i dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs i dna
    <t>DNA-binding</t> and RAD51-binding activities of the PSF domains. <t>ϕX174</t> ssDNA (20 µM) ( A ) or ϕX174 linear dsDNA (20 µM) ( B ) was incubated with PSF, PSF(1–266) or PSF(267–468) at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer and were visualized by ethidium bromide staining. The protein concentrations for panel A were 0 µM (lane 1), 0.15 µM (lanes 2, 5 and 8), 0.3 µM (lanes 3, 6 and 9) and 0.6 µM (lanes 4, 7 and 10). The protein concentrations for panel B were 0 µM (lane 1), 0.1 µM (lanes 2, 5 and 8), 0.2 µM (lanes 3, 6 and 9) and 0.4 µM (lanes 4, 7 and 10). ( C ) The pull-down assay with Ni–NTA beads. Lanes 2–5 represent purified RAD51, His 6 -tagged PSF, His 6 -tagged PSF(1–266) and His 6 -tagged PSF(267–468), respectively. His 6 -tagged PSF, His 6 -tagged PSF(1–266) or His 6 -tagged PSF(267–468) (3.8 µg) was mixed with RAD51 (7.4 µg). The RAD51 bound to the His 6 -tagged proteins was pulled down by the Ni–NTA agarose beads, and was analyzed by 12% SDS–PAGE. Bands were visualized by Coomassie Brilliant Blue staining.
    I Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/i dna/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    i dna - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities"

    Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp298

    DNA-binding and RAD51-binding activities of the PSF domains. ϕX174 ssDNA (20 µM) ( A ) or ϕX174 linear dsDNA (20 µM) ( B ) was incubated with PSF, PSF(1–266) or PSF(267–468) at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer and were visualized by ethidium bromide staining. The protein concentrations for panel A were 0 µM (lane 1), 0.15 µM (lanes 2, 5 and 8), 0.3 µM (lanes 3, 6 and 9) and 0.6 µM (lanes 4, 7 and 10). The protein concentrations for panel B were 0 µM (lane 1), 0.1 µM (lanes 2, 5 and 8), 0.2 µM (lanes 3, 6 and 9) and 0.4 µM (lanes 4, 7 and 10). ( C ) The pull-down assay with Ni–NTA beads. Lanes 2–5 represent purified RAD51, His 6 -tagged PSF, His 6 -tagged PSF(1–266) and His 6 -tagged PSF(267–468), respectively. His 6 -tagged PSF, His 6 -tagged PSF(1–266) or His 6 -tagged PSF(267–468) (3.8 µg) was mixed with RAD51 (7.4 µg). The RAD51 bound to the His 6 -tagged proteins was pulled down by the Ni–NTA agarose beads, and was analyzed by 12% SDS–PAGE. Bands were visualized by Coomassie Brilliant Blue staining.
    Figure Legend Snippet: DNA-binding and RAD51-binding activities of the PSF domains. ϕX174 ssDNA (20 µM) ( A ) or ϕX174 linear dsDNA (20 µM) ( B ) was incubated with PSF, PSF(1–266) or PSF(267–468) at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer and were visualized by ethidium bromide staining. The protein concentrations for panel A were 0 µM (lane 1), 0.15 µM (lanes 2, 5 and 8), 0.3 µM (lanes 3, 6 and 9) and 0.6 µM (lanes 4, 7 and 10). The protein concentrations for panel B were 0 µM (lane 1), 0.1 µM (lanes 2, 5 and 8), 0.2 µM (lanes 3, 6 and 9) and 0.4 µM (lanes 4, 7 and 10). ( C ) The pull-down assay with Ni–NTA beads. Lanes 2–5 represent purified RAD51, His 6 -tagged PSF, His 6 -tagged PSF(1–266) and His 6 -tagged PSF(267–468), respectively. His 6 -tagged PSF, His 6 -tagged PSF(1–266) or His 6 -tagged PSF(267–468) (3.8 µg) was mixed with RAD51 (7.4 µg). The RAD51 bound to the His 6 -tagged proteins was pulled down by the Ni–NTA agarose beads, and was analyzed by 12% SDS–PAGE. Bands were visualized by Coomassie Brilliant Blue staining.

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis, Staining, Pull Down Assay, Purification, SDS Page

    2) Product Images from "Homologous Pairing Activities of Two Rice RAD51 Proteins, RAD51A1 and RAD51A2"

    Article Title: Homologous Pairing Activities of Two Rice RAD51 Proteins, RAD51A1 and RAD51A2

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075451

    The DNA-binding activities of rice RAD51A1 and RAD51A2. Circular φX174 ssDNA (20 µM) (A) or linear φX174 dsDNA (20 µM) (C) was incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lanes 1–10 and 11–20 represent the reactions conducted with and without ATP, respectively. Lanes 1 and 11 indicate negative control experiments without protein. Lanes 2–4 and 12–14 represent the experiments conducted with RAD51A1. Lanes 5–7 and 15–17 represent the experiments conducted with RAD51A2. Lanes 8–10 and 18–20 represent the experiments conducted with human RAD51. The protein concentrations were 0.75 µM (lanes 2, 5, 8, 12, 15, and 18), 1.5 µM (lanes 3, 6, 9, 13, 16, and 19) and 3 µM (lanes 4, 7, 10, 14, 17, and 20). (B) Graphic representation of the relative migration distances of the RAD51A1- and RAD51A2-ssDNA complexes. The migration distances relative to the free DNA are plotted against the protein concentrations. (D) Competitive ssDNA- and dsDNA-binding. Circular φX174 ssDNA (20 µM) and linear φX174 dsDNA (20 µM) were incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min, under the 120 mM NaCl conditions. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lane 1 indicates negative control experiments without protein. Lanes 2–4, 5–7, and 8–10 represent the experiments conducted with RAD51A1, RAD51A2, and human RAD51, respectively. The protein concentrations were 0.9 µM (lanes 2, 5, and 8), 1.8 µM (lanes 3, 6, and 9), and 3.6 µM (lanes 4, 7, and 10).
    Figure Legend Snippet: The DNA-binding activities of rice RAD51A1 and RAD51A2. Circular φX174 ssDNA (20 µM) (A) or linear φX174 dsDNA (20 µM) (C) was incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lanes 1–10 and 11–20 represent the reactions conducted with and without ATP, respectively. Lanes 1 and 11 indicate negative control experiments without protein. Lanes 2–4 and 12–14 represent the experiments conducted with RAD51A1. Lanes 5–7 and 15–17 represent the experiments conducted with RAD51A2. Lanes 8–10 and 18–20 represent the experiments conducted with human RAD51. The protein concentrations were 0.75 µM (lanes 2, 5, 8, 12, 15, and 18), 1.5 µM (lanes 3, 6, 9, 13, 16, and 19) and 3 µM (lanes 4, 7, 10, 14, 17, and 20). (B) Graphic representation of the relative migration distances of the RAD51A1- and RAD51A2-ssDNA complexes. The migration distances relative to the free DNA are plotted against the protein concentrations. (D) Competitive ssDNA- and dsDNA-binding. Circular φX174 ssDNA (20 µM) and linear φX174 dsDNA (20 µM) were incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min, under the 120 mM NaCl conditions. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lane 1 indicates negative control experiments without protein. Lanes 2–4, 5–7, and 8–10 represent the experiments conducted with RAD51A1, RAD51A2, and human RAD51, respectively. The protein concentrations were 0.9 µM (lanes 2, 5, and 8), 1.8 µM (lanes 3, 6, and 9), and 3.6 µM (lanes 4, 7, and 10).

