hotstar taq dna polymerase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen hotstar taq dna polymerase
    Hotstar Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 360 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar taq dna polymerase/product/Qiagen
    Average 99 stars, based on 360 article reviews
    Price from $9.99 to $1999.99
    hotstar taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: .. Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen). .. PCR conditions were 94 °C for 4 min followed by 45 cycles of 95 °C for 20 s, 56 °C for 20 s, and 72 °C for 60 s, with a final extension of 72 °C for 3 min. Primer sequences are given in Table .

    Article Title: A Novel Putative Enterococcal Pathogenicity Island Linked to the esp Virulence Gene of Enterococcus faecium and Associated with Epidemicity
    Article Snippet: PCR conditions for all amplification reactions were as follows: initial denaturation at 95°C for 15 min, followed by 35 cycles of 30 s at 94°C, 30 s at 52°C, and 30 s at 72°C, and a final 5-min extension at 72°C. .. Reactions were performed in 25-μl volumes with HotStar Taq polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, Calif.).

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: .. Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Phylogenetic analysis and genotype prediction Amplification conditions were 95 • C for 15 min, 40× (94 • C for 1 min, 50 • C for 1 min, 72 • C for 30 s) and a 10 min final extension step.

    Article Title: Sex- and species-biased gene flow in a spotted eagle hybrid zone
    Article Snippet: .. Amplification was performed in 25 μl containing 25-50 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1 × Amplitaq Gold PCR buffer (Applied Biosystems) or Hotstar Taq polymerase with 1 × buffer (Qiagen), 2.5 mM MgCl2, 0.5 μM of each primer and 0.2 mM dNTP. .. The PCR profile included an initial heating at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 60°C to 50°C for 30 s and 72°C for 1 min, and a final extension at 72°C for 10 min. During first subset of cycles (10 or 20), an annealing temperature was decreased by 0.5°C or 1°C for every cycle, whereas for the remaining cycles 50°C was used.

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: .. The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen). ..

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: The reaction was chilled at 4°C, and cDNA was stored at −20°C until PCR amplification. .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen).

    Article Title: Parainfluenza 3-Induced Cough Hypersensitivity in the Guinea Pig Airways
    Article Snippet: The reaction was chilled at 4°C, and cDNA was stored at −20°C until PCR amplification. .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2, and 10× PCR buffer (Qiagen, Valencia, CA, USA).

    Article Title: Reverse Line Blot Hybridization Assay for Identification of Medically Important Fungi from Culture and Clinical Specimens ▿
    Article Snippet: PCRs were performed in 25-μl reaction mixtures containing 0.5 U HotStar Taq polymerase and 1× PCR buffer (catalogue no. 203203; QIAGEN, Doncaster, Victoria, Australia), 125 μM of each dATP, dCTP, dGTP, and dTTP (Roche Diagnostics), 0.5 μM of each forward and reverse primer, and 5 μl of DNA template. .. Amplification was performed on a Mastercycler gradient thermocycler (Eppendorf AG, North Ryde, Australia).

    Article Title: Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago
    Article Snippet: .. PCR conditions for all amplification reactions were performed in 25 μ L volumes with HotStar Taq Polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, CA). .. Subsequently, the amplicons were subjected to agarose gel electrophoresis (1%) in order to determine their sizes.

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: Paragraph title: DNA extraction and PCR amplification o f the ERG11 gene ... Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl.

    Positive Control:

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen). .. RNA isolated from human astrovirus serotype 8 was used as a positive control in the RT-PCR set-up.

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen). .. As a positive control, RNA was isolated from whole nodose ganglion and reverse transcribed using Omniscript RT Kit (Qiagen).

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. The PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    TA Cloning:

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. The amplicons were sequenced directly or after TOPO TA cloning and contigs spanning the junction of ORF1 and ORF2 were assembled in CLC Combined Workbench v. 3.0.1.

