hot start taq polymerase  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    TaKaRa hot start taq polymerase
    Hot Start Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start taq polymerase/product/TaKaRa
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    hot start taq polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    hot start taq polymerase Qiagen
    hot start taq polymerase Takara
    pcr buffer Qiagen
    pcr buffer Takara
    hot start taq polymerase Roche
    hot start taq polymerase Thermo Fisher
    mgcl2 Promega
    mgcl2 Qiagen
    du plus deoxynucleotide triphosphates Takara
    dntps Thermo Fisher
    uracil dna glycosylase Takara
    dntp mixture Takara
    microseal Bio Rad
    abi prism bigdye terminator cycle sequencing ready reaction kit Perkinelmer
    evagreen Biotium

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: Paragraph title: Bisulfite sequencing ... Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: Paragraph title: Bisulfite Sequencing ... Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III.

    Clone Assay:

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Centrifugation:

    Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells
    Article Snippet: Beads were collected by brief centrifugation, and the immunocomplexes were eluted by freshly prepared elution buffer (100 mM NaHCO3 , 1% SDS). .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Hot-Start Taq DNA polymerase (Takara, Dalian, China) (32 cycles).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III.

    Amplification:

    Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma
    Article Snippet: PCR and pyrosequencing for LINE-1 were performed as previously reported using TaKaRa Taq™ Hot Start Version (Takara, Japan). .. A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Hot Start Taq polymerase, and 2 µl of bisulfited template DNA. .. PCR conditions were as follows: initial denaturing at 95 °C for 3 min; 45 cycles of 95 °C for 15 s, 50 °C for 20 s, and 72 °C for 30 s; and a final extension at 72 °C for 5 min.

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma
    Article Snippet: Genomic DNA was bisulfited-modified with a Zymo DNA Modification Kit (Zymo Research, Orange, CA, USA) following the manufacturer’s instructions. .. The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of hot start Taq-polymerase (Takara) per reaction. .. Methylation-primers were as follows: GPX3-MF: CGTTCGTTTTTGAAATTTTAGTC, and GPX3-MR: CTACCTAATCCCTAACCACCGT.

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. Cycling conditions consisted of an initial denaturation step at 95°C for 5 min, followed by 38 cycles of 30 sec at 95°C, 30 sec at the relevant annealing temperature ( ) and 45 sec at 72°C.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA). .. Followed by analyses of PCR products on 2% agarose gel and gel purification (Qiagen, Cat no 28604, USA).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Pentraxin 3 (PTX3) promoter methylation associated with PTX3 plasma levels and neutrophil to lymphocyte ratio in coronary artery disease
    Article Snippet: Plasma was separated within 2 h of blood collection and kept at −80 °C until it was used further for analysis. .. 2.4 DNA was amplified using a methylation-specific primer set, PTX3-MF: 5′-CGTTTGCGGTTAGGAGTATTC-3′ and PTX3-MR: 5′-CAAAACGTCGTCCGTAACTTA-3′, or a non-methylation-specific primer set, PTX3-UF: 5′-TGTGT TTGTGGTTAGGAGTATTTG-3′ and PTX3-UR: 5′-CAA AACATCATCCATAACTTA-3′, in a total volume of 20 µL, using 0.5 units of hot-start Taq-polymerase (Takara, Japan) per reaction. .. The size of the non-methylated amplicon was 105 bp, and the methylated amplicon was 103 bp.

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). .. PCR was performed in 96-well plates with 2 l 10 × Taq Buffer, 10 mM deoxy-ribonucleoside triphosphate, 25 mM MgCL2 , primers at a final concentration of 0.2 µm and a cDNA sample derived from 5 ng total RNA in a total volume of 20 µl.

    Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics
    Article Snippet: PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA. .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    DNA Synthesis:

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Standard complentary DNA synthesis by reverse transcription of the RNA was then performed using random primers and SuperScript™ III RNase H-Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). .. Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan).

    Positive Control:

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. To avoid the occurrance of false positive and false negative results in the reactions, each set of PCR contained positive and negative controls.

    Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation
    Article Snippet: The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of hot-start Taq polymerase (Takara, Shiga, Japan) and the respective buffers. .. To prepare the positive methylation control, 1 μg of genomic DNA from normal human liver was treated in vitro with SssI methyltransferase (NEB, Beverly, MA), yielding completely methylated DNA at all CpG rich regions.