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis, Staining, Negative Control, Migration

    Purification of rice RAD51A1 and RAD51A2. (A) The amino acid sequences of rice RAD51A1 and RAD51A2 from japonica cultivar group, cv. Nipponbare, rice RAD51 from indica cultivar group, cv. Pusa Basmati 1, and human RAD51, aligned with the ClustalX software [50] . Black and gray boxes indicate identical and similar amino acid residues, respectively. The L1 and L2 loops, which are important for DNA binding, are represented by red lines. (B) Purified rice RAD51A1, RAD51A2, and human RAD51. Lane 1 indicates the molecular mass markers, and lanes 2, 3, and 4 represent rice RAD51A1 (0.5 µg), RAD51A2 (0.5 µg), and human RAD51 (0.5 µg), respectively. (C) The ATPase activities of Oryza sativa RAD51A1 and RAD51A2. The reactions were conducted with φX174 circular ssDNA (left panel), linearized φX174 dsDNA (center panel), or without DNA (right panel), in the presence of 5 µM ATP. Blue circles and red squares represent the experiments with RAD51A1 and RAD51A2, respectively. The averages of three independent experiments are shown with the SD values.
    Figure Legend Snippet: Purification of rice RAD51A1 and RAD51A2. (A) The amino acid sequences of rice RAD51A1 and RAD51A2 from japonica cultivar group, cv. Nipponbare, rice RAD51 from indica cultivar group, cv. Pusa Basmati 1, and human RAD51, aligned with the ClustalX software [50] . Black and gray boxes indicate identical and similar amino acid residues, respectively. The L1 and L2 loops, which are important for DNA binding, are represented by red lines. (B) Purified rice RAD51A1, RAD51A2, and human RAD51. Lane 1 indicates the molecular mass markers, and lanes 2, 3, and 4 represent rice RAD51A1 (0.5 µg), RAD51A2 (0.5 µg), and human RAD51 (0.5 µg), respectively. (C) The ATPase activities of Oryza sativa RAD51A1 and RAD51A2. The reactions were conducted with φX174 circular ssDNA (left panel), linearized φX174 dsDNA (center panel), or without DNA (right panel), in the presence of 5 µM ATP. Blue circles and red squares represent the experiments with RAD51A1 and RAD51A2, respectively. The averages of three independent experiments are shown with the SD values.

    Techniques Used: Purification, Software, Binding Assay

    Electron microscopic images of RAD51A1 and RAD51A2 complexed with DNA. (A and B) Electron microscopic images of rice RAD51A1 (A) and RAD51A2 (B) filaments formed on the φX174 dsDNA in the presence of ATP. The average helical pitches of the RAD51A1 and RAD51A2 filaments were about 9.15 nm. The black bar denotes 100 nm.
    Figure Legend Snippet: Electron microscopic images of RAD51A1 and RAD51A2 complexed with DNA. (A and B) Electron microscopic images of rice RAD51A1 (A) and RAD51A2 (B) filaments formed on the φX174 dsDNA in the presence of ATP. The average helical pitches of the RAD51A1 and RAD51A2 filaments were about 9.15 nm. The black bar denotes 100 nm.

    Techniques Used:

    3) Product Images from "GEMIN2 promotes accumulation of RAD51 at double-strand breaks in homologous recombination"

    Article Title: GEMIN2 promotes accumulation of RAD51 at double-strand breaks in homologous recombination

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq271

    GEMIN2 stimulates RAD51–DNA filament formation. ( A ) Polyacrylamide gel electrophoresis to examine the formation of the RAD51–DNA filament. RAD51 (4 µM) and GEMIN2 were incubated with 10 µM 49-mer ssDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 1 µM (lane 3), 2 µM (lane 4), 4 µM (lane 5) and 8 µM (lanes 6 and 7). Under these experimental conditions, 90% of the input ssDNA was estimated as being in the RAD51-bound fraction in the absence of the GEMIN2 protein. ( B ) Quantification of experiments shown in panel A. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound ssDNA fractions relative to lane 2 of panel A were plotted. Average values of three independent experiments are shown with standard deviation values. ( C ) Polyacrylamide gel electrophoresis, as in panel A. RAD51 (2 µM) and GEMIN2 were incubated with 6 µM 49-mer dsDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 0.5 µM (lane 3), 1 µM (lane 4), 2 µM (lane 5) and 4 µM (lanes 6 and 7). ( D ) Quantification of experiments shown in panel C. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound dsDNA fractions relative to lane 2 of panel C were plotted. Average values of three independent experiments are shown with standard deviation values. ( E ) Agarose gel electrophoresis to examine the formation of the RAD51-ssDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of ϕX174 ssDNA (20 µM). DNA was visualized by ethidium bromide staining. ( F ) Agarose gel electrophoresis to examine the formation of the RAD51–dsDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of linear ϕX174 dsDNA (10 µM). Results presented as in panel E. ( G ) Agarose gel electrophoresis to assess the complex formation between the RAD51-dsDNA filament and GEMIN2. GEMIN2 was labeled with Cy5 and dsDNA was stained with EtBr. Note that GEMIN2 facilitated the formation of the RAD51-dsDNA filament, but did not bind to the filament.
    Figure Legend Snippet: GEMIN2 stimulates RAD51–DNA filament formation. ( A ) Polyacrylamide gel electrophoresis to examine the formation of the RAD51–DNA filament. RAD51 (4 µM) and GEMIN2 were incubated with 10 µM 49-mer ssDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 1 µM (lane 3), 2 µM (lane 4), 4 µM (lane 5) and 8 µM (lanes 6 and 7). Under these experimental conditions, 90% of the input ssDNA was estimated as being in the RAD51-bound fraction in the absence of the GEMIN2 protein. ( B ) Quantification of experiments shown in panel A. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound ssDNA fractions relative to lane 2 of panel A were plotted. Average values of three independent experiments are shown with standard deviation values. ( C ) Polyacrylamide gel electrophoresis, as in panel A. RAD51 (2 µM) and GEMIN2 were incubated with 6 µM 49-mer dsDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 0.5 µM (lane 3), 1 µM (lane 4), 2 µM (lane 5) and 4 µM (lanes 6 and 7). ( D ) Quantification of experiments shown in panel C. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound dsDNA fractions relative to lane 2 of panel C were plotted. Average values of three independent experiments are shown with standard deviation values. ( E ) Agarose gel electrophoresis to examine the formation of the RAD51-ssDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of ϕX174 ssDNA (20 µM). DNA was visualized by ethidium bromide staining. ( F ) Agarose gel electrophoresis to examine the formation of the RAD51–dsDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of linear ϕX174 dsDNA (10 µM). Results presented as in panel E. ( G ) Agarose gel electrophoresis to assess the complex formation between the RAD51-dsDNA filament and GEMIN2. GEMIN2 was labeled with Cy5 and dsDNA was stained with EtBr. Note that GEMIN2 facilitated the formation of the RAD51-dsDNA filament, but did not bind to the filament.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Incubation, Staining, Standard Deviation, Agarose Gel Electrophoresis, Labeling

    GEMIN2 stabilizes the RAD51–DNA filament. ( A ) Complex formation of RAD51 and dsDNA was evaluated by electrophoresis of unbound free DNA in agarose gel. Increased concentrations of competitor DNA were incubated with 2 µM of RAD51 in the presence or absence of 4 µM of GEMIN2, prior to the addition of ϕX174 dsDNA. ( B ) Quantification of results from panel A. The relative amounts of RAD51-unbound DNA are shown. Closed and open circles indicate experiments with and without GEMIN2. Average values and standard deviation were calculated from three independent experiments. ( C ) Complex formation of RAD51 and dsDNA in the presence of the BRC4 polypeptide. The experiments were done as described for panel A. ( D ) Quantification of the data from panel C. ( E ) Surface plasmon resonance analysis. The RAD51- or GEMIN2-conjugated sensor chips were used. Sensorgrams of RAD51-BRC4 and GEMIN2-BRC4 interactions are presented. The BRC4 polypeptide concentration was 10 µM. Time 0 of the horizontal axis indicates the initiation time of the peptide injection.
    Figure Legend Snippet: GEMIN2 stabilizes the RAD51–DNA filament. ( A ) Complex formation of RAD51 and dsDNA was evaluated by electrophoresis of unbound free DNA in agarose gel. Increased concentrations of competitor DNA were incubated with 2 µM of RAD51 in the presence or absence of 4 µM of GEMIN2, prior to the addition of ϕX174 dsDNA. ( B ) Quantification of results from panel A. The relative amounts of RAD51-unbound DNA are shown. Closed and open circles indicate experiments with and without GEMIN2. Average values and standard deviation were calculated from three independent experiments. ( C ) Complex formation of RAD51 and dsDNA in the presence of the BRC4 polypeptide. The experiments were done as described for panel A. ( D ) Quantification of the data from panel C. ( E ) Surface plasmon resonance analysis. The RAD51- or GEMIN2-conjugated sensor chips were used. Sensorgrams of RAD51-BRC4 and GEMIN2-BRC4 interactions are presented. The BRC4 polypeptide concentration was 10 µM. Time 0 of the horizontal axis indicates the initiation time of the peptide injection.