    Quantitative RT-PCR:

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: .. Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Phylogenetic analysis and genotype prediction Amplification conditions were 95 • C for 15 min, 40× (94 • C for 1 min, 50 • C for 1 min, 72 • C for 30 s) and a 10 min final extension step.

    End-sequence Profiling:

    Article Title: A Novel Putative Enterococcal Pathogenicity Island Linked to the esp Virulence Gene of Enterococcus faecium and Associated with Epidemicity
    Article Snippet: Paragraph title: PCR and sequencing of the E. faecium esp gene. ... Reactions were performed in 25-μl volumes with HotStar Taq polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, Calif.).

    Article Title: Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago
    Article Snippet: Paragraph title: 2.2.1. Determination of Variation in the esp A and C Repeats ... PCR conditions for all amplification reactions were performed in 25 μ L volumes with HotStar Taq Polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, CA).

    Electrophoresis:

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. Products were separated by electrophoresis (2% agarose), stained using ethidium bromide, and sequenced to confirm identity.

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. Products were separated by electrophoresis (2% agarose), stained using ethidium bromide, and sequenced to confirm identity.

    Incubation:

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: Subsequently, 1 μl of oligo (dT), random primers (Invitrogen), and 10 mM dNTP Mix were added to each sample and then incubated at 70°C for another 5 min. .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen).

    Article Title: Parainfluenza 3-Induced Cough Hypersensitivity in the Guinea Pig Airways
    Article Snippet: Subsequently, 1 μl of oligo (dT), random primers (Invitrogen), and 10 mM dNTP mix were added to each sample and then incubated at 70°C for another 5 min. .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2, and 10× PCR buffer (Qiagen, Valencia, CA, USA).

    Modification:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: Paragraph title: DNA extraction, sodium bisulfite modification, and PCR ... Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    Hybridization:

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: The near-full length ERG11 gene (1480 bp) was amplified with primers ERG11-S (5' aggggttccatttgtttaca 3') and ERG11-A (5' ccaaatgatttctgctggtt 3'; Beijing AUGCT Biotechnology Co. Ltd., Beijing, China) preparatory to hybridization with padlock probes and subsequent RCA (all isolates; see below) and for ERG11 sequence analysis (ATCC and Australian isolates). .. Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl.

    Sequencing:

    Article Title: A Novel Putative Enterococcal Pathogenicity Island Linked to the esp Virulence Gene of Enterococcus faecium and Associated with Epidemicity
    Article Snippet: Paragraph title: PCR and sequencing of the E. faecium esp gene. ... Reactions were performed in 25-μl volumes with HotStar Taq polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, Calif.).

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: Phylogenetic analysis and genotype prediction As BoNoV specific PCR products with different T m s were obtained, sequencing of a wider region, spanning the primerbinding areas was performed (Fig. 1) . .. Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below.

    Article Title: Sex- and species-biased gene flow in a spotted eagle hybrid zone
    Article Snippet: Strongest single-band PCR products were selected for sequencing resulting in high-quality sequence data for 36 autosomal and 15 Z-chromosomal loci to use in further analysis. .. Amplification was performed in 25 μl containing 25-50 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1 × Amplitaq Gold PCR buffer (Applied Biosystems) or Hotstar Taq polymerase with 1 × buffer (Qiagen), 2.5 mM MgCl2, 0.5 μM of each primer and 0.2 mM dNTP.

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: Paragraph title: RT-PCR design, sequencing and phylogenetic analysis ... The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen).

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: The near-full length ERG11 gene (1480 bp) was amplified with primers ERG11-S (5' aggggttccatttgtttaca 3') and ERG11-A (5' ccaaatgatttctgctggtt 3'; Beijing AUGCT Biotechnology Co. Ltd., Beijing, China) preparatory to hybridization with padlock probes and subsequent RCA (all isolates; see below) and for ERG11 sequence analysis (ATCC and Australian isolates). .. Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl.

