ht 2a r sirna  (Santa Cruz Biotechnology)

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-cMyc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 4 independent experiments) ( A ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). ( G-I ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR3. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR3 mRNA was assessed by RT-qPCR (n = 9 independent experiments) ( G ), and mGluR3 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( H ). Representative immunoblots are shown ( I ). Unpaired two-tailed Student’s t -test (*p < 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( A ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-c-Myc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). Unpaired two-tailed Student’s t -test (p > 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A, B) Validation of cytosolic fractionation of RNP complexes using RIP Assay kit by using a cytosolic marker α-Tubulin (A) and a nuclear marker Lamin A/C (B) . (C) Immunoblot with an anti-cMyc antibody in HEK293 cells transiently transfected with pcDNA3.1-c-Myc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc. (D) Immunoblot with an anti-HA antibody in HEK293 cells transiently transfected with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Fractionation, Marker, Western Blot, Transfection

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The mGluR2 targeting antibody (anti-HA, magenta) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of mGluR2. ( B ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The 5-HT 2A R targeting antibody (anti-cMyc, dark green) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of 5-HT 2A R. ( C ) HEK293 cells were co-transfected with pcDNA3.1-HA-mGluR2, and pcDNA3.1-cMyc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc constructs, or mock. Images show representative RT-PCR products for mGluR2 , 5-HT 2A R and 5-HT 2C R transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( D ) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2, pcDNA3.1-HA-mGluR3 or pcDNA3.1-TAA-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-cMyc antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( E ) Schematic showing anti-cMyc antibody used to immunoprecipitate 5-HT 2A R protein and association of 5-HT 2A R and mGluR2 transcripts in the absence of mGluR2 protein. ( F ) Immunoblot demonstrating loss of HA-mGluR2 protein when the translation initiation site is mutated (TAA). (G, H) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R and mGluR2 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. RIP assays were performed in presence and absence of EDTA (25 mM). ( H ) Quantification of change in IP band intensities of RT-PCR products for 5-HT 2A R and mGluR2 transcripts as observed in presence and absence of 25mM EDTA. Representative image ( G ), and quantification of IP/input band intensities (n = 3 independent experiments performed in triplicate) ( H ). ( I ) Images show representative RT-PCR products for 5-HT 2A R , 5-HT 2C R and mGluR2 transcripts from mouse frontal cortex samples before (Input) and after immuno-precipitation (IP) using an anti-mGluR2 antibody. Data are representative from three independent experiments in 3 mice. ( J ) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and 5-HT 2C R transcripts. Data are shown as fold change of IP/Input (n = 3 mice). Two-way ANOVA followed by Bonferroni’s post-hoc test ( H ), and unpaired two-tailed Student’s t -test ( J ). (*p < 0.05, **p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Immunoprecipitation, Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Control, Expressing, Western Blot, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Confocal micrographs of HEK293 cells transiently transfected with pcDNA3.1-cMyc-5-HT 2A R-mCherry (red) and HA-mGluR2-mCitrine (green), and stained with anti-calnexin (upper panel, magenta) or anti-58-K (lower panel, magenta) and secondary antibodies, and imaged to detect mCherry, mCitrine, anti-calnexin, and anti-58-K. Nuclei were stained in blue with Hoechst. Scale bars, 5 µM. ( B ) Schematic representation of a working model for the mechanism of 5-HT 2A R and mGluR2 transcript association and subcellular localization of the 5-HT 2A R-mGluR2 heterocomplex during maturation. Following co-translational association within RNP complexes containing RPS24, 5-HT 2A R and mGluR2 are trafficked to the ER as part of a protein complex. Subsequently, this GPCR heterocomplex is translocated to the Golgi apparatus and directed to the cell membrane or other subcellular compartments.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Staining, Membrane