    Techniques Used: Electrophoresis, Agarose Gel Electrophoresis, Incubation, Standard Deviation, SPR Assay, Concentration Assay, Injection

    4) Product Images from "Recombination Activator Function of the Novel RAD51- and RAD51B-binding Protein, Human EVL *Recombination Activator Function of the Novel RAD51- and RAD51B-binding Protein, Human EVL * S⃞"

    Article Title: Recombination Activator Function of the Novel RAD51- and RAD51B-binding Protein, Human EVL *Recombination Activator Function of the Novel RAD51- and RAD51B-binding Protein, Human EVL * S⃞

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M807715200

    DNA binding activities of the EVL protein. φX174 ssDNA (20 μ m ) and/orφX174 linear dsDNA (20 μ m ) were each incubated with the EVL protein at 37 °C for 15 min. The samples were then separated by 0.8% agarose gel
    Figure Legend Snippet: DNA binding activities of the EVL protein. φX174 ssDNA (20 μ m ) and/orφX174 linear dsDNA (20 μ m ) were each incubated with the EVL protein at 37 °C for 15 min. The samples were then separated by 0.8% agarose gel

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis

    5) Product Images from "Stimulation of Dmc1-mediated DNA strand exchange by the human Rad54B protein"

    Article Title: Stimulation of Dmc1-mediated DNA strand exchange by the human Rad54B protein

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl562

    Stimulation of the Dmc1-mediated DNA strand exchange activity by Rad54B. ( A ) Schematic representation of the DNA strand exchange assay. The nucleoprotein filament is formed by incubating Dmc1 with circular ssDNA. The filament is paired with homologous linear dsDNA to yield a joint molecule. A nicked circular duplex (nc) and linear ssDNA are then generated by completing strand exchange over the length of the DNA molecules. ( B ) Dmc1-mediated DNA strand exchange activity with Rad54B. A constant amount of Dmc1 (7.5 µM) was incubated for 2 h with φX174 circular ssDNA (30 µM), φX174 linear dsDNA (22 µM), RPA (2 µM), KCl (200 mM) and increasing concentrations of Rad54B (0, 0.025, 0.1, 0.4 and 1.6 µM in lanes 2–6, respectively), in the order described for the procedure at 37°C. In lane 1, ssDNA and dsDNA were incubated in buffer with RPA and KCl, but without other recombinant proteins, and in lane 7, ssDNA and dsDNA were incubated in buffer with RPA, KCl and Rad54B (1.6 µM), but no Dmc1. The reaction mixtures were deproteinized, fractionated on a 1% agarose gel and stained with ethidium bromide. ( C ) Graphic representation of the experiments shown in (B). The amounts of nicked circular duplex are presented. ( D ) Time course experiments for DNA strand exchange. Dmc1 (7.5 µM) was incubated with φX174 circular ssDNA (30 µM), φX174 linear dsDNA (22 µM), RPA (2 µM) and KCl (200 mM), in the presence (open squares) or absence (closed squares) of Rad54B (0.4 µM), in the order described for the procedure at 37°C, for the indicated times. ( E ) Graphic representation of the experiments shown in (D). The amounts of nicked circular duplex are graphically presented.
    Figure Legend Snippet: Stimulation of the Dmc1-mediated DNA strand exchange activity by Rad54B. ( A ) Schematic representation of the DNA strand exchange assay. The nucleoprotein filament is formed by incubating Dmc1 with circular ssDNA. The filament is paired with homologous linear dsDNA to yield a joint molecule. A nicked circular duplex (nc) and linear ssDNA are then generated by completing strand exchange over the length of the DNA molecules. ( B ) Dmc1-mediated DNA strand exchange activity with Rad54B. A constant amount of Dmc1 (7.5 µM) was incubated for 2 h with φX174 circular ssDNA (30 µM), φX174 linear dsDNA (22 µM), RPA (2 µM), KCl (200 mM) and increasing concentrations of Rad54B (0, 0.025, 0.1, 0.4 and 1.6 µM in lanes 2–6, respectively), in the order described for the procedure at 37°C. In lane 1, ssDNA and dsDNA were incubated in buffer with RPA and KCl, but without other recombinant proteins, and in lane 7, ssDNA and dsDNA were incubated in buffer with RPA, KCl and Rad54B (1.6 µM), but no Dmc1. The reaction mixtures were deproteinized, fractionated on a 1% agarose gel and stained with ethidium bromide. ( C ) Graphic representation of the experiments shown in (B). The amounts of nicked circular duplex are presented. ( D ) Time course experiments for DNA strand exchange. Dmc1 (7.5 µM) was incubated with φX174 circular ssDNA (30 µM), φX174 linear dsDNA (22 µM), RPA (2 µM) and KCl (200 mM), in the presence (open squares) or absence (closed squares) of Rad54B (0.4 µM), in the order described for the procedure at 37°C, for the indicated times. ( E ) Graphic representation of the experiments shown in (D). The amounts of nicked circular duplex are graphically presented.

    Techniques Used: Activity Assay, Generated, Incubation, Recombinase Polymerase Amplification, Recombinant, Agarose Gel Electrophoresis, Staining

    Pull down assay for the protein transfer between ssDNA molecules. ( A ) A schematic diagram of the pull down assay. Dmc1 and biotinylated DNA form a complex in the absence or presence of Rad54B. Then, circular ssDNA is added as a competitor, and protein transfer occurs. Biotinylated DNA is immobilized on streptavidin beads, and the reaction mixture is divided into the beads and supernatant. ( B ) Dmc1 (5 µM) was incubated with SAT-120 (20 µM) labeled with biotin at the 5′ end in the absence (lane 2) or presence (lane 3) of Rad54B (200 nM), followed by an incubation with φX174 circular ssDNA (2 mM). After immobilization on streptavidin beads for 1 h at 4°C, the reaction mixture was divided into the beads and the supernatant by centrifugation. Then, one-tenth of the supernatant was fractionated on a 4–20% gradient SDS–PAGE gel. Lane 1 is one-tenth of the input protein. ( C ) Graphic representation of the experiments shown in (B). The amounts of Dmc1 within the supernatant are presented.
    Figure Legend Snippet: Pull down assay for the protein transfer between ssDNA molecules. ( A ) A schematic diagram of the pull down assay. Dmc1 and biotinylated DNA form a complex in the absence or presence of Rad54B. Then, circular ssDNA is added as a competitor, and protein transfer occurs. Biotinylated DNA is immobilized on streptavidin beads, and the reaction mixture is divided into the beads and supernatant. ( B ) Dmc1 (5 µM) was incubated with SAT-120 (20 µM) labeled with biotin at the 5′ end in the absence (lane 2) or presence (lane 3) of Rad54B (200 nM), followed by an incubation with φX174 circular ssDNA (2 mM). After immobilization on streptavidin beads for 1 h at 4°C, the reaction mixture was divided into the beads and the supernatant by centrifugation. Then, one-tenth of the supernatant was fractionated on a 4–20% gradient SDS–PAGE gel. Lane 1 is one-tenth of the input protein. ( C ) Graphic representation of the experiments shown in (B). The amounts of Dmc1 within the supernatant are presented.

    Techniques Used: Pull Down Assay, Incubation, Labeling, Centrifugation, SDS Page

    Model of Rad54B converting the Dmc1–DNA complex from the octameric ring form to the helical filament form. Rad54B interacts with terminus of the stacked octameric rings of the Dmc1–DNA complex, causing a conversion into the helical-filament form. This conversion results in the stabilization of the Dmc1–ssDNA complex, and the stimulation of the DNA strand exchange promoted by Dmc1.
    Figure Legend Snippet: Model of Rad54B converting the Dmc1–DNA complex from the octameric ring form to the helical filament form. Rad54B interacts with terminus of the stacked octameric rings of the Dmc1–DNA complex, causing a conversion into the helical-filament form. This conversion results in the stabilization of the Dmc1–ssDNA complex, and the stimulation of the DNA strand exchange promoted by Dmc1.