    Polymerase Chain Reaction:

    Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma
    Article Snippet: PCR and pyrosequencing for LINE-1 were performed as previously reported using TaKaRa Taq™ Hot Start Version (Takara, Japan). .. A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Hot Start Taq polymerase, and 2 µl of bisulfited template DNA. .. PCR conditions were as follows: initial denaturing at 95 °C for 3 min; 45 cycles of 95 °C for 15 s, 50 °C for 20 s, and 72 °C for 30 s; and a final extension at 72 °C for 5 min.

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: To detect exon 18 mutations (G719X), and exon 21 mutations (L858R and L861Q), the Cycleave method was used based on the basic principle of realtime polymerase chain reaction. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume. .. The PCR conditions consisted of initial denaturation at 95 °C for 3 min; 50 cycles of 95 °C for 15 s, annealing at 56 °C for 30 s and 72 °C for 30 s; and final extension at 72 °C for 5 min.

    Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma
    Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of hot start Taq-polymerase (Takara) per reaction.

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA. .. After PCR amplification, 3 µL of amplified products were digested with three units of restriction enzyme.

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. Cycling conditions consisted of an initial denaturation step at 95°C for 5 min, followed by 38 cycles of 30 sec at 95°C, 30 sec at the relevant annealing temperature ( ) and 45 sec at 72°C.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA). .. Followed by analyses of PCR products on 2% agarose gel and gel purification (Qiagen, Cat no 28604, USA).

    Article Title: From Pig Breeding Environment to Subsequently Produced Pork: Comparative Analysis of Antibiotic Resistance Genes and Bacterial Community Composition
    Article Snippet: Paragraph title: PCR Detection of ARGs ... The PCRs were performed in a total volume of 25 μL including 1 μL of extracted DNA, 2.5 μL of Taq reaction buffer, 0.2 mM dNTPs, 0.2 μM primers, and 0.625 units of Hot Start Taq DNA polymerase (Takara, Shiga, Japan).

    Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells
    Article Snippet: Chromatin was then de-crosslinked for 5 h at 65°C. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Hot-Start Taq DNA polymerase (Takara, Dalian, China) (32 cycles). .. The primers used were as follows: sense TTGAGACCAGCCTGACCAAC, antisense GTGCCCCAAATATGCCATAT (product length 297 bp).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: Two multiplex PCR reactions were designed. .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The second PCR reaction in 20 µl volume contained 1x GC Buffer I, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 2 and about 20 ng of genomic DNA.

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The second PCR reaction in 20 µl volume contained 1x GC Buffer I, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 2 and about 20 ng of genomic DNA. .. The PCR program for both reactions was as follows: 95°C 2 min; 11 cycles x (94°C 20 s, 65°C -0.5°C/cycle 40 s, 72°C 1 min 30 s); 24 cycles x (94°C 20 s, 59°C 30 s, 72°C 1 min 30 s); 72°C 2 min; hold at 4°C.

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). .. Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan).

    Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics
    Article Snippet: Paragraph title: PCR‐based metabarcoding ... PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA.

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: DNA was precipitated with ethanol and washed with 75% ethanol three times before being resuspended in H2 O. .. The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′). .. Purified PCR products were used to generate cRNA probes with a T7 RNA polymerase kit (MEGAscript, Ambion).

    Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation
    Article Snippet: The MSP primer sequences of each gene for the unmethylated and methylated reactions were determined as described previously [ , - ]. .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of hot-start Taq polymerase (Takara, Shiga, Japan) and the respective buffers. .. Hot start polymerase chain reaction was performed at 95°C hot start for 10 minutes followed by 30 repetitive cycles consisting of denaturation at 95°C for 30 seconds, annealing at specific temperature for 30 seconds, and extension at 72°C for 30 seconds, then finished with a final 10-minute extension.

