|
ATCC
modesticaldum strain ice1 Modesticaldum Strain Ice1, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/modesticaldum strain ice1/product/ATCC Average 94 stars, based on 1 article reviews
modesticaldum strain ice1 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
DSMZ
strain h. modesticaldum ice1 Strain H. Modesticaldum Ice1, supplied by DSMZ, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/strain h. modesticaldum ice1/product/DSMZ Average 90 stars, based on 1 article reviews
strain h. modesticaldum ice1 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Agrisera
anti-ice1 antibody no. as16 3971 ![]() Anti Ice1 Antibody No. As16 3971, supplied by Agrisera, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-ice1 antibody no. as16 3971/product/Agrisera Average 90 stars, based on 1 article reviews
anti-ice1 antibody no. as16 3971 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
TaKaRa
itln1 ice1 rev 5 cccaaaaccaacaccaactc 3 primers ![]() Itln1 Ice1 Rev 5 Cccaaaaccaacaccaactc 3 Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/itln1 ice1 rev 5 cccaaaaccaacaccaactc 3 primers/product/TaKaRa Average 86 stars, based on 1 article reviews
itln1 ice1 rev 5 cccaaaaccaacaccaactc 3 primers - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
TaKaRa
itln1 ice1 fwd primer ![]() Itln1 Ice1 Fwd Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/itln1 ice1 fwd primer/product/TaKaRa Average 86 stars, based on 1 article reviews
itln1 ice1 fwd primer - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Hasegawa Co Ltd
ice1 ser403 ![]() Ice1 Ser403, supplied by Hasegawa Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ice1 ser403/product/Hasegawa Co Ltd Average 90 stars, based on 1 article reviews
ice1 ser403 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Hasegawa Co Ltd
siz1-mediated sumoylation of ice1 ![]() Siz1 Mediated Sumoylation Of Ice1, supplied by Hasegawa Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/siz1-mediated sumoylation of ice1/product/Hasegawa Co Ltd Average 90 stars, based on 1 article reviews
siz1-mediated sumoylation of ice1 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ATCC
heliomicrobium modesticaldum ice1 3548 ![]() Heliomicrobium Modesticaldum Ice1 3548, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/heliomicrobium modesticaldum ice1 3548/product/ATCC Average 94 stars, based on 1 article reviews
heliomicrobium modesticaldum ice1 3548 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
Journal: Plants
Article Title: Brassica rapa BrICE1 and BrICE2 Positively Regulate the Cold Tolerance via CBF and ROS Pathways, Balancing Growth and Defense in Transgenic Arabidopsis
doi: 10.3390/plants13182625
Figure Lengend Snippet: Phylogenetic analysis of ICE1 homologous genes in Brassica species. The phylogenetic tree was constructed by neighbor-joining distance using MEGA 6.0. A total of 42 ICE1 homologous genes were identified from Brassica species. Well-known ICE1 and ICE2 homologous genes of dicotyledon Arabidopsis thaliana , tomato ( Solanum lycopersicum ), soybean ( Glycine max ), monocotyledon maize ( Zea mays ), foxtail millet ( Setaria italica ) and rice ( Oryza sativa ) were used as the outgroup. BrICE , BraICE , BoICE , BniICE , BnICE , BjuICE and BcaICE stand for the ICE1 homologous genes of Z1 ( B. rapa , yellow sarson, as an oilseed crop), Chiifu-401-42 ( B. rapa , Chinese cabbage, as a vegetable), B. oleracea , B. nigra , B. napus , B. juncea and B. carinata , respectively. The red-filled triangle, red-filled square and red-filled circle represent ICE1 homologous genes of Arabidopsis , B. rapa (Chiifu-401-42, as a vegetable) and B. rapa (Z1, as an oilseed crop).
Article Snippet: ICE1 protein was detected using a specific
Techniques: Construct
Journal: Plants
Article Title: Brassica rapa BrICE1 and BrICE2 Positively Regulate the Cold Tolerance via CBF and ROS Pathways, Balancing Growth and Defense in Transgenic Arabidopsis
doi: 10.3390/plants13182625
Figure Lengend Snippet: Low temperature induces the expression of ICE1 homologous genes in Brassica species. The 14-day-old seedlings were low-temperature treated at 4 °C for 6 h, 12 h and 24 h, while the expression levels of ICE1 homologous genes were determined by qRT–PCR. BrACTIN2 was used as the control. ( A ) The expression profiles of six BnICE1 homologous genes in Westar. ( B – D ) The expression profiles of four BrICE1 homologous genes in Tianyou 2, Longyou 6 and Longyou 8. Values are shown as mean ± SD ( n = 3) of three independent experiments. Statistically significant differences are indicated by asterisks (Student’s t -test, *, p < 0.05, **, p < 0.01).
