino acids (Difco Laboratories, Detroit, MI, USA), 0.19% yeast synthetic drop out medium without uracil (Thermo Fisher Scientific), 4% d -raffinose (Thermo Fisher Scientific) at 28 °C for 6 h. The crtIBY1 gene was expressed by addition of galactose (Thermo Fisher Scientific) to a final concentration of 2%, followed by further incubation for 16 h. For carotenoid analysis, cells from a 50-mL culture were collected by centrifugation (3500 rpm, 10 min, 4 °C), washed with water, and freeze-dried.

    Variant Assay:

    Article Title: Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration
    Article Snippet: Paragraph title: Assessing the functional impact on EXOSC3 splicing of an intronic variant c.475-12A > G ... The gel extracted amplicons were cloned into pcDNA3.1/Zeo(+) (linearized with BamH I and Xho I; Invitrogen) by using the In-Fusion® HD Cloning System (Clonetech).

    Homologous Recombination:

    Article Title: Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector
    Article Snippet: Paragraph title: 2.3. Assembly of SYNV and PVY cDNA Clones by Yeast Homologous Recombination ... All the three PCR products and the linearized vector were designed to share a 15-nt homologous sequence and were assembled in vitro in the presence of an In-Fusion Cloning mixture (Clonetech).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa in fusion pcr cloning kit
    Standard assembly versus In-Fusion assembly. ( a ) Standard Assembly of two <t>BioBricks</t> (Parts A and B) involves restriction digestion and ligation. Both parts are on pSB1A2 vectors encoding ampicillin resistance. The Part A plasmid is digested with EcoRI (E) and SpeI (S), while the second plasmid is digested with EcoRI (E) and XbaI (X). SpeI and XbaI restricted fragments have compatible sticky ends for ligation. The desired digested fragments are gel purified and ligated together to create the assembled plasmid with both parts. A scar sequence is left between both parts that does not have the original restriction site and the restriction sites flanking the parts are maintained. ( b ) In-Fusion assembly of two BioBricks involves <t>PCR,</t> purification, and a subsequent In-Fusion reaction. Parts A and B are PCR-amplified (in this example the vector is amplified with Part B) and purified without gel extraction. Each assembly requires four primers, where two are specific to the junction (parts to assemble) and two are general vector primers. BioBrick Part A (blue) and Part B (red) are on pSB1A2 plasmids encoding ampicillin resistance. Primers described in ‘Materials and Methods’ section are color-coded to show their homology. The thick black line indicates BioBrick prefix or suffix homology on the pSB1A2 vector. The yellow sequence is the scar that is normally between parts after standard BioBrick assembly, if this is desired, or can be a linker sequence for a fusion protein. The purified PCR products are fused together in the In-Fusion reaction to create a circular plasmid. Restriction sites flanking the parts maintain the standard BioBrick format.
    In Fusion Pcr Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1716 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in fusion pcr cloning kit/product/TaKaRa
    Average 99 stars, based on 1716 article reviews
    Price from $9.99 to $1999.99
    in fusion pcr cloning kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Standard assembly versus In-Fusion assembly. ( a ) Standard Assembly of two BioBricks (Parts A and B) involves restriction digestion and ligation. Both parts are on pSB1A2 vectors encoding ampicillin resistance. The Part A plasmid is digested with EcoRI (E) and SpeI (S), while the second plasmid is digested with EcoRI (E) and XbaI (X). SpeI and XbaI restricted fragments have compatible sticky ends for ligation. The desired digested fragments are gel purified and ligated together to create the assembled plasmid with both parts. A scar sequence is left between both parts that does not have the original restriction site and the restriction sites flanking the parts are maintained. ( b ) In-Fusion assembly of two BioBricks involves PCR, purification, and a subsequent In-Fusion reaction. Parts A and B are PCR-amplified (in this example the vector is amplified with Part B) and purified without gel extraction. Each assembly requires four primers, where two are specific to the junction (parts to assemble) and two are general vector primers. BioBrick Part A (blue) and Part B (red) are on pSB1A2 plasmids encoding ampicillin resistance. Primers described in ‘Materials and Methods’ section are color-coded to show their homology. The thick black line indicates BioBrick prefix or suffix homology on the pSB1A2 vector. The yellow sequence is the scar that is normally between parts after standard BioBrick assembly, if this is desired, or can be a linker sequence for a fusion protein. The purified PCR products are fused together in the In-Fusion reaction to create a circular plasmid. Restriction sites flanking the parts maintain the standard BioBrick format.