    Concentration Assay:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: The DNA concentration and quality were measured using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Houston, TX). .. Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: Paragraph title: DNA extraction, sodium bisulfite modification, and PCR ... Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    Article Title: A Novel Putative Enterococcal Pathogenicity Island Linked to the esp Virulence Gene of Enterococcus faecium and Associated with Epidemicity
    Article Snippet: Paragraph title: PCR and sequencing of the E. faecium esp gene. ... Reactions were performed in 25-μl volumes with HotStar Taq polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, Calif.).

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: .. Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Phylogenetic analysis and genotype prediction Amplification conditions were 95 • C for 15 min, 40× (94 • C for 1 min, 50 • C for 1 min, 72 • C for 30 s) and a 10 min final extension step.

    Article Title: Sex- and species-biased gene flow in a spotted eagle hybrid zone
    Article Snippet: .. Amplification was performed in 25 μl containing 25-50 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1 × Amplitaq Gold PCR buffer (Applied Biosystems) or Hotstar Taq polymerase with 1 × buffer (Qiagen), 2.5 mM MgCl2, 0.5 μM of each primer and 0.2 mM dNTP. .. The PCR profile included an initial heating at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 60°C to 50°C for 30 s and 72°C for 1 min, and a final extension at 72°C for 10 min. During first subset of cycles (10 or 20), an annealing temperature was decreased by 0.5°C or 1°C for every cycle, whereas for the remaining cycles 50°C was used.

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: .. The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen). ..

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen). .. Additionally 10 mM dNTP and custom-synthesized intron-spanning primers (Invitrogen) were added to the reaction mixture in a volume of 2 μl as previously described ( ).

    Article Title: Parainfluenza 3-Induced Cough Hypersensitivity in the Guinea Pig Airways
    Article Snippet: .. The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2, and 10× PCR buffer (Qiagen, Valencia, CA, USA). .. Additionally 10 mM dNTP and selected primers (Invitrogen) were added to the reaction mixture in a volume of 2 μl.

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: .. The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 10 minutes.

    Article Title: Reverse Line Blot Hybridization Assay for Identification of Medically Important Fungi from Culture and Clinical Specimens ▿
    Article Snippet: .. PCRs were performed in 25-μl reaction mixtures containing 0.5 U HotStar Taq polymerase and 1× PCR buffer (catalogue no. 203203; QIAGEN, Doncaster, Victoria, Australia), 125 μM of each dATP, dCTP, dGTP, and dTTP (Roche Diagnostics), 0.5 μM of each forward and reverse primer, and 5 μl of DNA template. .. Amplification was performed on a Mastercycler gradient thermocycler (Eppendorf AG, North Ryde, Australia).

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: .. The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. The PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    Article Title: Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago
    Article Snippet: .. PCR conditions for all amplification reactions were performed in 25 μ L volumes with HotStar Taq Polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, CA). .. Subsequently, the amplicons were subjected to agarose gel electrophoresis (1%) in order to determine their sizes.

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: .. Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl. .. Amplification was performed on a Mastercycler gradient thermocycler (Eppendorf AG, North Ryde, Australia).

    DNA Extraction:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: Paragraph title: DNA extraction, sodium bisulfite modification, and PCR ... Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: Paragraph title: DNA extraction and PCR amplification o f the ERG11 gene ... Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl.

    Isolation:

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: RT-PCR design, sequencing and phylogenetic analysis RNA from the faecal samples was isolated with NucliSens 1 easyMAG TM (BioMé rieux) according to the manufacturer's instructions. .. The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen).

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen). .. As a positive control, RNA was isolated from whole nodose ganglion and reverse transcribed using Omniscript RT Kit (Qiagen).

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. The PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    Purification:

    Article Title: A Novel Putative Enterococcal Pathogenicity Island Linked to the esp Virulence Gene of Enterococcus faecium and Associated with Epidemicity
    Article Snippet: Chromosomal DNA was purified as described elsewhere ( , ). .. Reactions were performed in 25-μl volumes with HotStar Taq polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, Calif.).