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: The primers were designed by online Primer3 and their specificity was tested by BLAST [ ]. .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water. .. The PCR mixture was preheated for 5 min at 95°C and then incubated for 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, followed by 72°C for 5 min.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Electrophoresis:

    Article Title: From Pig Breeding Environment to Subsequently Produced Pork: Comparative Analysis of Antibiotic Resistance Genes and Bacterial Community Composition
    Article Snippet: The PCRs were performed in a total volume of 25 μL including 1 μL of extracted DNA, 2.5 μL of Taq reaction buffer, 0.2 mM dNTPs, 0.2 μM primers, and 0.625 units of Hot Start Taq DNA polymerase (Takara, Shiga, Japan). .. The PCRs were performed in a total volume of 25 μL including 1 μL of extracted DNA, 2.5 μL of Taq reaction buffer, 0.2 mM dNTPs, 0.2 μM primers, and 0.625 units of Hot Start Taq DNA polymerase (Takara, Shiga, Japan).

    Microarray:

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′). .. After purification with Ambion Megaclear kits, the cRNA was further labeled with a ULS labeling kit (Kreatech: start sample cy3; end sample, cy5).

    Incubation:

    Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells
    Article Snippet: Immunocomplexes were mixed with 60 μl of 50% protein G agarose suspension, followed by incubation for 1 h at 4°C with rotation. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Hot-Start Taq DNA polymerase (Takara, Dalian, China) (32 cycles).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction.

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). .. PCR was performed in 96-well plates with 2 l 10 × Taq Buffer, 10 mM deoxy-ribonucleoside triphosphate, 25 mM MgCL2 , primers at a final concentration of 0.2 µm and a cDNA sample derived from 5 ng total RNA in a total volume of 20 µl.

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: The sample was then digested with 25 µg/mL RNase A for overnight incubation at 37°C and extracted with phaselock tubes again as described above. .. The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′).

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: Also, from FFPE tissues, DNA was extracted using the recover all total nucleic acid isolation kit (Ambion, USA). .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    In Silico:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: An in silico analysis using the UCSC Genome Bioinformatics Site ( http://genome.ucsc.edu ) was performed to identify the CpG sites associated with the proximal promoter for each gene. .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA.

    Expressing:

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: DNA was precipitated with ethanol and washed with 75% ethanol three times before being resuspended in H2 O. .. The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′). .. Purified PCR products were used to generate cRNA probes with a T7 RNA polymerase kit (MEGAscript, Ambion).

    Modification:

    Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma
    Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of hot start Taq-polymerase (Takara) per reaction.

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA.

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. Cycling conditions consisted of an initial denaturation step at 95°C for 5 min, followed by 38 cycles of 30 sec at 95°C, 30 sec at the relevant annealing temperature ( ) and 45 sec at 72°C.

    Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics
    Article Snippet: The forward primer was LepF (5′ ATTCAACCAATCATAAAGATATTGG 3′), and the reverse primer (mlCOIintBeeR, 5′ GGDGGRTAWANDGTTCANCCHGTHCC 3′) was modified from mlCOIintR (Leray et al .), based on 160 bee COI reference sequences downloaded from GenBank. .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA.

    Gas Chromatography:

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The second PCR reaction in 20 µl volume contained 1x GC Buffer I, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 2 and about 20 ng of genomic DNA. .. The PCR program for both reactions was as follows: 95°C 2 min; 11 cycles x (94°C 20 s, 65°C -0.5°C/cycle 40 s, 72°C 1 min 30 s); 24 cycles x (94°C 20 s, 59°C 30 s, 72°C 1 min 30 s); 72°C 2 min; hold at 4°C.

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: The primers were designed by online Primer3 and their specificity was tested by BLAST [ ]. .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water. .. The PCR mixture was preheated for 5 min at 95°C and then incubated for 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, followed by 72°C for 5 min.

    Ligation:

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The two PCR products were equally mixed and purified by 1 U of shrimp alkaline phosphatase’s digestion at 37°C for 1 hr and at 75°C for 15 min.

    Sequencing:

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA). .. Followed by analyses of PCR products on 2% agarose gel and gel purification (Qiagen, Cat no 28604, USA).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The selected 5 SNPs were genotyped with the method of polymerase chain reaction (PCR)-ligase detection reaction (LDR) on an ABI Prism 377 Sequence Detection System (Applied Biosystems, Foster City, CA, USA), as previously reported [ , ] with technical supports from the Shanghai Genesky Biotechnology Company (Shanghai, China). .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA.

    Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics
    Article Snippet: To build Illumina‐ready PCR amplicons, we attached the standard Illumina HP10 or HP11 sequencing primers, an 8‐bp index sequence, a 0‐ to 5‐bp ‘heterogeneity spacer’ to the 5′ end of LepF, and mlCOIintBeeR (Fig. S3), following Fadrosh et al . ( ). .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA.

    Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation
    Article Snippet: Two sets of primers were used to amplify each region of interest: one pair recognized a sequence in which CpG sites were unmethylated (bisulfite-modified to UpG), and the other recognized a sequence in which CpG sites were methylated (unmodified by bisulfite treatment). .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of hot-start Taq polymerase (Takara, Shiga, Japan) and the respective buffers.

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: Paragraph title: Sequencing analysis ... PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    DNA Extraction:

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: Paragraph title: DNA isolation, bisulfite conversion and bisulfite specific PCR ... Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    Combined Bisulfite Restriction Analysis Assay:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA. .. After PCR amplification, 3 µL of amplified products were digested with three units of restriction enzyme.

    Methylation:

    Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma
    Article Snippet: Paragraph title: Measurement of LINE-1 methylation by pyrosequencing ... A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Hot Start Taq polymerase, and 2 µl of bisulfited template DNA.

    Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma
    Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of hot start Taq-polymerase (Takara) per reaction.

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: COBRA was used to assess the methylation status of the specific CpG sites located in the promoter regions of somatostatin (SST ) and insulin (INS ). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA.

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Paragraph title: Primer design and methylation detection ... Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: Briefly, pooled samples were digested with Proteinase K (PK) and treated with sodium bisulfite to convert all unmethylated cytosine to uracil using an EZ DNA Methylation-Direct Kit (Zymo Research). .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction.

    Article Title: Pentraxin 3 (PTX3) promoter methylation associated with PTX3 plasma levels and neutrophil to lymphocyte ratio in coronary artery disease
    Article Snippet: Plasma was separated within 2 h of blood collection and kept at −80 °C until it was used further for analysis. .. 2.4 DNA was amplified using a methylation-specific primer set, PTX3-MF: 5′-CGTTTGCGGTTAGGAGTATTC-3′ and PTX3-MR: 5′-CAAAACGTCGTCCGTAACTTA-3′, or a non-methylation-specific primer set, PTX3-UF: 5′-TGTGT TTGTGGTTAGGAGTATTTG-3′ and PTX3-UR: 5′-CAA AACATCATCCATAACTTA-3′, in a total volume of 20 µL, using 0.5 units of hot-start Taq-polymerase (Takara, Japan) per reaction. .. The size of the non-methylated amplicon was 105 bp, and the methylated amplicon was 103 bp.

    Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation
    Article Snippet: Paragraph title: Methylation-specific polymerase chain reaction (MSP) ... The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of hot-start Taq polymerase (Takara, Shiga, Japan) and the respective buffers.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: Briefly, pooled samples were digested with Proteinase K (PK) and treated with sodium bisulfite to convert all unmethylated cytosine to uracil using an EZ DNA Methylation-Direct Kit (Zymo Research). .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III.

    Mutagenesis:

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Paragraph title: EGFR Mutation Analysis ... Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water. .. The PCR products were purified and sequenced by a commercial sequencing company (Jie Li Biology, Shanghai, China).

    Isolation:

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: A total of 500 ng of isolated DNA was bisulfite-converted using Zymo EZ DNA methylation kit (cat no D5005, USA). .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: Genomic DNA was isolated from peripheral blood using QIAamp DNA Blood Mini Kit (QIAGEN, Valencia, CA, USA). .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water.

    Size-exclusion Chromatography:

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). .. PCR was performed in 96-well plates with 2 l 10 × Taq Buffer, 10 mM deoxy-ribonucleoside triphosphate, 25 mM MgCL2 , primers at a final concentration of 0.2 µm and a cDNA sample derived from 5 ng total RNA in a total volume of 20 µl.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Labeling:

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The two PCR products were equally mixed and purified by 1 U of shrimp alkaline phosphatase’s digestion at 37°C for 1 hr and at 75°C for 15 min.

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′). .. The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′).