    Journal: Nucleic Acids Research

    Article Title: In-Fusion BioBrick assembly and re-engineering

    doi: 10.1093/nar/gkq179

    Figure Lengend Snippet: Standard assembly versus In-Fusion assembly. ( a ) Standard Assembly of two BioBricks (Parts A and B) involves restriction digestion and ligation. Both parts are on pSB1A2 vectors encoding ampicillin resistance. The Part A plasmid is digested with EcoRI (E) and SpeI (S), while the second plasmid is digested with EcoRI (E) and XbaI (X). SpeI and XbaI restricted fragments have compatible sticky ends for ligation. The desired digested fragments are gel purified and ligated together to create the assembled plasmid with both parts. A scar sequence is left between both parts that does not have the original restriction site and the restriction sites flanking the parts are maintained. ( b ) In-Fusion assembly of two BioBricks involves PCR, purification, and a subsequent In-Fusion reaction. Parts A and B are PCR-amplified (in this example the vector is amplified with Part B) and purified without gel extraction. Each assembly requires four primers, where two are specific to the junction (parts to assemble) and two are general vector primers. BioBrick Part A (blue) and Part B (red) are on pSB1A2 plasmids encoding ampicillin resistance. Primers described in ‘Materials and Methods’ section are color-coded to show their homology. The thick black line indicates BioBrick prefix or suffix homology on the pSB1A2 vector. The yellow sequence is the scar that is normally between parts after standard BioBrick assembly, if this is desired, or can be a linker sequence for a fusion protein. The purified PCR products are fused together in the In-Fusion reaction to create a circular plasmid. Restriction sites flanking the parts maintain the standard BioBrick format.

    Article Snippet: The method described here is an alternative assembly strategy that allows for two or more PCR-amplified BioBricks to be quickly assembled and re-engineered using the Clontech In-Fusion PCR Cloning Kit.

    Techniques: Ligation, Plasmid Preparation, Purification, Sequencing, Polymerase Chain Reaction, Amplification, Gel Extraction

    MTA1 transcriptionally suppresses p21 WAF1 by recruitment of the MTA1-HDAC2 complex onto the p21 WAF1 promoter. A and B , Western blot ( A ) or qPCR ( B ) analysis of p21 WAF1 expression in the MTA1 +/+ or MTA1 −/− MEFs. The relative fold-increase of p21 WAF1 mRNA levels in the MTA1 −/− MEFs relative to the wild-type controls are shown in B . Each value represents the mean ± S.E. of three independent experiments. C , MTA1 +/+ or MTA1 −/− MEFs were transfected with the pGL3 -p21 WAF1 luciferase reporter plasmid as well as the pCMVβ vector carrying the β-galactosidase gene as an internal control for transfection efficiency. After 36 h of transfection, cells were lysed and luciferase activities in triplicate samples were determined. Luciferase values (relative light units) were calculated by dividing the luciferase activity by the β-galactosidase activity and normalized to controls. Values are reported as the fold-increase in the MTA1 −/− MEFs over the wild-type controls and represent the mean ± S.E. from three independent transfection experiments. D , ChIP analysis of recruitment of MTA1 on the p21 WAF1 promoter. MTA1 +/+ or MTA1 −/− MEFs were treated with 1% formaldehyde to cross-link histones to DNA, lysed by sonication, and immunoprecipitated ( IP ) with anti-MTA1 antibody or IgG control. The immunoprecipitates were washed, the DNA was eluted from the beads, and purified DNA was subjected to PCR. E , double ChIP analysis of recruitment of the MTA1-HDAC2 complex onto the p21 WAF1 promoter. The first ChIP was carried out with anti-MTA1 antibody, followed by a second ChIP with anti-HDAC2 antibody. F , ChIP analysis of recruitment of the p53 protein on the p21 WAF1 promoter using MTA1 +/+ or MTA1 −/− MEFs. G , ChIP analysis of recruitment of the MTA1 protein on the p21 WAF1 promoter using p53 +/+ or p53 −/− MEFs. Error bars represent S.E.