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A-C) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, input and IP samples underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R (A) , 5-HT 2C R (B) and mGluR2 (C) transcripts (n = 3 mice). Unpaired two-tailed Student’s t -test (*p < 0.05, **p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Venn diagram showing the overlap of identified polypeptides by LC-MS/MS in parental HEK293 cells, cells transfected solely with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3, and cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R following RIP assay using the anti-HA antibody. ( B ) Dot plot depicting polypeptides present in HEK293 cells transfected solely with pcDNA3.1-HA-mGluR2 as well as in cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R, but not in parental HEK293 cells or in cells transfected solely with pcDNA3.1-HA-mGluR3. ( C ) LC-MS/MS analysis identifying with high confidence two tryptic peptides – QMVIDVLHPGK (top) and TTPKVIFVFGFR (bottom) – from RPS24. Mass-to-Charge (m/z) peptide fragments for the y ions (blue) and the b ions (red) are displayed in the spectra (D, E) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-RPS24 antibody. Representative image ( D ), and quantification of IP/input band intensities (n = 3 independent experiments) ( E ). ( F ) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-c-Myc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RIP assays were carried out 24 h following DNA transfection using an anti-HA antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and mGluR2 transcripts. Data are shown as fold change of IP/Input (n = 4 independent samples). Unpaired two-tailed Student’s t -test (*p < 0.05, ***p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Liquid Chromatography with Mass Spectroscopy, Transfection, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Construct, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A) Immunoblot depicting RPS24 immunoreactivity in RIP preparations from parental HEK293 cells, as well as cells co-transfected with pcDNA3.1-cMyc-5HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. (B) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RNA extractions were carried out 24 h following DNA transfection in Input samples. RPS24 mRNA was assessed by RT-qPCR (n = 4 independent samples). Unpaired two-tailed Student’s t -test (***p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Western Blot, Transfection, Construct, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-cMyc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 4 independent experiments) ( A ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). ( G-I ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR3. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR3 mRNA was assessed by RT-qPCR (n = 9 independent experiments) ( G ), and mGluR3 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( H ). Representative immunoblots are shown ( I ). Unpaired two-tailed Student’s t -test (*p < 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( A ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-c-Myc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). Unpaired two-tailed Student’s t -test (p > 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A, B) Validation of cytosolic fractionation of RNP complexes using RIP Assay kit by using a cytosolic marker α-Tubulin (A) and a nuclear marker Lamin A/C (B) . (C) Immunoblot with an anti-cMyc antibody in HEK293 cells transiently transfected with pcDNA3.1-c-Myc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc. (D) Immunoblot with an anti-HA antibody in HEK293 cells transiently transfected with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Fractionation, Marker, Western Blot, Transfection

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The mGluR2 targeting antibody (anti-HA, magenta) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of mGluR2. ( B ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The 5-HT 2A R targeting antibody (anti-cMyc, dark green) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of 5-HT 2A R. ( C ) HEK293 cells were co-transfected with pcDNA3.1-HA-mGluR2, and pcDNA3.1-cMyc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc constructs, or mock. Images show representative RT-PCR products for mGluR2 , 5-HT 2A R and 5-HT 2C R transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( D ) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2, pcDNA3.1-HA-mGluR3 or pcDNA3.1-TAA-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-cMyc antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( E ) Schematic showing anti-cMyc antibody used to immunoprecipitate 5-HT 2A R protein and association of 5-HT 2A R and mGluR2 transcripts in the absence of mGluR2 protein. ( F ) Immunoblot demonstrating loss of HA-mGluR2 protein when the translation initiation site is mutated (TAA). (G, H) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R and mGluR2 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. RIP assays were performed in presence and absence of EDTA (25 mM). ( H ) Quantification of change in IP band intensities of RT-PCR products for 5-HT 2A R and mGluR2 transcripts as observed in presence and absence of 25mM EDTA. Representative image ( G ), and quantification of IP/input band intensities (n = 3 independent experiments performed in triplicate) ( H ). ( I ) Images show representative RT-PCR products for 5-HT 2A R , 5-HT 2C R and mGluR2 transcripts from mouse frontal cortex samples before (Input) and after immuno-precipitation (IP) using an anti-mGluR2 antibody. Data are representative from three independent experiments in 3 mice. ( J ) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and 5-HT 2C R transcripts. Data are shown as fold change of IP/Input (n = 3 mice). Two-way ANOVA followed by Bonferroni’s post-hoc test ( H ), and unpaired two-tailed Student’s t -test ( J ). (*p < 0.05, **p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Immunoprecipitation, Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Control, Expressing, Western Blot, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Confocal micrographs of HEK293 cells transiently transfected with pcDNA3.1-cMyc-5-HT 2A R-mCherry (red) and HA-mGluR2-mCitrine (green), and stained with anti-calnexin (upper panel, magenta) or anti-58-K (lower panel, magenta) and secondary antibodies, and imaged to detect mCherry, mCitrine, anti-calnexin, and anti-58-K. Nuclei were stained in blue with Hoechst. Scale bars, 5 µM. ( B ) Schematic representation of a working model for the mechanism of 5-HT 2A R and mGluR2 transcript association and subcellular localization of the 5-HT 2A R-mGluR2 heterocomplex during maturation. Following co-translational association within RNP complexes containing RPS24, 5-HT 2A R and mGluR2 are trafficked to the ER as part of a protein complex. Subsequently, this GPCR heterocomplex is translocated to the Golgi apparatus and directed to the cell membrane or other subcellular compartments.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Staining, Membrane