    Techniques Used:

    6) Product Images from "Human PSF concentrates DNA and stimulates duplex capture in DMC1-mediated homologous pairing"

    Article Title: Human PSF concentrates DNA and stimulates duplex capture in DMC1-mediated homologous pairing

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1229

    The DNA aggregation assay. ( A ) Schematic representation of the DNA aggregation assay. ( B ) The reaction was conducted with DMC1 (4 µM) and/or PSF (1.2 µM) in the presence of ϕX174 ssDNA (10 µM) and linearized ϕX174 dsDNA (10 µM). The samples were centrifuged for 3 min at 20 400 g at room temperature, and the ssDNA and dsDNA recovered in the upper (15 µl) and bottom (5 µl) fractions were analyzed by 0.8% agarose gel electrophoresis with ethidium bromide staining. ( C ) The reaction was conducted by the same method as in panel B, except HOP2-MND1 (1.2 µM) was used instead of PSF.
    Figure Legend Snippet: The DNA aggregation assay. ( A ) Schematic representation of the DNA aggregation assay. ( B ) The reaction was conducted with DMC1 (4 µM) and/or PSF (1.2 µM) in the presence of ϕX174 ssDNA (10 µM) and linearized ϕX174 dsDNA (10 µM). The samples were centrifuged for 3 min at 20 400 g at room temperature, and the ssDNA and dsDNA recovered in the upper (15 µl) and bottom (5 µl) fractions were analyzed by 0.8% agarose gel electrophoresis with ethidium bromide staining. ( C ) The reaction was conducted by the same method as in panel B, except HOP2-MND1 (1.2 µM) was used instead of PSF.

    Techniques Used: Agarose Gel Electrophoresis, Staining

    7) Product Images from "S100A11 plays a role in homologous recombination and genome maintenance by influencing the persistence of RAD51 in DNA repair foci"

    Article Title: S100A11 plays a role in homologous recombination and genome maintenance by influencing the persistence of RAD51 in DNA repair foci

    Journal: Cell Cycle

    doi: 10.1080/15384101.2016.1220457

    S100A11 stimulates the strand exchange activity of RAD51. (A) left panel Scheme of the strand exchange reaction between circular ssDNA and linearized dsDNA. right panel Strand exchange by human RAD51 requires Ca 2+ . RAD51, derived from 2 distinct purification procedures, (lanes 2–3 and 5–6: 3 µM) was incubated with 24 µM circular ΦX174 ssDNA in strand exchange buffer containing 2 mM of either magnesium or calcium acetate for 15 min at 37°C followed by incubation with 2.4 µM RPA for 5 min and addition of 24 µM linearized ΦX174 dsDNA to initiate strand exchange reaction for 2 h at 37°C. Lane M: constructed joint molecule DNA product derived from ssDNA/dsDNA annealing used as marker (B) left panel S100A11 enhances RAD51-mediated strand exchange. RAD51 (lanes 4–6: 3 µM) alone or with S100A11 (lane 5: 2 µM, lane 6: 4 µM) was incubated as described in (A) in strand exchange buffer containing calcium acetate (2 mM). As negative control, S100A11 (lane 7: 4 µM) was incubated alone. The joint molecule product (jm) was visualized by GelStar staining. right panel Quantification of S100A11-stimulated joint molecule formation by RAD51. Average values of 3 independent experiments are shown with standard derivation. (C) Dialysis of S100A11 abrogated the stimulating effect of S100A11 on RAD51 activity. RAD51 (lanes 4–8 and 10) together with undialyzed S100A11 (lane 5), S100A11 dialyzed in EGTA containing buffer (lanes 7–9), or S100A11 dialyzed in buffer without EGTA (lane 10), was incubated with 24 µM circular ΦX174 ssDNA in strand exchange buffer containing 2 mM of either magnesium or calcium acetate for 15 min at 37°C followed by incubation with 2.4 µM RPA for 5 min and addition of 24 µM linearized ΦX174 dsDNA to initiate strand exchange reaction for 2 h at 37°C. * P
    Figure Legend Snippet: S100A11 stimulates the strand exchange activity of RAD51. (A) left panel Scheme of the strand exchange reaction between circular ssDNA and linearized dsDNA. right panel Strand exchange by human RAD51 requires Ca 2+ . RAD51, derived from 2 distinct purification procedures, (lanes 2–3 and 5–6: 3 µM) was incubated with 24 µM circular ΦX174 ssDNA in strand exchange buffer containing 2 mM of either magnesium or calcium acetate for 15 min at 37°C followed by incubation with 2.4 µM RPA for 5 min and addition of 24 µM linearized ΦX174 dsDNA to initiate strand exchange reaction for 2 h at 37°C. Lane M: constructed joint molecule DNA product derived from ssDNA/dsDNA annealing used as marker (B) left panel S100A11 enhances RAD51-mediated strand exchange. RAD51 (lanes 4–6: 3 µM) alone or with S100A11 (lane 5: 2 µM, lane 6: 4 µM) was incubated as described in (A) in strand exchange buffer containing calcium acetate (2 mM). As negative control, S100A11 (lane 7: 4 µM) was incubated alone. The joint molecule product (jm) was visualized by GelStar staining. right panel Quantification of S100A11-stimulated joint molecule formation by RAD51. Average values of 3 independent experiments are shown with standard derivation. (C) Dialysis of S100A11 abrogated the stimulating effect of S100A11 on RAD51 activity. RAD51 (lanes 4–8 and 10) together with undialyzed S100A11 (lane 5), S100A11 dialyzed in EGTA containing buffer (lanes 7–9), or S100A11 dialyzed in buffer without EGTA (lane 10), was incubated with 24 µM circular ΦX174 ssDNA in strand exchange buffer containing 2 mM of either magnesium or calcium acetate for 15 min at 37°C followed by incubation with 2.4 µM RPA for 5 min and addition of 24 µM linearized ΦX174 dsDNA to initiate strand exchange reaction for 2 h at 37°C. * P

    Techniques Used: Activity Assay, Derivative Assay, Purification, Incubation, Recombinase Polymerase Amplification, Construct, Marker, Negative Control, Staining

    8) Product Images from "Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase *"

    Article Title: Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.032953

    Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which
    Figure Legend Snippet: Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which

    Techniques Used:

    9) Product Images from "Homologous Pairing Activities of Two Rice RAD51 Proteins, RAD51A1 and RAD51A2"

    Article Title: Homologous Pairing Activities of Two Rice RAD51 Proteins, RAD51A1 and RAD51A2

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075451

    The DNA-binding activities of rice RAD51A1 and RAD51A2. Circular φX174 ssDNA (20 µM) (A) or linear φX174 dsDNA (20 µM) (C) was incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lanes 1–10 and 11–20 represent the reactions conducted with and without ATP, respectively. Lanes 1 and 11 indicate negative control experiments without protein. Lanes 2–4 and 12–14 represent the experiments conducted with RAD51A1. Lanes 5–7 and 15–17 represent the experiments conducted with RAD51A2. Lanes 8–10 and 18–20 represent the experiments conducted with human RAD51. The protein concentrations were 0.75 µM (lanes 2, 5, 8, 12, 15, and 18), 1.5 µM (lanes 3, 6, 9, 13, 16, and 19) and 3 µM (lanes 4, 7, 10, 14, 17, and 20). (B) Graphic representation of the relative migration distances of the RAD51A1- and RAD51A2-ssDNA complexes. The migration distances relative to the free DNA are plotted against the protein concentrations. (D) Competitive ssDNA- and dsDNA-binding. Circular φX174 ssDNA (20 µM) and linear φX174 dsDNA (20 µM) were incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min, under the 120 mM NaCl conditions. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lane 1 indicates negative control experiments without protein. Lanes 2–4, 5–7, and 8–10 represent the experiments conducted with RAD51A1, RAD51A2, and human RAD51, respectively. The protein concentrations were 0.9 µM (lanes 2, 5, and 8), 1.8 µM (lanes 3, 6, and 9), and 3.6 µM (lanes 4, 7, and 10).
    Figure Legend Snippet: The DNA-binding activities of rice RAD51A1 and RAD51A2. Circular φX174 ssDNA (20 µM) (A) or linear φX174 dsDNA (20 µM) (C) was incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lanes 1–10 and 11–20 represent the reactions conducted with and without ATP, respectively. Lanes 1 and 11 indicate negative control experiments without protein. Lanes 2–4 and 12–14 represent the experiments conducted with RAD51A1. Lanes 5–7 and 15–17 represent the experiments conducted with RAD51A2. Lanes 8–10 and 18–20 represent the experiments conducted with human RAD51. The protein concentrations were 0.75 µM (lanes 2, 5, 8, 12, 15, and 18), 1.5 µM (lanes 3, 6, 9, 13, 16, and 19) and 3 µM (lanes 4, 7, 10, 14, 17, and 20). (B) Graphic representation of the relative migration distances of the RAD51A1- and RAD51A2-ssDNA complexes. The migration distances relative to the free DNA are plotted against the protein concentrations. (D) Competitive ssDNA- and dsDNA-binding. Circular φX174 ssDNA (20 µM) and linear φX174 dsDNA (20 µM) were incubated with rice RAD51A1, RAD51A2, or human RAD51 at 37°C for 10 min, under the 120 mM NaCl conditions. The samples were then separated by 0.8% agarose gel electrophoresis in TAE buffer, and were visualized by ethidium bromide staining. Lane 1 indicates negative control experiments without protein. Lanes 2–4, 5–7, and 8–10 represent the experiments conducted with RAD51A1, RAD51A2, and human RAD51, respectively. The protein concentrations were 0.9 µM (lanes 2, 5, and 8), 1.8 µM (lanes 3, 6, and 9), and 3.6 µM (lanes 4, 7, and 10).