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Amplicons were visualized on ethidium bromide stained agarose gels and products of the expected size were excised and purified by a spin column procedure (Qiagen Gel-Extraction kit, Qiagen, Germany).

    Article Title: Sex- and species-biased gene flow in a spotted eagle hybrid zone
    Article Snippet: Amplification was performed in 25 μl containing 25-50 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1 × Amplitaq Gold PCR buffer (Applied Biosystems) or Hotstar Taq polymerase with 1 × buffer (Qiagen), 2.5 mM MgCl2, 0.5 μM of each primer and 0.2 mM dNTP. .. PCR fragments for sequencing were purified by exonuclease I and shrimp alkaline phosphatase (USB) treatment at 37°C for 15 min, followed by denaturation at 80°C for 15 min. Sequencing was performed by DYEnamic ET Terminator or BigDye Terminator sequencing reagent premix and MegaBACE 1000 or ABI 3750 automated capillary sequencer (Amersham Biosciences) according to the manufacturer's recommendations.

    Article Title: Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago
    Article Snippet: Briefly, chromosomal DNA was purified as described elsewhere [ ]. .. PCR conditions for all amplification reactions were performed in 25 μ L volumes with HotStar Taq Polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, CA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
    Article Snippet: Paragraph title: RT-PCR design, sequencing and phylogenetic analysis ... The RT reaction was performed in a thermocycler (MJ Research) at 50 8C for 30 min, followed by an inactivation step at 70 8C for 15 min. 2,5 mL cDNA were used in a 25 mL PCR reaction and amplified by using HotStar Taq DNA polymerase (Qiagen).

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: Paragraph title: Single-neuron RT-PCR. ... The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen).

    Article Title: Parainfluenza 3-Induced Cough Hypersensitivity in the Guinea Pig Airways
    Article Snippet: Paragraph title: Single-cell RT-PCR ... The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2, and 10× PCR buffer (Qiagen, Valencia, CA, USA).

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: Paragraph title: Single-cell RT-PCR. ... The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume).

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: Paragraph title: Semi-quantitative and single-cell RT-PCR. ... The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume).

    Gel Extraction:

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Amplicons were visualized on ethidium bromide stained agarose gels and products of the expected size were excised and purified by a spin column procedure (Qiagen Gel-Extraction kit, Qiagen, Germany).

    Nested PCR:

    Article Title: Reverse Line Blot Hybridization Assay for Identification of Medically Important Fungi from Culture and Clinical Specimens ▿
    Article Snippet: Paragraph title: Multiplex PCR and nested PCR. (i) Fungal isolates. ... PCRs were performed in 25-μl reaction mixtures containing 0.5 U HotStar Taq polymerase and 1× PCR buffer (catalogue no. 203203; QIAGEN, Doncaster, Victoria, Australia), 125 μM of each dATP, dCTP, dGTP, and dTTP (Roche Diagnostics), 0.5 μM of each forward and reverse primer, and 5 μl of DNA template.

    Multiplex Assay:

    Article Title: Reverse Line Blot Hybridization Assay for Identification of Medically Important Fungi from Culture and Clinical Specimens ▿
    Article Snippet: Paragraph title: Multiplex PCR and nested PCR. (i) Fungal isolates. ... PCRs were performed in 25-μl reaction mixtures containing 0.5 U HotStar Taq polymerase and 1× PCR buffer (catalogue no. 203203; QIAGEN, Doncaster, Victoria, Australia), 125 μM of each dATP, dCTP, dGTP, and dTTP (Roche Diagnostics), 0.5 μM of each forward and reverse primer, and 5 μl of DNA template.