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A-C) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, input and IP samples underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R (A) , 5-HT 2C R (B) and mGluR2 (C) transcripts (n = 3 mice). Unpaired two-tailed Student’s t -test (*p < 0.05, **p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Venn diagram showing the overlap of identified polypeptides by LC-MS/MS in parental HEK293 cells, cells transfected solely with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3, and cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R following RIP assay using the anti-HA antibody. ( B ) Dot plot depicting polypeptides present in HEK293 cells transfected solely with pcDNA3.1-HA-mGluR2 as well as in cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R, but not in parental HEK293 cells or in cells transfected solely with pcDNA3.1-HA-mGluR3. ( C ) LC-MS/MS analysis identifying with high confidence two tryptic peptides – QMVIDVLHPGK (top) and TTPKVIFVFGFR (bottom) – from RPS24. Mass-to-Charge (m/z) peptide fragments for the y ions (blue) and the b ions (red) are displayed in the spectra (D, E) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-RPS24 antibody. Representative image ( D ), and quantification of IP/input band intensities (n = 3 independent experiments) ( E ). ( F ) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-c-Myc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RIP assays were carried out 24 h following DNA transfection using an anti-HA antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and mGluR2 transcripts. Data are shown as fold change of IP/Input (n = 4 independent samples). Unpaired two-tailed Student’s t -test (*p < 0.05, ***p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Liquid Chromatography with Mass Spectroscopy, Transfection, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Construct, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A) Immunoblot depicting RPS24 immunoreactivity in RIP preparations from parental HEK293 cells, as well as cells co-transfected with pcDNA3.1-cMyc-5HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. (B) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RNA extractions were carried out 24 h following DNA transfection in Input samples. RPS24 mRNA was assessed by RT-qPCR (n = 4 independent samples). Unpaired two-tailed Student’s t -test (***p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Western Blot, Transfection, Construct, Quantitative RT-PCR, Two Tailed Test

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Serotonin receptors are abnormally upregulated during early‐stage AD in the BLA. (a) A hierarchically clustered heatmap showed expression patterns of 13 emotion‐related genes in the human amygdala. (b) The mRNA expression levels of emotion‐related genes in the human amygdala ( n = 11–18 brain samples for each group). (c) Expression levels of 5‐HT 1A R, 5‐HT 2A R, 5‐HT 2B R, 5‐HT 2C R, 5‐HT 3A R, 5‐HT 4 R, 5‐HT 6 R and 5‐HT 7 R proteins in the amygdala from PW10 WT and APP/PS1 mice ( n = 3 animals for each group). (d, e) Representative images and summary data of 5‐HT 2A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 4 to 5 mice for each group). The white arrowheads denote co‐labeled 5‐HT 2A R + /TBR1 + , 5‐HT 2A R + /PV + or 5‐HT 2A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. (f, g) Representative images and summary data of 5‐HT 1A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 6 mice for each group). The white arrowheads denote co‐labeled 5‐HT 1A R + /TBR1 + , 5‐HT 1A R + /PV + or 5‐HT 1A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. Statistical significance was assessed by unpaired Student's t test in (c), (e), and (g), one‐way ANOVA with post hoc comparisons (Tukey test) between groups in (b). All data are presented as the mean ± SEM. * means the difference between normal brain and probably AD brain or normal brain and definite AD brain, # means the difference between probably AD brain and definite AD brain. * p < 0.05; ** p < 0.01; **** p < 0.0001; # p < 0.05; ## p < 0.01; ### p < 0.001; #### p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Expressing, Immunofluorescence, Labeling

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Double knockdown of serotonin receptors rescues mood defeats in APP/PS1 mice. (a) The schematic illustrates combined knockdown 5‐HT 2A R in pyramidal neuron and 5‐HT 1A R in PV interneuron. (b) Left panel showed experimental scheme of virus injection in BLA and data analysis. Right panel showed histologically verified placements of viral injections in BLA. Scale bars, 200 μm; 125 μm for magnified images. (c) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the central time and total distance of APP/PS1 mice in OFT ( n = 8–10 animals for each group). (d) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the time in open arms of APP/PS1 mice in EPM ( n = 8–10 animals for each group). (e) Representative traces for action potential firing of WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and statistical data for action potential firing recorded in four groups ( n = 12–14 cells from 3 to 4 mice for each group). (f) Sample traces of eEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for eEPSCs from the four groups ( n = 12–16 cells from 3 to 4 mice per group). (g) Sample traces of sEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sEPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). (h) Sample traces of sIPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sIPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). Statistical significance was assessed by two‐way repeated measures ANOVA with post hoc comparisons (Tukey test) between groups in (c)–(h). All data are presented as mean ± SEM. * p < 0.05; ** p < 0.01; **** p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Knockdown, Virus, Injection, shRNA