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis, Staining, Negative Control, Migration

    Purification of rice RAD51A1 and RAD51A2. (A) The amino acid sequences of rice RAD51A1 and RAD51A2 from japonica cultivar group, cv. Nipponbare, rice RAD51 from indica cultivar group, cv. Pusa Basmati 1, and human RAD51, aligned with the ClustalX software [50] . Black and gray boxes indicate identical and similar amino acid residues, respectively. The L1 and L2 loops, which are important for DNA binding, are represented by red lines. (B) Purified rice RAD51A1, RAD51A2, and human RAD51. Lane 1 indicates the molecular mass markers, and lanes 2, 3, and 4 represent rice RAD51A1 (0.5 µg), RAD51A2 (0.5 µg), and human RAD51 (0.5 µg), respectively. (C) The ATPase activities of Oryza sativa RAD51A1 and RAD51A2. The reactions were conducted with φX174 circular ssDNA (left panel), linearized φX174 dsDNA (center panel), or without DNA (right panel), in the presence of 5 µM ATP. Blue circles and red squares represent the experiments with RAD51A1 and RAD51A2, respectively. The averages of three independent experiments are shown with the SD values.
    Figure Legend Snippet: Purification of rice RAD51A1 and RAD51A2. (A) The amino acid sequences of rice RAD51A1 and RAD51A2 from japonica cultivar group, cv. Nipponbare, rice RAD51 from indica cultivar group, cv. Pusa Basmati 1, and human RAD51, aligned with the ClustalX software [50] . Black and gray boxes indicate identical and similar amino acid residues, respectively. The L1 and L2 loops, which are important for DNA binding, are represented by red lines. (B) Purified rice RAD51A1, RAD51A2, and human RAD51. Lane 1 indicates the molecular mass markers, and lanes 2, 3, and 4 represent rice RAD51A1 (0.5 µg), RAD51A2 (0.5 µg), and human RAD51 (0.5 µg), respectively. (C) The ATPase activities of Oryza sativa RAD51A1 and RAD51A2. The reactions were conducted with φX174 circular ssDNA (left panel), linearized φX174 dsDNA (center panel), or without DNA (right panel), in the presence of 5 µM ATP. Blue circles and red squares represent the experiments with RAD51A1 and RAD51A2, respectively. The averages of three independent experiments are shown with the SD values.

    Techniques Used: Purification, Software, Binding Assay

    Electron microscopic images of RAD51A1 and RAD51A2 complexed with DNA. (A and B) Electron microscopic images of rice RAD51A1 (A) and RAD51A2 (B) filaments formed on the φX174 dsDNA in the presence of ATP. The average helical pitches of the RAD51A1 and RAD51A2 filaments were about 9.15 nm. The black bar denotes 100 nm.
    Figure Legend Snippet: Electron microscopic images of RAD51A1 and RAD51A2 complexed with DNA. (A and B) Electron microscopic images of rice RAD51A1 (A) and RAD51A2 (B) filaments formed on the φX174 dsDNA in the presence of ATP. The average helical pitches of the RAD51A1 and RAD51A2 filaments were about 9.15 nm. The black bar denotes 100 nm.

    Techniques Used:

    10) Product Images from "DNA repair by a Rad22-Mus81-dependent pathway that is independent of Rhp51"

    Article Title: DNA repair by a Rad22-Mus81-dependent pathway that is independent of Rhp51

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkh853

    Rad22-promoted D-loop formation and D-loop cleavage by Mus81. ( A ) Schematic of D-loop formation. The asterisk indicates the position of the 5′- 32 P-end-label on the partial duplex. ( B ) Rad22-promoted D-loop formation. Reactions are described in Materials and Methods and contained Rad22 (6 nM, lanes b and e; 12 nM, lanes c and f; and 24 nM, lanes d and g) and 10 mM MgCl 2 . Rad22 was pre-incubated with partial duplex or φX174 DNA as indicated. ( C ) Dependence on homology for D-loop formation. Reactions are described in Materials and Methods. ( D ) Effect of Mus81 on Rad22-promoted φX174-based D-loop formation. Reactions contained 12 nM Rad22 and 14 nM Mus81–Eme1 as indicated. ( E ) Cleavage of purified φX174-based D-loops by Mus81–Eme1. Reactions contained 7 nM (lane c) or 14 nM (lanes d and e) Mus81–Eme1 and 10 mM MgCl 2 as indicated. The D-loop (lane a) was dissociated by heat treatment at 96°C for 2 min.
    Figure Legend Snippet: Rad22-promoted D-loop formation and D-loop cleavage by Mus81. ( A ) Schematic of D-loop formation. The asterisk indicates the position of the 5′- 32 P-end-label on the partial duplex. ( B ) Rad22-promoted D-loop formation. Reactions are described in Materials and Methods and contained Rad22 (6 nM, lanes b and e; 12 nM, lanes c and f; and 24 nM, lanes d and g) and 10 mM MgCl 2 . Rad22 was pre-incubated with partial duplex or φX174 DNA as indicated. ( C ) Dependence on homology for D-loop formation. Reactions are described in Materials and Methods. ( D ) Effect of Mus81 on Rad22-promoted φX174-based D-loop formation. Reactions contained 12 nM Rad22 and 14 nM Mus81–Eme1 as indicated. ( E ) Cleavage of purified φX174-based D-loops by Mus81–Eme1. Reactions contained 7 nM (lane c) or 14 nM (lanes d and e) Mus81–Eme1 and 10 mM MgCl 2 as indicated. The D-loop (lane a) was dissociated by heat treatment at 96°C for 2 min.

    Techniques Used: Incubation, Purification

    Related Articles

    Amplification:

    Article Title: Could Public Restrooms Be an Environment for Bacterial Resistomes?
    Article Snippet: The 2 log DNA ladder I (New England Biolab, Hitchin, UK) was used as molecular size markers. .. Amplified PCR products were sequenced by Eurofins MWG GmBH (Ebersberg, Germany) using ABI 3730×L DNA analyser .

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: Digestion of pET28b plasmid and the amplified kIspS fragment with Nco I and Not I to 2 generate pET28b-kIspS- C-term construct. .. Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I.

    Synthesized:

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: Complimentary DNA (cDNA) was synthesized using SuperScript III reverse transcriptase (Invitrogen). .. PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA).

    Article Title: Design and testing of a synthetic biology framework for genetic engineering of Corynebacterium glutamicum
    Article Snippet: DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs. .. Plasmid pTGR, including all the DNA components described in this work were synthesized by Genescript (NJ, USA).

    Construct:

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: Digestion of pET28b plasmid and the amplified kIspS fragment with Nco I and Not I to 2 generate pET28b-kIspS- C-term construct. .. Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I.

    Article Title: Sizing femtogram amounts of dsDNA by single-molecule counting
    Article Snippet: In order to simulate analysis of an unknown sample, 0.5 ng of 1 kbp DNA ladder (NEB) were mixed with 0.5 ng of reference sample, containing the previously calibrated 3 kb and 7 kb populations. .. The reference data were fitted with two Gaussian functions and a calibration curve was constructed using the centers of the fitted peaks and previous calibration results (Figure ).

    Electrophoresis:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. ..

    Quantitation Assay:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. .. Dilutions of the plasmid were used for each real-time PCR assay to generate standard curves for quantitation of target DNA in test samples.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: Paragraph title: RT-PCR of Peripheral Blood RNA ... PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA).

    DNA Sequencing:

    Article Title: Design and testing of a synthetic biology framework for genetic engineering of Corynebacterium glutamicum
    Article Snippet: DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs. .. DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs.

    Sequencing:

    Article Title: Could Public Restrooms Be an Environment for Bacterial Resistomes?
    Article Snippet: Paragraph title: Partial 16S RNA gene sequencing for Staphylococci ... The 2 log DNA ladder I (New England Biolab, Hitchin, UK) was used as molecular size markers.

    Article Title: Design and testing of a synthetic biology framework for genetic engineering of Corynebacterium glutamicum
    Article Snippet: DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs. .. DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs.