    Agarose Gel Electrophoresis:

    Article Title: Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago
    Article Snippet: PCR conditions for all amplification reactions were performed in 25 μ L volumes with HotStar Taq Polymerase and HotStar Master Mix buffers (Qiagen Inc., Valencia, CA). .. Subsequently, the amplicons were subjected to agarose gel electrophoresis (1%) in order to determine their sizes.

    Spectrophotometry:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: The DNA concentration and quality were measured using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Houston, TX). .. Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    DNA Methylation Assay:

    Article Title: Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis
    Article Snippet: Bisulfite modification of genomic DNA was performed using the EZ DNA Methylation Kit (Zymo Research) according to the manufacturer’s protocol. .. Bisulfite-treated genomic DNA was amplified in a 384-well plate using HotStar Taq Polymerase in a 5-μl reaction volume (Qiagen).

    Activation Assay:

    Article Title: TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors
    Article Snippet: The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2 , and 10× PCR buffer (Qiagen). .. The PCR reaction conditions were on a 50-cycle basis with initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min followed by a final extension at 72°C for 10 min. Control experiments testing the amplification of the “no RT” for each individual neuron and bath control by using either one or multiple primer pairs did not produce a specific product.

    Article Title: Parainfluenza 3-Induced Cough Hypersensitivity in the Guinea Pig Airways
    Article Snippet: The PCR reaction mixture contained 0.5 U of HotStar Taq Polymerase, 2.5 mM MgCl2, and 10× PCR buffer (Qiagen, Valencia, CA, USA). .. The PCR reaction conditions were on a 50-cycle basis with initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min followed by a final extension at 72°C for 10 min. Products were visualized in ethidium bromide-stained 1.5% agarose gels with a 50- or 100-bp DNA ladder.

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 10 minutes.

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. The PCR reaction conditions were 50 cycles of initial activation at 95°C for 15 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min. As a positive control, RNA was isolated from whole DRG, spinal cord, or gall bladder and was reverse transcribed using Omniscript RT Kit (Qiagen).

    Marker:

    Article Title: Sex- and species-biased gene flow in a spotted eagle hybrid zone
    Article Snippet: Paragraph title: Marker development ... Amplification was performed in 25 μl containing 25-50 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1 × Amplitaq Gold PCR buffer (Applied Biosystems) or Hotstar Taq polymerase with 1 × buffer (Qiagen), 2.5 mM MgCl2, 0.5 μM of each primer and 0.2 mM dNTP.

    Staining:

    Article Title: SYBR Green based real-time RT-PCR assay for detection and genotype prediction of bovine noroviruses and assessment of clinical significance in Norway.
    Article Snippet: Additionally, a 516 bp region was amplified with the BoNV72F and Capsid516R (5 -ATYADYACATGRGGRAACTG-3 ) primers. cDNA prepared for the real-time RT-PCR assay was used as template and the PCR was performed using the Qiagen HotStar Taq polymerase (Qiagen, Hilden, Germany) as described below. .. Amplicons were visualized on ethidium bromide stained agarose gels and products of the expected size were excised and purified by a spin column procedure (Qiagen Gel-Extraction kit, Qiagen, Germany).

    Article Title: The TGR5 receptor mediates bile acid-induced itch and analgesia
    Article Snippet: The PCR reaction contained primers, 0.5 U HotStar Taq Polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. Products were separated by electrophoresis (2% agarose), stained using ethidium bromide, and sequenced to confirm identity.