Article Snippet: ICE1 protein was detected using a specific
Techniques: Expressing, Quantitative RT-PCR, Control
Journal: Plants
Article Title: Brassica rapa BrICE1 and BrICE2 Positively Regulate the Cold Tolerance via CBF and ROS Pathways, Balancing Growth and Defense in Transgenic Arabidopsis
doi: 10.3390/plants13182625
Figure Lengend Snippet: Cold-induced degradation of BrICE1 and BrICE2 depends on the 26S-proteasome pathway. The 14-day-old wild-type and transgenic seedlings were treated at 4 °C for 1 to 24 h with or without 100 mM CHX and 50 mM MG132. Total protein was extracted and immunoblotting was performed using specific anti-ICE1 and anti-GFP antibodies. Coomassie brilliant blue (CBB) was used as the control for protein loading. The integrated optical density (IOD) values of ICE1 bands were quantified. ( A , B ) Immunoblotting assays to assess the protein level in wild-type and transgenic seedlings without CHX and MG132 treatment using specific anti-ICE1 ( A ) and anti-GFP ( B ) antibodies. ( C , D ) Immunoblotting assays to assess the protein levels in wild-type and transgenic seedlings with CHX and MG132 treatment using specific anti-ICE1 ( A ) and anti-GFP ( B ) antibodies.
Article Snippet: ICE1 protein was detected using a specific
Techniques: Transgenic Assay, Western Blot, Control
Journal: Nature Communications
Article Title: A common polymorphism in the Intelectin-1 gene influences mucus plugging in severe asthma
doi: 10.1038/s41467-024-48034-5
Figure Lengend Snippet: a Chronic IL-13 stimulation model of airway epithelial T2 inflammation as illustrated by H&E staining and immunofluorescent (IF) labeling of MUC5AC (red), MUC5B (green), and nuclei (blue); images are representative of 8 paired donors analyzed; scale bar 30 µM. b Box plot of normalized ITLN1 gene expression in baseline (control) and IL-13-treated ALI cultures ( n = 19 donors). FDR-adjusted (Benjamini-Hochberg method) two-sided p value is based on a paired exact test (edgeR). Box centers = median, upper and lower box bounds = 1st and 3rd quartiles, whiskers extend from these bounds up to 1.5 × IQR (inter-quartile range), and data beyond whiskers are plotted as points. c Connectivity among genes within a co-expression network that includes ITLN1 . Genes shown are those annotated for the enriched functional terms and pathways indicated. Genes with direct connections to ITLN1 are highlighted in red and edge width indicates strength of connectivity. Node color denotes functional annotation, and node size increases with eigengene-based connectivity to the network. d Enrichment of ITLN1 co-expression network genes in mucus secretory cells, compared to all other defined airway epithelial lung cell populations identified by scRNA-seq. FDR-adjusted two-sided p-values are based on a one-sided hypergeometric test. e Immunofluorescent labeling shows IL-13-induced expression of ITLN-1 in a subset of MUC5AC + secretory cells; MUC5AC (red), ITLN-1 (green), nuclei (blue); Images are representative of 8 paired donors analyzed; scale bar 30 µM. f Boxplots of normalized ITLN-1 peptides measured in apical ALI secretions following control and chronic IL-13 stimulation (aqueous fraction n = 14 donors, mucus fraction n = 9 donors). FDR-adjusted two-sided p values are based on a paired exact test (edgeR). LFC = log fold change. Box plots as defined in b . g Confocal imaging analysis of mucociliary ALI cultures stimulated with IL-13 illustrating ITLN-1 presence within the airway mucus on the apical side of mucociliary epithelium; MUC5AC (red), ITLN-1 (green), F-actin (white); black arrows—apical cell membrane, yellow arrows—mucus layer; XY image scale bar 10 µm; YZ image scale bar 2.5 µm; images are representative of ALI cultures labeled from n = 3 HBEC donors. Source data are provided as a Source Data file.