    Journal: The Journal of Biological Chemistry

    Article Title: Revelation of p53-independent Function of MTA1 in DNA Damage Response via Modulation of the p21WAF1-Proliferating Cell Nuclear Antigen Pathway *

    doi: 10.1074/jbc.M109.079095

    Figure Lengend Snippet: MTA1 transcriptionally suppresses p21 WAF1 by recruitment of the MTA1-HDAC2 complex onto the p21 WAF1 promoter. A and B , Western blot ( A ) or qPCR ( B ) analysis of p21 WAF1 expression in the MTA1 +/+ or MTA1 −/− MEFs. The relative fold-increase of p21 WAF1 mRNA levels in the MTA1 −/− MEFs relative to the wild-type controls are shown in B . Each value represents the mean ± S.E. of three independent experiments. C , MTA1 +/+ or MTA1 −/− MEFs were transfected with the pGL3 -p21 WAF1 luciferase reporter plasmid as well as the pCMVβ vector carrying the β-galactosidase gene as an internal control for transfection efficiency. After 36 h of transfection, cells were lysed and luciferase activities in triplicate samples were determined. Luciferase values (relative light units) were calculated by dividing the luciferase activity by the β-galactosidase activity and normalized to controls. Values are reported as the fold-increase in the MTA1 −/− MEFs over the wild-type controls and represent the mean ± S.E. from three independent transfection experiments. D , ChIP analysis of recruitment of MTA1 on the p21 WAF1 promoter. MTA1 +/+ or MTA1 −/− MEFs were treated with 1% formaldehyde to cross-link histones to DNA, lysed by sonication, and immunoprecipitated ( IP ) with anti-MTA1 antibody or IgG control. The immunoprecipitates were washed, the DNA was eluted from the beads, and purified DNA was subjected to PCR. E , double ChIP analysis of recruitment of the MTA1-HDAC2 complex onto the p21 WAF1 promoter. The first ChIP was carried out with anti-MTA1 antibody, followed by a second ChIP with anti-HDAC2 antibody. F , ChIP analysis of recruitment of the p53 protein on the p21 WAF1 promoter using MTA1 +/+ or MTA1 −/− MEFs. G , ChIP analysis of recruitment of the MTA1 protein on the p21 WAF1 promoter using p53 +/+ or p53 −/− MEFs. Error bars represent S.E.

    Article Snippet: Mutant mouse p21WAF1 promoter lacking the MTA1 binding region was constructed by cloning the PCR product amplified from the mouse p21WAF1 promoter (region from −1860 to −632) using the forward primer (5′-TAGCCCGGGCTCGAGAGATATCCGTTCGTTCAAACTAAGACTCC-3′) and reverse primer (5′-CCGGAATGCCAAGCTTGAGGCACGAGGGGCGTTACAGGTTCAA-3′), and then cloned into a pGL3 basic vector after digesting with XhoI and HindIII using the Clontech Infusion PCR cloning kit (Clontech).

    Techniques: Western Blot, Real-time Polymerase Chain Reaction, Expressing, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Chromatin Immunoprecipitation, Sonication, Immunoprecipitation, Purification, Polymerase Chain Reaction

    Overview of In-Fusion enzyme-based cloning of a single sgRNA. a Schematics of the final assembled CRISPR guide RNA cassette, along with the location of primers is shown in the top panel. b Using a set of two universal primers (p1F and g2R) and two sgRNA-specific primers (g1F and p1R), two fragments, A and B, are PCR-amplified using pEN-Chimera-ccdB plasmid as a template that contains AtU6-26(P) promoter and gRNA separated by the ccdB gene (Fig. 1 ). This PCR incorporates the 20-nt protospacer sgRNA sequence to the 3′ end of AtU6-26 promoter in fragments A, and a 15-bp overlap of the 3′ end of the protospacer sgRNA to the 5′ end of fragment B. c These two fragments are then fused using the In-Fusion ® HD cloning kit with the Cas9-containig pDe-Cas9 fragment, which is amplified with primers 3-AvrII and 5-MluI or obtained by digestion with Avr II/ Mlu I restriction enzymes. Alternatively, fragments A and B can also be fused with pUC57GW amplified with primers 3-AvrII and 5-MluI, which contains the attL1 and attL2 sites for subsequent Gateway ® LR cloning in a plant expression destination vector that contains R1 and R2 sites such as pDe-Cas9