    Recombinant:

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I. .. Colony PCR results of the recombinant plasmid pET28b-kIspS -C term in BL21 (DE3) cells.

    Nucleic Acid Electrophoresis:

    Article Title: Extensive libraries of gene truncation variants generated by in vitro transposition
    Article Snippet: Gel electrophoresis was conducted in 0.5X Tris-Borate EDTA buffer (TBE). .. DNA ladders were purchased from NEB.

    Article Title: Cooperativity-based modeling of heterotypic DNA nanostructure assembly
    Article Snippet: Paragraph title: Gel electrophoresis ... The TBE buffer and the Agarose LE were ordered from Promega, while the gel loading dye and DNA ladders were purchased from New England BioLabs.

    Fluorescence:

    Article Title: Sizing femtogram amounts of dsDNA by single-molecule counting
    Article Snippet: Despite having identical lengths, the fluorescence intensity of the Cy5 reference standards is weaker than that of the unlabeled molecules of the same length, most likely due to energy transfer from YOYO-1 to Cy5 ( ). .. In order to simulate analysis of an unknown sample, 0.5 ng of 1 kbp DNA ladder (NEB) were mixed with 0.5 ng of reference sample, containing the previously calibrated 3 kb and 7 kb populations.

    Size-exclusion Chromatography:

    Article Title: Could Public Restrooms Be an Environment for Bacterial Resistomes?
    Article Snippet: PCR thermal cycling conditions were 5 min at 94°C, 30 cycles for 30 sec at 94°C, 1 min for 50°C and 30 sec for 72°C. .. The 2 log DNA ladder I (New England Biolab, Hitchin, UK) was used as molecular size markers.

    Labeling:

    Article Title: Sizing femtogram amounts of dsDNA by single-molecule counting
    Article Snippet: .. RESULTS In order to validate the linear dependency of intercalation intensity on DNA length, 1 ng of a 1 kbp DNA ladder (NEB) was labeled with the intercalating dye YOYO-1 and imaged. ..

    Article Title: Sizing femtogram amounts of dsDNA by single-molecule counting
    Article Snippet: Fitting the red data with two Gaussian functions and placing their centers on the calibration curve, provides the imaged length of the labeled reference populations. .. In order to simulate analysis of an unknown sample, 0.5 ng of 1 kbp DNA ladder (NEB) were mixed with 0.5 ng of reference sample, containing the previously calibrated 3 kb and 7 kb populations.

    Purification:

    Article Title: Extensive libraries of gene truncation variants generated by in vitro transposition
    Article Snippet: Gel Extraction Kit and PCR Purification Kit (QIAGEN) were used according to manufacturer instructions. .. DNA ladders were purchased from NEB.

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: Plasmid DNA was purified by using the Wizard Plus SV Minipreps DNA purification kit (Promega). .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm.

    Polymerase Chain Reaction:

    Article Title: Extensive libraries of gene truncation variants generated by in vitro transposition
    Article Snippet: Gel Extraction Kit and PCR Purification Kit (QIAGEN) were used according to manufacturer instructions. .. DNA ladders were purchased from NEB.

    Article Title: Could Public Restrooms Be an Environment for Bacterial Resistomes?
    Article Snippet: PCR thermal cycling conditions were 5 min at 94°C, 30 cycles for 30 sec at 94°C, 1 min for 50°C and 30 sec for 72°C. .. The 2 log DNA ladder I (New England Biolab, Hitchin, UK) was used as molecular size markers.

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I. .. Colony PCR results of the recombinant plasmid pET28b-kIspS -C term in BL21 (DE3) cells.

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: .. PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA). ..

    Article Title: Design and testing of a synthetic biology framework for genetic engineering of Corynebacterium glutamicum
    Article Snippet: .. DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs. .. Plasmid DNA was prepared by using the Axygen Biosciences Axy-Prep™ Plasmid Minipreps Kit.

    Article Title: Sizing femtogram amounts of dsDNA by single-molecule counting
    Article Snippet: Fitting the grey data with two Gaussian functions and plotting the theoretical length of the PCR products as function of the fitted centers, allows creating a calibration curve (See Supporting Information Figure S7). .. In order to simulate analysis of an unknown sample, 0.5 ng of 1 kbp DNA ladder (NEB) were mixed with 0.5 ng of reference sample, containing the previously calibrated 3 kb and 7 kb populations.

    Article Title: Tumor Grafting Induces Changes of Gut Microbiota in Athymic Nude Mice in the Presence and Absence of Medicinal Gynostemma Saponins
    Article Snippet: .. 10 μl of each PCR product was loaded on 2% (w/v) agarose gels containing 0.5 μg/ml ethidium bromide and run for 40 min at 100 V. A DNA ladder (0.1–10.0 kb) was used as the DNA size marker (NEB, N3200). ..

    Staining:

    Article Title: Cooperativity-based modeling of heterotypic DNA nanostructure assembly
    Article Snippet: Gel electrophoresis DNA folded samples were electrophoresed on 0.5× TBE agarose gels stained with ethidium bromide purchased from Sigma and 11 mM magnesium chloride in an ice- water bath (80–100 V, 3–5 h). .. The TBE buffer and the Agarose LE were ordered from Promega, while the gel loading dye and DNA ladders were purchased from New England BioLabs.

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: .. PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA). ..

    Plasmid Preparation:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. ..

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: Digestion of pET28b plasmid and the amplified kIspS fragment with Nco I and Not I to 2 generate pET28b-kIspS- C-term construct. .. Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I.

    Article Title: Design and testing of a synthetic biology framework for genetic engineering of Corynebacterium glutamicum
    Article Snippet: DNA preparation and PCR techniques Restrictions enzymes, T4 ligase and DNA ladders were purchased from New England Biolabs. .. Plasmid DNA was prepared by using the Axygen Biosciences Axy-Prep™ Plasmid Minipreps Kit.

    Article Title: Identification and Functional Characterization of a Novel Bacterial Type Asparagine Synthetase A
    Article Snippet: Plasmid pET-30a was obtained from Novagen. .. Protein markers and DNA ladders were acquired from New England Biolabs. l -Aspartic acid, l -glutamine, lactate dehydrogenase, myokinase, and pyruvate kinase were obtained from Sigma-Aldrich.

    Software:

    Article Title: Cooperativity-based modeling of heterotypic DNA nanostructure assembly
    Article Snippet: The TBE buffer and the Agarose LE were ordered from Promega, while the gel loading dye and DNA ladders were purchased from New England BioLabs. .. Gels were imaged on an BioRad Gel Doc Imager and analyzed on ImageLab v4.0.1 software.

    Real-time Polymerase Chain Reaction:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. .. Dilutions of the plasmid were used for each real-time PCR assay to generate standard curves for quantitation of target DNA in test samples.

    Multiplex Assay:

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: RT-PCRs were performed using Multiplex polymerase (Qiagen) and primer sets exon 8-F (GCTTGTCAGTCTCGCAAGAAG) and exon 13-R (AATTTGAGCCCTGTTCCAGAG). .. PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA).

    Positron Emission Tomography:

    Article Title: Identification and Functional Characterization of a Novel Bacterial Type Asparagine Synthetase A
    Article Snippet: Plasmid pET-30a was obtained from Novagen. .. Protein markers and DNA ladders were acquired from New England Biolabs. l -Aspartic acid, l -glutamine, lactate dehydrogenase, myokinase, and pyruvate kinase were obtained from Sigma-Aldrich.

    Agarose Gel Electrophoresis:

    Article Title: ATF6 Is Mutated in Early Onset Photoreceptor Degeneration With Macular Involvement
    Article Snippet: .. PCR products were run on 2% agarose gel stained with ethidium bromide along with 1-kb-plus ladder (New England Biolabs, Ipswich, MA, USA). ..

    Spectrophotometry:

    Article Title: Extensive libraries of gene truncation variants generated by in vitro transposition
    Article Snippet: DNA concentrations were determined by measuring absorbance at 260 nm on a Nano Drop spectrophotometer 2000c (Thermo Scientific). .. DNA ladders were purchased from NEB.

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. ..

    Mobility Shift:

    Article Title: Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase *
    Article Snippet: The ϕX174 replicative form I DNA and viral (+) strand DNA were purchased from New England Biolabs. .. For the DNA mobility shift assay, the 83-mer oligonucleotide (5′-TTTATATCCTTTACTTTATTTTCTATGTTTATTCATTTACTTATTTTGTATTATCCTTATACTTTTTACTTTATGTTCATTT-3′) was 5′ end-labeled with T4 polynucleotide kinase (Roche Applied Science) and [γ-32 P]ATP (Amersham Biosciences).