Article Snippet: PCR amplification was performed using 25 ng of input DNA from each sample, with 0.2 μM of
Techniques: Staining, Labeling, Expressing, Functional Assay, Imaging, Membrane
Journal: Nature Communications
Article Title: A common polymorphism in the Intelectin-1 gene influences mucus plugging in severe asthma
doi: 10.1038/s41467-024-48034-5
Figure Lengend Snippet: a Schematic of the gene structure of ITLN1 , the targeted CRISPR-Cas9 editing site, and the resultant DNA editing as determined by high-resolution melt curve analysis. The plot (bottom) shows differences in melt temperature profiles from pooled ALI inserts ( n = 3/condition) for ITLN1 KO (red) samples from each donor assayed by HRM analysis. The scramble control DNA melt temperature profile (blue) was set as the reference for each donor ( n = 3 donors). b Western blot quantitation of ITLN-1 (35 kDa) in apical washes collected from mock or IL-13-stimulated mucociliary ALI cultures differentiated from control edited (scrb; blue) and ITLN1 KO basal cells (red); Western blot image is representative of all measured data, and band intensity plot reflects data from conditions from all edited donors ( n = 3); Two-sided p values calculated using paired Student’s t test. c Box plots showing the log of average particle speed within control edited (scrb) and ITLN1 KO mucociliary cultures that were mock- (BSA, white boxes) or IL-13-stimulated (gray boxes), with replicate experiments carried out using no wash, PBS wash, PBS-DTT wash, and ATP + PBS-DTT wash regimes. Data values represent the log of average speed of all measured particles within each video from the MCM assays, where there are an average of n = 18 videos for each of the 16 total conditions (2 gene-edited statuses × 2 treatments × 4 washes) per donor. Videos were captured across 6–7 fields of view across the culture to account for variation across the culture, measured across n = 3 individual ALI inserts from each of the edited donors ( n = 3)—with each donor identified by a different color in the plot). The exact sample sizes per box, left to right, are 54, 55, 56, 55, 55, 54, 58, 58, 55, 55, 55, 56, 56, 54, 55, 58. Above plots are given the estimated percent recovery (and associated p values) of particle speed in IL-13-stimulated cultures relative to BSA cultures when in an ITLN1 KO epithelium compared to the control (scrb) epithelium. Two-sided p values are based on linear mixed model t tests, with random effects for donor and insert, and use Satterthwaite approximation of degrees of freedom. Box centers = median, upper and lower box bounds = 1st and 3rd quartiles, whiskers extend from these bounds up to 1.5 × IQR (inter-quartile range). All data points are overlain. d Box plots of ciliary beat frequency (CBF) measured on control (scrb) and ITLN1 KO mucociliary ALI cultures from triplicate culture inserts and 3 donors following mock- and IL-13-stimulation. Each box plot, as defined in c , represents all datapoints collected from all videos captured across donors and inserts for each condition ( n = 30,899, 24,786, 25,533, and 24,964, from left to right), but illustration of outliers was excluded for visualization purposes. Two-sided p values are based on linear mixed model t-tests with random effects for donor and insert and use Satterthwaite approximation of degrees of freedom. Source data are provided as a Source Data file.
Article Snippet: PCR amplification was performed using 25 ng of input DNA from each sample, with 0.2 μM of
Techniques: CRISPR, Western Blot, Quantitation Assay
Journal: Nature Communications
Article Title: A common polymorphism in the Intelectin-1 gene influences mucus plugging in severe asthma
doi: 10.1038/s41467-024-48034-5
Figure Lengend Snippet: a WGCNA conducted using gene expression from nasal airway epithelial brushings collected from 695 children in the GALA II asthma study found a strong correlation of ITLN1 expression with T2 inflammation and mucus secretory networks. Select genes from each network, Pearson correlation between expression of ITLN1 and network eigengenes, and top functional enrichments from each network are given. Enrichment p values were obtained from a one-sided Fisher exact test implemented in Enrichr. FDR-adjusted p values were obtained using the Benjamini–Hochberg method. b Box plots of log 2 -normalized ITLN1 gene expression in GALA II nasal epithelial brushes stratified by T2 inflammation status ( n : T2-low = 331, T2-high = 364). Fold change (FC) and two-sided p value from a Wald test was obtained from DESeq2. Box centers = median, upper and lower box bounds = 1st and 3rd quartiles, whiskers extend from these bounds up to 1.5 × IQR (inter-quartile range). All data points are overlain. c UMAP visualization of 11,515 cells from scRNA-seq of two dissociated bronchial airway epithelial brushings detailing the 17 cell types identified by SNN clustering through the Leiden algorithm. d Violin plots of log count per million (CPM)-normalized ITLN1 expression across the 17 distinct cell types identified in bronchial airway brushings. e Box plots of log 2 -normalized ITLN1 expression in GALA II stratified by the A/A ( n = 292), A/G ( n = 313), or G/G ( n = 76) genotypes of the top eQTL variant rs4656959. Two-sided p-values were obtained from a Wald test in DESeq2. Box plots as defined in b . f Box plots of log 2 -normalized ITLN1 expression in GALA II, stratified by T2 inflammation status and the genotypes of the top eQTL variant rs4656959 (T2-low n : A/A = 141, A/G = 148, G/G = 35 and T2-high n : A/A = 151, A/G = 165, G/G = 41). Two-sided p values were obtained from a Wald test in DESeq2. Box plots as defined in b . Source data are provided as a Source Data file.