    Journal: Plant Methods

    Article Title: A highly efficient ligation-independent cloning system for CRISPR/Cas9 based genome editing in plants

    doi: 10.1186/s13007-017-0236-9

    Figure Lengend Snippet: Overview of In-Fusion enzyme-based cloning of a single sgRNA. a Schematics of the final assembled CRISPR guide RNA cassette, along with the location of primers is shown in the top panel. b Using a set of two universal primers (p1F and g2R) and two sgRNA-specific primers (g1F and p1R), two fragments, A and B, are PCR-amplified using pEN-Chimera-ccdB plasmid as a template that contains AtU6-26(P) promoter and gRNA separated by the ccdB gene (Fig. 1 ). This PCR incorporates the 20-nt protospacer sgRNA sequence to the 3′ end of AtU6-26 promoter in fragments A, and a 15-bp overlap of the 3′ end of the protospacer sgRNA to the 5′ end of fragment B. c These two fragments are then fused using the In-Fusion ® HD cloning kit with the Cas9-containig pDe-Cas9 fragment, which is amplified with primers 3-AvrII and 5-MluI or obtained by digestion with Avr II/ Mlu I restriction enzymes. Alternatively, fragments A and B can also be fused with pUC57GW amplified with primers 3-AvrII and 5-MluI, which contains the attL1 and attL2 sites for subsequent Gateway ® LR cloning in a plant expression destination vector that contains R1 and R2 sites such as pDe-Cas9

    Article Snippet: Expected fragments (ccdB and CmR genes, 1569 bp and pEN-Chimera backbone, 3738 bp) were gel purified (QIAquick Gel Extraction Kit, Cat#28706, Qiagen) and cloned together using the In-Fusion® HD cloning Kit (Cat#639648, Clontech) according to manufacturer’s instructions.

    Techniques: Clone Assay, CRISPR, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing, Expressing

    Overview of In-Fusion ® -based cloning of two gRNA targets for paired nickases (Cas9-D10A). a Illustration of cloning strategy. Schematics of final gRNA cassette is shown in the top panel. Using a set of four universal primers (p1F, p2F, g1R and g2R) and four target-specific primers (g1F and p1R for protospacer target 1, and g2F and p2R for protospacer target 2), four fragments, A, B, C and D are PCR amplified using pEn-Chimera-ccdB plasmid in Round 1 PCR. In Round 2 PCR, using primers p1F and g1R, fragments A and B are fused resulting in fragment AB, and using primers p2F and g2R, fragments C and D are fused resulting in fragment CD. In Step 3, fragments AB and CD are cloned into pDe-Cas9-D10A or pUC57GW using the In-Fusion ® HD cloning system. b A representative gel picture showing PCR fragments of YFP upper panel, SlMLO1, NbPDS and mCherry lower panel. Expected sizes of each fragment are shown on the left. c Protospacer sequences of the targeted genes ( YFP upper panel, NbPDS middle panel, and mCherry lower panel) are highlighted in purple background and the PAM sequences NGG in red background

    Journal: Plant Methods

    Article Title: A highly efficient ligation-independent cloning system for CRISPR/Cas9 based genome editing in plants

    doi: 10.1186/s13007-017-0236-9

    Figure Lengend Snippet: Overview of In-Fusion ® -based cloning of two gRNA targets for paired nickases (Cas9-D10A). a Illustration of cloning strategy. Schematics of final gRNA cassette is shown in the top panel. Using a set of four universal primers (p1F, p2F, g1R and g2R) and four target-specific primers (g1F and p1R for protospacer target 1, and g2F and p2R for protospacer target 2), four fragments, A, B, C and D are PCR amplified using pEn-Chimera-ccdB plasmid in Round 1 PCR. In Round 2 PCR, using primers p1F and g1R, fragments A and B are fused resulting in fragment AB, and using primers p2F and g2R, fragments C and D are fused resulting in fragment CD. In Step 3, fragments AB and CD are cloned into pDe-Cas9-D10A or pUC57GW using the In-Fusion ® HD cloning system. b A representative gel picture showing PCR fragments of YFP upper panel, SlMLO1, NbPDS and mCherry lower panel. Expected sizes of each fragment are shown on the left. c Protospacer sequences of the targeted genes ( YFP upper panel, NbPDS middle panel, and mCherry lower panel) are highlighted in purple background and the PAM sequences NGG in red background