    Article Title: Feeding-dependent activation of enteric cells and sensory neurons by lymphatic fluid: evidence for a neurolymphocrine system
    Article Snippet: The PCR reaction contained primers, 0.5 units of HotStar Taq polymerase, 2.5 mM MgCl2 , 10 mM dNTP, and 10× PCR buffer (Qiagen) (20 μl final volume). .. Products were separated by electrophoresis (2% agarose), stained using ethidium bromide, and sequenced to confirm identity.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen hotstart taq dna polymerase
    Effect of individual constituents of the PCR on background fluorescence in the presence or absence of CABS. Each column represents the result of three PCRs performed: 1, in the absence of <t>Taq</t> Gold polymerase, but in the presence of oligonucleotides and template; 2, in the absence of Taq Gold polymerase and template, but in the presence of oligonucleotides; 3, in the absence of Taq Gold polymerase, template, and one oligonucleotide but in the presence of one oligonucleotide; 4, in the absence of primers and template, but in the presence of Taq Gold polymerase; 5, in the absence of template, but in the presence of both primers and polymerase; 6, as in case 3, except in the presence of the alternative primer of the primer combination; 7, in which specific amplicon is produced; and 8, in which no amplicon is expected. Conditions 1, 2, and 6 show the effect of CABS in reducing the background fluorescence caused by the single-strand oligonucleotides. The reaction with CABS in conditions 5 and 8 shows the residual effect caused by primer/dimers, in the case of 8 with additional template <t>DNA.</t>
    Hotstart Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstart taq dna polymerase/product/Qiagen
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    hotstart taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Qiagen hotstar taq dna polymerase
    Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget <t>DNA</t> reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. <t>HotStar</t> <t>Taq</t> DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.
    Hotstar Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 408 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar taq dna polymerase/product/Qiagen
    Average 99 stars, based on 408 article reviews
    Price from $9.99 to $1999.99
    hotstar taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Effect of individual constituents of the PCR on background fluorescence in the presence or absence of CABS. Each column represents the result of three PCRs performed: 1, in the absence of Taq Gold polymerase, but in the presence of oligonucleotides and template; 2, in the absence of Taq Gold polymerase and template, but in the presence of oligonucleotides; 3, in the absence of Taq Gold polymerase, template, and one oligonucleotide but in the presence of one oligonucleotide; 4, in the absence of primers and template, but in the presence of Taq Gold polymerase; 5, in the absence of template, but in the presence of both primers and polymerase; 6, as in case 3, except in the presence of the alternative primer of the primer combination; 7, in which specific amplicon is produced; and 8, in which no amplicon is expected. Conditions 1, 2, and 6 show the effect of CABS in reducing the background fluorescence caused by the single-strand oligonucleotides. The reaction with CABS in conditions 5 and 8 shows the residual effect caused by primer/dimers, in the case of 8 with additional template DNA.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Alkaline-mediated differential interaction (AMDI): A simple automatable single-nucleotide polymorphism assay

    doi: 10.1073/pnas.041619998

    Figure Lengend Snippet: Effect of individual constituents of the PCR on background fluorescence in the presence or absence of CABS. Each column represents the result of three PCRs performed: 1, in the absence of Taq Gold polymerase, but in the presence of oligonucleotides and template; 2, in the absence of Taq Gold polymerase and template, but in the presence of oligonucleotides; 3, in the absence of Taq Gold polymerase, template, and one oligonucleotide but in the presence of one oligonucleotide; 4, in the absence of primers and template, but in the presence of Taq Gold polymerase; 5, in the absence of template, but in the presence of both primers and polymerase; 6, as in case 3, except in the presence of the alternative primer of the primer combination; 7, in which specific amplicon is produced; and 8, in which no amplicon is expected. Conditions 1, 2, and 6 show the effect of CABS in reducing the background fluorescence caused by the single-strand oligonucleotides. The reaction with CABS in conditions 5 and 8 shows the residual effect caused by primer/dimers, in the case of 8 with additional template DNA.

    Article Snippet: The reaction mixture consisted of 67 mM Tris⋅HCl (pH 8.4) at 25°C, 16.6 mM ammonium sulfate, 2 mM magnesium chloride, 0.01% (vol/vol) Tween 20, 200 μM of each dNTP, 1 μM of each primer, and 0.5 units Hotstart Taq DNA polymerase (Qiagen) or AmpliTaq Gold (Perkin–Elmer).