Article Snippet: PCR amplification was performed using 25 ng of input DNA from each sample, with 0.2 μM of
Techniques: Expressing, Functional Assay, Variant Assay
Journal: Nature Communications
Article Title: A common polymorphism in the Intelectin-1 gene influences mucus plugging in severe asthma
doi: 10.1038/s41467-024-48034-5
Figure Lengend Snippet: a Normalized ITLN1 gene expression from paired HBEC ALI cultures ( n = 19 donors) stratified by treatment (control vs. IL-13) and by ITLN1 rs4656959 genotype for both treatments ( n : A/A = 9, A/G = 7, and G/G = 3). Two-sided p values for indicated differences are based on an exact test (edgeR). Box centers = median, upper and lower box bounds = 1st and 3rd quartiles, whiskers extend from these bounds up to 1.5 × IQR (inter-quartile range). All data points are overlain. b Box plots showing normalized ITLN-1 protein secretion measured in aqueous (left; n : A/A = 5, A/G = 6, and G/G = 3) and mucus (right; n : A/A = 3, A/G = 3, and G/G = 3) fractions from apical washes of IL-13-stimulated HBEC ALI cultures. Two-sided p values are based on an exact test (edgeR). Box plots as defined in a . c Normalized ITLN1 and MUC5AC expression measured by qPCR from tracheal mucociliary ALI cultures stratified by treatment (control-white or IL-13-gray) and by ITLN1 rs4656959 genotype ( n = 5 donors/genotype). Two-sided p-values are based on linear mixed model t tests with donor as random intercept using Satterthwaite approximation of degrees of freedom. Box plots as defined in a . d Western blot analysis measuring ITLN-1 in apical washes from control or IL-13-stimulated tracheal ALI cultures with the A/A or G/G genotype of rs4656959 ( n = 5 donors/genotype). Western blot image is representative of data from all donors. Band intensity data reflect all conditions from all donors ( n = 5 donors/genotype). Data represent mean value ± SEM; Two-sided p values calculated using Student’s t test. e Immunofluorescent labeling of IL-13-treated tracheal ALI cultures for ITLN-1 (green), MUC5AC (red), and nuclei (DAPI); images are representative of all 10 donors analyzed; scale bar 50 μm. Source data are provided as a Source Data file.
Article Snippet: PCR amplification was performed using 25 ng of input DNA from each sample, with 0.2 μM of
Techniques: Expressing, Western Blot, Labeling
Journal: Nature Communications
Article Title: A common polymorphism in the Intelectin-1 gene influences mucus plugging in severe asthma
doi: 10.1038/s41467-024-48034-5
Figure Lengend Snippet: a Box plots of log 2 -normalized ITLN1 expression from 249 participants in the SARP asthma cohort stratified by T2 status and ITLN1 rs4656959 genotype; n : T2-low participants n: A/A = 43, A/G = 61, G/G = 13 and T2-high participants n : A/A = 37, A/G = 77, G/G = 18. Two-sided p values for indicated differences were obtained from a Wald test in DESeq2. Box centers = median, upper and lower box bounds = 1st and 3rd quartiles, whiskers extend from these bounds up to 1.5 × IQR (inter-quartile range). All data points are overlain. b Box plots of mucus plug scores (2 measurements per participant) from SARP, stratified into T2-low ( n = 41 participants) and T2-high ( n = 71 participants) groups based on sputum RNA-seq expression profiles. Two-sided p values were obtained by fitting negative binomial mixed model implemented in SAS PROC GLIMMIX (METHOD = RSPL; DDFM = KENWARDROGER2) with subjectID as random effect. Box plots as defined in a . c Box plots of mucus plug scores (2 measurements per participant) from SARP, stratified by both T2 status and ITLN1 rs4656959 variant genotype; T2-low participants n: A/A = 13, A/G = 26, G/G = 2 and T2-high participants n : A/A = 18, A/G = 43, G/G = 10. Two-sided p values were obtained by fitting a negative binomial mixed model implemented in SAS PROC GLIMMIX (METHOD = RSPL; DDFM = KENWARDROGER2) with subjectID as random effect. Box plots as defined in a . Source data are provided as a Source Data file.
Article Snippet: PCR amplification was performed using 25 ng of input DNA from each sample, with 0.2 μM of
Techniques: Expressing, RNA Sequencing Assay, Variant Assay