    Article Snippet: Expected fragments (ccdB and CmR genes, 1569 bp and pEN-Chimera backbone, 3738 bp) were gel purified (QIAquick Gel Extraction Kit, Cat#28706, Qiagen) and cloned together using the In-Fusion® HD cloning Kit (Cat#639648, Clontech) according to manufacturer’s instructions.

    Techniques: Clone Assay, Polymerase Chain Reaction, Amplification, Plasmid Preparation

    Construction and schematic of plasmid. a pEn-Chimera-ccdB. A cassette consisting of chloramphenicol resistance gene ( CmR ) and the ccdB gene was PCR-amplified and inserted between the AtU6-26(P) promoter and the sgRNA of pEn-Chimera [ 22 ] using the In-Fusion ® HD cloning strategy as described in “ Methods ” section. Plasmid pEn-Chimera-ccdB is used as template in PCR for fusing the 20-nucleotide protospacer sequence to the AtU6-26 promoter and sgRNA. Using the ccdB gene virtually eliminated any background colonies, which could arise due to incomplete digestion of pEn-Chimera using the restriction enzymes-based cloning method. b pDe-Cas9-D10A-2 gRNA: Schematic illustration of pDe-Cas9-D10A after two gRNA constructs, gRNA1 and gRNA2, are directly cloned in this vector using the In-Fusion ® HD cloning system. c pUC57GW: this is an in-house constructed Gateway ® -compatible Entry vector, which, in contrast to commonly used Gateway ® Entry/DONR vectors, contains the ccdB and Chloranphenicol ( CmR ) resistance genes. This unique design allows efficient cloning of gRNAs constructs in this vector using the In-Fusion ® HD cloning system without any background colonies. Please see “ Methods ” and “ Results ” section for details

    Journal: Plant Methods

    Article Title: A highly efficient ligation-independent cloning system for CRISPR/Cas9 based genome editing in plants

    doi: 10.1186/s13007-017-0236-9

    Figure Lengend Snippet: Construction and schematic of plasmid. a pEn-Chimera-ccdB. A cassette consisting of chloramphenicol resistance gene ( CmR ) and the ccdB gene was PCR-amplified and inserted between the AtU6-26(P) promoter and the sgRNA of pEn-Chimera [ 22 ] using the In-Fusion ® HD cloning strategy as described in “ Methods ” section. Plasmid pEn-Chimera-ccdB is used as template in PCR for fusing the 20-nucleotide protospacer sequence to the AtU6-26 promoter and sgRNA. Using the ccdB gene virtually eliminated any background colonies, which could arise due to incomplete digestion of pEn-Chimera using the restriction enzymes-based cloning method. b pDe-Cas9-D10A-2 gRNA: Schematic illustration of pDe-Cas9-D10A after two gRNA constructs, gRNA1 and gRNA2, are directly cloned in this vector using the In-Fusion ® HD cloning system. c pUC57GW: this is an in-house constructed Gateway ® -compatible Entry vector, which, in contrast to commonly used Gateway ® Entry/DONR vectors, contains the ccdB and Chloranphenicol ( CmR ) resistance genes. This unique design allows efficient cloning of gRNAs constructs in this vector using the In-Fusion ® HD cloning system without any background colonies. Please see “ Methods ” and “ Results ” section for details

    Article Snippet: Expected fragments (ccdB and CmR genes, 1569 bp and pEN-Chimera backbone, 3738 bp) were gel purified (QIAquick Gel Extraction Kit, Cat#28706, Qiagen) and cloned together using the In-Fusion® HD cloning Kit (Cat#639648, Clontech) according to manufacturer’s instructions.

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing, Construct