Structured Review

The Jackson Laboratory human myotilin tgt57i transgene
miMYOT mediates silencing of human <t>myotilin</t> in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to <t>TgT57I</t> mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.
Human Myotilin Tgt57i Transgene, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human myotilin tgt57i transgene/product/The Jackson Laboratory
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
human myotilin tgt57i transgene - by Bioz Stars, 2020-07
86/100 stars

Images

1) Product Images from "RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice"

Article Title: RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1038/mtna.2014.13

miMYOT mediates silencing of human myotilin in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to TgT57I mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.
Figure Legend Snippet: miMYOT mediates silencing of human myotilin in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to TgT57I mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.

Techniques Used: In Vitro, In Vivo, Generated, Construct, Real-time Polymerase Chain Reaction, Western Blot, Transfection, Mutagenesis, Expressing, Plasmid Preparation

Related Articles

Mouse Assay:

Article Title: RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice
Article Snippet: .. Mice hemizygous for human myotilin TgT57I transgene were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained by breeding onto the C57BL/6 background. .. Male TgT57I and wild-type C57BL/6 littermates were identified by PCR genotyping of genomic DNA from newborn mice (P1) using primers detecting the human MYOT transgene (forward, 5′- GCAAAGATTTTCTGCCTCCTCAAC -3′ and reverse, 5′- GCGGAAGGGATTTTACTGCTATTG -3′) and the mouse Y chromosome (SRY gene; forward, 5′-GTGTCACAGAGGAGTGGCATTTTAC-3′ and reverse, 5′-TTGCTGCTGGTGGTGGTTATGG-3′).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    The Jackson Laboratory human myotilin tgt57i transgene
    miMYOT mediates silencing of human <t>myotilin</t> in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to <t>TgT57I</t> mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.
    Human Myotilin Tgt57i Transgene, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human myotilin tgt57i transgene/product/The Jackson Laboratory
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human myotilin tgt57i transgene - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    miMYOT mediates silencing of human myotilin in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to TgT57I mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    doi: 10.1038/mtna.2014.13

    Figure Lengend Snippet: miMYOT mediates silencing of human myotilin in vitro and in vivo . ( a ) Four different MYOT-targeted artificial miRNAs (mi1291, mi1321, mi1366, and mi1490) were generated and tested for their ability to stimulate human MYOT gene silencing in HEK293 cells. Data shown are representative of three independent experiments. The lead miMYOT construct, mi1321, stimulated an 81 and 62% knockdown of MYOT mRNA (top, real-time PCR) and protein (bottom, western blot), respectively. Gene silencing data are calculated relative to samples transfected with a control miRNA targeting eGFP (miGFP). 22 Individual samples were normalized to GAPDH. The mi1321 construct is referred to as miMYOT in all subsequent figures. ( b,c ), AAV6-delivery of the U6.miMYOT construct to TgT57I mouse gastrocnemius muscle reduced mutant MYOT expression in 3- and 9-month-old animals, compared to AAV6-treated miGFP or miLacZ 29 controls, respectively. Specifically, by 3 months, MYOT mRNA and protein was reduced 50 and 54% and at 9 months, these values were 79 and 63%, respectively. For both timepoints, N = 8 animals, with one leg receiving AAV.miMYOT and the other a control miRNA vector. QPCR data represents means ± SEM. Western blots show three representative samples. C, control-treated legs; T, miMYOT-treated legs.

    Article Snippet: Mice hemizygous for human myotilin TgT57I transgene were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained by breeding onto the C57BL/6 background.

    Techniques: In Vitro, In Vivo, Generated, Construct, Real-time Polymerase Chain Reaction, Western Blot, Transfection, Mutagenesis, Expressing, Plasmid Preparation