    Techniques: Polymerase Chain Reaction, Fluorescence, Amplification, Produced

    Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Journal: BMC Genomics

    Article Title: Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction

    doi: 10.1186/1471-2164-9-584

    Figure Lengend Snippet: Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Article Snippet: The results showed a tendency that positive signals were improved and background signals were decreased compared to the use of HotStar Taq DNA polymerase, although statistical evidence is lacking (results not shown).

    Techniques: Negative Control

    TALEN-induced mutations in the Platynereis estrogen receptor . (A) Schematic of the er locus showing target exons 2 and 3 with TALEN target sites (yellow). Blue arrows, primer positions; red double-ended arrow, region of sequence deleted in E; green, DNA-binding domain. Primer combinations used for screening are shown above in B–E. (B–E) PCR, undigested PCR product; NI, non-injected. (B) Restriction digest screening of larvae injected with er Ex3_L2/R2 TALENs (mRNA concentration: 267 ng/µl/TALEN mRNA). Arrowhead indicates uncut PCR product following AflI II digestion (asterisk). (C) Mutation evidence at exon 2 site: uncut band adult worm +3 vs. fully digested product from mutation-negative (−) TALEN-injected worm. (D) Adult worms er+31 and er+37 with mutations at exon 3 site. (E) Deletions (red arrow) detected in larvae and adult worms resulting from simultaneous cleavage at exons 2 and 3 using 300 ng/µl/TALEN mRNA: deletion positive (+); deletion negative (−). Please note different primer pairs used for larval vs. adult samples. (F) Mutant sequences obtained from digest screening for exons 1, 2, and long deletions. Numbers in brackets indicate the sample or worm from which the sequence was obtained; all other sequences are from injected larvae shown in B. Length of mutations are indicated by ∆ with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Journal: Genetics

    Article Title: TALENs Mediate Efficient and Heritable Mutation of Endogenous Genes in the Marine Annelid Platynereis dumerilii

    doi: 10.1534/genetics.113.161091

    Figure Lengend Snippet: TALEN-induced mutations in the Platynereis estrogen receptor . (A) Schematic of the er locus showing target exons 2 and 3 with TALEN target sites (yellow). Blue arrows, primer positions; red double-ended arrow, region of sequence deleted in E; green, DNA-binding domain. Primer combinations used for screening are shown above in B–E. (B–E) PCR, undigested PCR product; NI, non-injected. (B) Restriction digest screening of larvae injected with er Ex3_L2/R2 TALENs (mRNA concentration: 267 ng/µl/TALEN mRNA). Arrowhead indicates uncut PCR product following AflI II digestion (asterisk). (C) Mutation evidence at exon 2 site: uncut band adult worm +3 vs. fully digested product from mutation-negative (−) TALEN-injected worm. (D) Adult worms er+31 and er+37 with mutations at exon 3 site. (E) Deletions (red arrow) detected in larvae and adult worms resulting from simultaneous cleavage at exons 2 and 3 using 300 ng/µl/TALEN mRNA: deletion positive (+); deletion negative (−). Please note different primer pairs used for larval vs. adult samples. (F) Mutant sequences obtained from digest screening for exons 1, 2, and long deletions. Numbers in brackets indicate the sample or worm from which the sequence was obtained; all other sequences are from injected larvae shown in B. Length of mutations are indicated by ∆ with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Article Snippet: PCR and restriction digest screening assays PCR reaction mixes contained DNA polymerase [either HotStar Taq Plus (Qiagen) or Phusion Polymerase (Fermentas)], 1.5–3 mM MgCl2 , 400 μM dNTPs, 200 μM of each primer, 1× reaction buffer (according to the enzyme used), 1–2 µl of DNA template in final volume of 25 or 50 µl.

    Techniques: Sequencing, Binding Assay, Polymerase Chain Reaction, Injection, TALENs, Concentration Assay, Mutagenesis