    DNA Purification:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: Plasmid DNA was purified by using the Wizard Plus SV Minipreps DNA purification kit (Promega). .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm.

    Marker:

    Article Title: Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
    Article Snippet: .. Plasmid concentrations were determined by electrophoresis and comparison of band strengths against molecular marker DNA (2-log DNA ladder N3200L; New England BioLabs Ltd., Herts, United Kingdom) and by using a spectrophotometer (Cecil Instruments, Cambridge, United Kingdom) at 260/280 nm. ..

    Article Title: Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory
    Article Snippet: .. Marker: 2 log DNA ladder (1.0–10.0 kb) NEB catalogue #3 N3200, Lane 1: pET28b digested by Nco I and Not I (5.2 kb), Lane 2: kIspS (1.7 kb) digested by Nco I 4 and Not I. .. Colony PCR results of the recombinant plasmid pET28b-kIspS -C term in BL21 (DE3) cells.

    Article Title: Tumor Grafting Induces Changes of Gut Microbiota in Athymic Nude Mice in the Presence and Absence of Medicinal Gynostemma Saponins
    Article Snippet: .. 10 μl of each PCR product was loaded on 2% (w/v) agarose gels containing 0.5 μg/ml ethidium bromide and run for 40 min at 100 V. A DNA ladder (0.1–10.0 kb) was used as the DNA size marker (NEB, N3200). ..

    Gel Extraction:

    Article Title: Extensive libraries of gene truncation variants generated by in vitro transposition
    Article Snippet: Gel Extraction Kit and PCR Purification Kit (QIAGEN) were used according to manufacturer instructions. .. DNA ladders were purchased from NEB.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t7 endonuclease i dna
    SMD is sensitive to T7 endonuclease I. Logarithmically growing apn1/2 cells were arrested in G2/M with nocodazole, treated with MMS (0.1%, 15 min) in PBS and returned to the YPDA+nocodazole medium. Cells were collected at the indicated times and processed for <t>DNA</t> plug preparation. The plugs were then incubated with T7 endonuclease I as described in the Materials and Methods or in buffer only (mock-treated). The SMD was estimated in the ethidium bromide stained gel by comparing the amount of DNA material in the SMD region to DNA in the small chromosomes that experienced little breakage, “SMD / Chr (I+VI)”.
    T7 Endonuclease I Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 endonuclease i dna/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t7 endonuclease i dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    New England Biolabs mse i library dna
    Overall strategy for cloning methylated CpG islands. In step 1, genomic <t>DNA</t> was digested with <t>Mse</t> I (red), which cuts between CpG islands, and Hpa II (blue), which cuts unmethylated CpG islands. Mse I fragments containing methylated CpG islands then are transformed into a bacterial strain that does not cut methylated DNA. However, brief bacterial passage leads to loss of methylation of these previously methylated sequences. In step 2, the library DNA is pooled and digested with Eag I (green), which cuts relatively large fragments within CpG islands, and these fragments are then subcloned.
    Mse I Library Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mse i library dna/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mse i library dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    New England Biolabs sma i dna fragments
    Schematic representation and computer-aided dendrogram analysis of the 83 <t>Sma</t> I pulsotypes of S. aureus <t>DNA</t> from strains producing at least one epidermolysin and isolated from patients with impetigo in metropolitan France. Columns: a, pulsotype numbers; b, number of isolates corresponding to each pulsotype (numbers in parentheses are the numbers of isolates producing at least one epidermolysin and LukE-LukD); c, different phage groups, with sensitivities of isolates distinguished in each pulsotype (NC, nonclassified phages 81, 94, 95, and 96; NT, nontypeable isolate).
    Sma I Dna Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sma i dna fragments/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sma i dna fragments - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    New England Biolabs dnase i treated dna
    A specifically positioned nucleosome covers the promoter of HPV-16. (A) The HPV-16 LCR cloned in pHPV-16-Luc was assembled into chromatin with Drosophila S190 extracts and treated with increasing amounts of <t>DNase</t> I, and the resulting fragments were purified and assayed by primer extension. Lanes 2 and 3, footprints originating from two nucleosomes that overlap with the promoter and the enhancer (large and small oval shapes on the right). Weak 10-bp-spaced bands (filled stars) indicate <t>DNase</t> I accessibility due to the rotational phasing of the nucleosomes, and a strong hypersensitive site (open star) suggests the center of the dyad symmetry of the nucleosome. As controls, lane 1 shows DNase I treatment of free HPV-16 LCR DNA and the left side of the panel indicates a sequencing ladder. Lane M, size marker with bands at 500, 400, 300, 200, and 100 bp. Symbols and nucleotides on the left identify the four cis -responsive elements of the E6 promoter, namely, binding sites for Sp1, the viral factor E2, and TBP. (B) Footprint obtained in a similar experiment and permitting similar interpretations. It highlights the 10-bp periodicity but does not permit clear mapping of the extent of nucleosomal protection.
    Dnase I Treated Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i treated dna/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dnase i treated dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    SMD is sensitive to T7 endonuclease I. Logarithmically growing apn1/2 cells were arrested in G2/M with nocodazole, treated with MMS (0.1%, 15 min) in PBS and returned to the YPDA+nocodazole medium. Cells were collected at the indicated times and processed for DNA plug preparation. The plugs were then incubated with T7 endonuclease I as described in the Materials and Methods or in buffer only (mock-treated). The SMD was estimated in the ethidium bromide stained gel by comparing the amount of DNA material in the SMD region to DNA in the small chromosomes that experienced little breakage, “SMD / Chr (I+VI)”.

    Journal: PLoS Genetics

    Article Title: Alkylation Base Damage Is Converted into Repairable Double-Strand Breaks and Complex Intermediates in G2 Cells Lacking AP Endonuclease

    doi: 10.1371/journal.pgen.1002059

    Figure Lengend Snippet: SMD is sensitive to T7 endonuclease I. Logarithmically growing apn1/2 cells were arrested in G2/M with nocodazole, treated with MMS (0.1%, 15 min) in PBS and returned to the YPDA+nocodazole medium. Cells were collected at the indicated times and processed for DNA plug preparation. The plugs were then incubated with T7 endonuclease I as described in the Materials and Methods or in buffer only (mock-treated). The SMD was estimated in the ethidium bromide stained gel by comparing the amount of DNA material in the SMD region to DNA in the small chromosomes that experienced little breakage, “SMD / Chr (I+VI)”.

    Article Snippet: Resolution of the slow moving DNA (SMD) intermediate with T7 endonuclease I DNA was digested in agarose plugs with T7 endonuclease I (New England Biolabs, Beverly, MA).

    Techniques: Incubation, Staining

    Overall strategy for cloning methylated CpG islands. In step 1, genomic DNA was digested with Mse I (red), which cuts between CpG islands, and Hpa II (blue), which cuts unmethylated CpG islands. Mse I fragments containing methylated CpG islands then are transformed into a bacterial strain that does not cut methylated DNA. However, brief bacterial passage leads to loss of methylation of these previously methylated sequences. In step 2, the library DNA is pooled and digested with Eag I (green), which cuts relatively large fragments within CpG islands, and these fragments are then subcloned.

    Journal: Genome Research

    Article Title: A Genome-Wide Screen for Normally Methylated Human CpG Islands That Can Identify Novel Imprinted Genes

    doi: 10.1101/gr.224102

    Figure Lengend Snippet: Overall strategy for cloning methylated CpG islands. In step 1, genomic DNA was digested with Mse I (red), which cuts between CpG islands, and Hpa II (blue), which cuts unmethylated CpG islands. Mse I fragments containing methylated CpG islands then are transformed into a bacterial strain that does not cut methylated DNA. However, brief bacterial passage leads to loss of methylation of these previously methylated sequences. In step 2, the library DNA is pooled and digested with Eag I (green), which cuts relatively large fragments within CpG islands, and these fragments are then subcloned.

    Article Snippet: In the second step, 100 μg of the Mse I library DNA were digested with 1,000 U of Eag I (NEB) according to the manufacturer’s conditions.

    Techniques: Clone Assay, Methylation, Transformation Assay

    Schematic representation and computer-aided dendrogram analysis of the 83 Sma I pulsotypes of S. aureus DNA from strains producing at least one epidermolysin and isolated from patients with impetigo in metropolitan France. Columns: a, pulsotype numbers; b, number of isolates corresponding to each pulsotype (numbers in parentheses are the numbers of isolates producing at least one epidermolysin and LukE-LukD); c, different phage groups, with sensitivities of isolates distinguished in each pulsotype (NC, nonclassified phages 81, 94, 95, and 96; NT, nontypeable isolate).

    Journal: Journal of Clinical Microbiology

    Article Title: Staphylococcus aureus Isolated in Cases of Impetigo Produces Both Epidermolysin A or B and LukE-LukD in 78% of 131 Retrospective and Prospective Cases

    doi: 10.1128/JCM.39.12.4349-4356.2001

    Figure Lengend Snippet: Schematic representation and computer-aided dendrogram analysis of the 83 Sma I pulsotypes of S. aureus DNA from strains producing at least one epidermolysin and isolated from patients with impetigo in metropolitan France. Columns: a, pulsotype numbers; b, number of isolates corresponding to each pulsotype (numbers in parentheses are the numbers of isolates producing at least one epidermolysin and LukE-LukD); c, different phage groups, with sensitivities of isolates distinguished in each pulsotype (NC, nonclassified phages 81, 94, 95, and 96; NT, nontypeable isolate).

    Article Snippet: Electrophoresis of Sma I DNA fragments began with 2-s pulses for 1 h, followed by 14-s pulses for 1 h, 12-s pulses for 1.5 h, 10-s pulses for 2.5 h, 8-s pulses for 6 h, and 6-s pulses for 6 h. Lambda PFG Marker (New England Biolabs) was used as a molecular marker.

    Techniques: Isolation

    Schematic representation and computer-aided dendrogram analysis of the 48 Sma I pulsotypes of S. aureus DNA from strains originating from patients with impetigo in French Guiana. Columns: a, pulsotype numbers; b, number of isolates corresponding to each pulsotype (numbers in parentheses are the numbers of isolates producing at least one epidermolysin and LukE-LukD); c, sensitivity of isolates distinguished in each pulsotype to phages belonging to phage groups (NC, nonclassified phages 81, 94, 95, and 96).

    Journal: Journal of Clinical Microbiology

    Article Title: Staphylococcus aureus Isolated in Cases of Impetigo Produces Both Epidermolysin A or B and LukE-LukD in 78% of 131 Retrospective and Prospective Cases

    doi: 10.1128/JCM.39.12.4349-4356.2001

    Figure Lengend Snippet: Schematic representation and computer-aided dendrogram analysis of the 48 Sma I pulsotypes of S. aureus DNA from strains originating from patients with impetigo in French Guiana. Columns: a, pulsotype numbers; b, number of isolates corresponding to each pulsotype (numbers in parentheses are the numbers of isolates producing at least one epidermolysin and LukE-LukD); c, sensitivity of isolates distinguished in each pulsotype to phages belonging to phage groups (NC, nonclassified phages 81, 94, 95, and 96).

    Article Snippet: Electrophoresis of Sma I DNA fragments began with 2-s pulses for 1 h, followed by 14-s pulses for 1 h, 12-s pulses for 1.5 h, 10-s pulses for 2.5 h, 8-s pulses for 6 h, and 6-s pulses for 6 h. Lambda PFG Marker (New England Biolabs) was used as a molecular marker.

    Techniques:

    A specifically positioned nucleosome covers the promoter of HPV-16. (A) The HPV-16 LCR cloned in pHPV-16-Luc was assembled into chromatin with Drosophila S190 extracts and treated with increasing amounts of DNase I, and the resulting fragments were purified and assayed by primer extension. Lanes 2 and 3, footprints originating from two nucleosomes that overlap with the promoter and the enhancer (large and small oval shapes on the right). Weak 10-bp-spaced bands (filled stars) indicate DNase I accessibility due to the rotational phasing of the nucleosomes, and a strong hypersensitive site (open star) suggests the center of the dyad symmetry of the nucleosome. As controls, lane 1 shows DNase I treatment of free HPV-16 LCR DNA and the left side of the panel indicates a sequencing ladder. Lane M, size marker with bands at 500, 400, 300, 200, and 100 bp. Symbols and nucleotides on the left identify the four cis -responsive elements of the E6 promoter, namely, binding sites for Sp1, the viral factor E2, and TBP. (B) Footprint obtained in a similar experiment and permitting similar interpretations. It highlights the 10-bp periodicity but does not permit clear mapping of the extent of nucleosomal protection.

    Journal: Journal of Virology

    Article Title: The Chromatin Structure of the Long Control Region of Human Papillomavirus Type 16 Represses Viral Oncoprotein Expression

    doi:

    Figure Lengend Snippet: A specifically positioned nucleosome covers the promoter of HPV-16. (A) The HPV-16 LCR cloned in pHPV-16-Luc was assembled into chromatin with Drosophila S190 extracts and treated with increasing amounts of DNase I, and the resulting fragments were purified and assayed by primer extension. Lanes 2 and 3, footprints originating from two nucleosomes that overlap with the promoter and the enhancer (large and small oval shapes on the right). Weak 10-bp-spaced bands (filled stars) indicate DNase I accessibility due to the rotational phasing of the nucleosomes, and a strong hypersensitive site (open star) suggests the center of the dyad symmetry of the nucleosome. As controls, lane 1 shows DNase I treatment of free HPV-16 LCR DNA and the left side of the panel indicates a sequencing ladder. Lane M, size marker with bands at 500, 400, 300, 200, and 100 bp. Symbols and nucleotides on the left identify the four cis -responsive elements of the E6 promoter, namely, binding sites for Sp1, the viral factor E2, and TBP. (B) Footprint obtained in a similar experiment and permitting similar interpretations. It highlights the 10-bp periodicity but does not permit clear mapping of the extent of nucleosomal protection.

    Article Snippet: DNase I-treated DNA was purified by standard procedures and used as a template for the extension reaction with Vent (exo-) polymerase (New England Biolabs).

    Techniques: Clone Assay, Purification, Sequencing, Marker, Binding Assay

    A specifically positioned nucleosome covers the replication origin of HPV-18 and extends into E6 promoter sequences. The cloned HPV-18 LCR was assembled into chromatin with Drosophila S190 extracts and treated with increasing amounts of DNase I, and the resulting fragments were assayed by primer extension. Lanes 3 to 7 show, with increasing DNase I treatment, the footprint of a nucleosome overlapping the replication origin (distal E2 and E1 binding site), indicated by a large hatched oval on the right. Weak 10-bp-spaced bands (filled stars) indicate DNase I accessibility due to the rotational phasing of the nucleosomal organization, and a strong hypersensitivity site (open star) suggests the center of the dyad symmetry of the nucleosome. As controls, lanes 1 and 2 show DNase I treatment of free HPV-18 LCR DNA, and the left side shows a sequencing ladder of this sequence. Lane M, size marker with bands at 500, 400, 300, 200, and 100 bp. Symbols and nucleotides on the right identify the third E2 binding site from the E6 promoter, the E1 binding site, and one of the four cis -responsive elements of the E6 promoter, namely, the binding site for Sp1.

    Journal: Journal of Virology

    Article Title: The Chromatin Structure of the Long Control Region of Human Papillomavirus Type 16 Represses Viral Oncoprotein Expression

    doi:

    Figure Lengend Snippet: A specifically positioned nucleosome covers the replication origin of HPV-18 and extends into E6 promoter sequences. The cloned HPV-18 LCR was assembled into chromatin with Drosophila S190 extracts and treated with increasing amounts of DNase I, and the resulting fragments were assayed by primer extension. Lanes 3 to 7 show, with increasing DNase I treatment, the footprint of a nucleosome overlapping the replication origin (distal E2 and E1 binding site), indicated by a large hatched oval on the right. Weak 10-bp-spaced bands (filled stars) indicate DNase I accessibility due to the rotational phasing of the nucleosomal organization, and a strong hypersensitivity site (open star) suggests the center of the dyad symmetry of the nucleosome. As controls, lanes 1 and 2 show DNase I treatment of free HPV-18 LCR DNA, and the left side shows a sequencing ladder of this sequence. Lane M, size marker with bands at 500, 400, 300, 200, and 100 bp. Symbols and nucleotides on the right identify the third E2 binding site from the E6 promoter, the E1 binding site, and one of the four cis -responsive elements of the E6 promoter, namely, the binding site for Sp1.

    Article Snippet: DNase I-treated DNA was purified by standard procedures and used as a template for the extension reaction with Vent (exo-) polymerase (New England Biolabs).

    Techniques: Clone Assay, Binding Assay, Sequencing, Marker