    Purification:

    Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma
    Article Snippet: A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Hot Start Taq polymerase, and 2 µl of bisulfited template DNA. .. The primers used in the amplification were as follows: LINE-1, (forward) 5'-TTTTTTGAGTTAGGTGTGGGATA-3' and (reverse) 5'-AAAAATCAAAAAATTCCCTTTCC-3'.

    Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer
    Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume.

    Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells
    Article Snippet: Chromatin was then de-crosslinked for 5 h at 65°C. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Hot-Start Taq DNA polymerase (Takara, Dalian, China) (32 cycles). .. The primers used were as follows: sense TTGAGACCAGCCTGACCAAC, antisense GTGCCCCAAATATGCCATAT (product length 297 bp).

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction.

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The PCR program for both reactions was as follows: 95°C 2 min; 11 cycles x (94°C 20 s, 65°C -0.5°C/cycle 40 s, 72°C 1 min 30 s); 24 cycles x (94°C 20 s, 59°C 30 s, 72°C 1 min 30 s); 72°C 2 min; hold at 4°C.

    Article Title: The Regulatory Effects of Lateral Hypothalamus Area GABAB Receptor on Gastric Ischemia-Reperfusion Injury in Rats
    Article Snippet: Purification and reverse transcription RNA was performed as described above. .. Real time PCR was performed in a total volume of 50 μL with 1 μL reverse transcribed cDNA, 3 μL of each primer in hot start buffer, 0.5 μL hot start Taq DNA polymerase (Takara technology), 5 μL 10×LA TaqBuffer (Mg2+ Plus), and 8 μL dNTP Mixture.

    Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling
    Article Snippet: The DNA was PCR-amplified with Takara hot start Taq polymerase (RR006B) with primers flanking the ORF expression cassette (primer 1, 5′-GATCCCTACCGGTGATATCC-3′; primer 2, 5′-TAATACGACTCACTATAGGGAGAGGCCCTCTAGTCGACCTAGC-3′). .. Purified PCR products were used to generate cRNA probes with a T7 RNA polymerase kit (MEGAscript, Ambion).

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water. .. The PCR mixture was preheated for 5 min at 95°C and then incubated for 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, followed by 72°C for 5 min.

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos
    Article Snippet: Standard complentary DNA synthesis by reverse transcription of the RNA was then performed using random primers and SuperScript™ III RNase H-Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). .. Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using hot start Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). .. PCR was performed in 96-well plates with 2 l 10 × Taq Buffer, 10 mM deoxy-ribonucleoside triphosphate, 25 mM MgCL2 , primers at a final concentration of 0.2 µm and a cDNA sample derived from 5 ng total RNA in a total volume of 20 µl.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA. .. After PCR amplification, 3 µL of amplified products were digested with three units of restriction enzyme.

    Nested PCR:

    Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94 °C for 5 min, 45 cycles of 94 °C for 30 sec, the optimal primer annealing temperature for 30 sec and 72 °C for 1 min, followed by 72 °C for 10 min. Products from the first amplification reaction were used in the second PCR reaction. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos
    Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Hot Start Taq Polymerase (TaKaRa) with a profile of 94°C for 5 min, 45 cycles of 94°C for 30 sec, the optimal annealing temperature (53°C for Oct4 Region I, 54°C for Oct4 Region II, 50°C for Thy1 Regions I and II, and 53°C for Thy1 Region III, respectively) for 30 sec and 72°C for 1 min, followed by 72°C for 10 min. Products from the first amplification reaction were used in the second PCR reaction, and the optimal annealing temperatures of inner primers were 50°C for Oct4 Regions I and II, 51°C for Thy1 Regions I and II and 52°C for Thy1 Region III. .. Then, the amplified products were verified by electrophoresis and purified using an Agarose Gel DNA Purification Kit (TaKaRa).

    Chromatin Immunoprecipitation:

    Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells
    Article Snippet: Paragraph title: Chromatin immunoprecipitation (ChIP) ... After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Hot-Start Taq DNA polymerase (Takara, Dalian, China) (32 cycles).

    Software:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA. .. Finally, the restriction products were separated by 10% PAGE and visualized by ethidium bromide staining.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA). .. Followed by analyses of PCR products on 2% agarose gel and gel purification (Qiagen, Cat no 28604, USA).

    Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot
    Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Hot Start DNA Taq polymerase (TaKaRa), and 1.5 μl of double-distilled water. .. The PCR products were purified and sequenced by a commercial sequencing company (Jie Li Biology, Shanghai, China).

    Real-time Polymerase Chain Reaction:

    Article Title: The Regulatory Effects of Lateral Hypothalamus Area GABAB Receptor on Gastric Ischemia-Reperfusion Injury in Rats
    Article Snippet: Purification and reverse transcription RNA was performed as described above. .. Real time PCR was performed in a total volume of 50 μL with 1 μL reverse transcribed cDNA, 3 μL of each primer in hot start buffer, 0.5 μL hot start Taq DNA polymerase (Takara technology), 5 μL 10×LA TaqBuffer (Mg2+ Plus), and 8 μL dNTP Mixture. .. The sequences of GABAB R and β-Actin primers used and the amplification sizes are as follows, GABAB R forward: GGAAGGTGGCATCAGGTA, reverse: CATAGTCCAC AGGCAGGAA, 115 bp; β-Actin forward: GTACCCCATTGAAC ACGG, reverse: TGTGGTGCCAAATCTTCTC, 80 bp.

    Multiplex Assay:

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: Two multiplex PCR reactions were designed. .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA.

    Agarose Gel Electrophoresis:

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates.

    In Vitro:

    Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer
    Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U hot-start Taq polymerase (Takara, Japan), 10X PCR buffer (Mg2+ plus), 2.5 mM of each dNTP, 20 pmol of each primer and 80 ng of bisulfite-modified genomic DNA as templates. .. To avoid the occurrance of false positive and false negative results in the reactions, each set of PCR contained positive and negative controls.

    Spectrophotometry:

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: DNA samples were air dried and quantified using an ND1000 spectrophotometer (Thermo Scientific) and stored at −20ºC. .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    DNA Methylation Assay:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Paragraph title: DNA methylation analysis ... Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA.

    Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy
    Article Snippet: A total of 500 ng of isolated DNA was bisulfite-converted using Zymo EZ DNA methylation kit (cat no D5005, USA). .. Bisulfite-modified DNA was amplified by PCR using hot start taq DNA polymerase (epitaq, Takara, USA).

    Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation
    Article Snippet: DNA methylation of CpG islands was then determined by PCR using specific primers for either methylated or unmethylated DNA. .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of hot-start Taq polymerase (Takara, Shiga, Japan) and the respective buffers.

    DNA Purification:

    Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population
    Article Snippet: According to the manufacturer’s instructions, DNA was extracted from peripheral blood leukocytes using Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, USA). .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA.

    Staining:

    Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells
    Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Hot Start Taq polymerase (Takara), 10 pmol of primers, and 1 µL of bisulfite-treated DNA. .. After PCR amplification, 3 µL of amplified products were digested with three units of restriction enzyme.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • ex taq dna polymerase hot start version  (TaKaRa)
    94
    TaKaRa ex taq dna polymerase hot start version
    Sequencing electropherogram of (CA)7 . PCR of the mtDNA D-loop (CA)7 was performed using EX <t>Taq</t> <t>DNA</t> polymerase and F7/R5 primer pairs (A) or F5/R5 primer pairs (B). The sequencing electropherogram using the F5 primer is the same as (data not shown). (C) PCR was performed using a different proofreading DNA polymerase KOD and F7/R5 primer pairs. (D) PCR of genomic (CA)7 of the NAALAD2 gene was performed using EX Taq DNA polymerase. An arrow indicates a representative position used to evaluate a variant allele. PCR, polymerase chain reaction; mtDNA, mitochondrial DNA; NB, normal breast epithelia; NLN, normal lymph node; BC, breast cancer; NL16, normal liver; F, forward; R, reverse. NL16 is a different patient with a (CA)4 repeat.
    Ex Taq Dna Polymerase Hot Start Version, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq dna polymerase hot start version/product/TaKaRa
    Average 94 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    ex taq dna polymerase hot start version - by Bioz Stars, 2019-12
    94/100 stars
    		  Buy from Supplier
    hot start taq dna polymerase mix  (TaKaRa)
    83
    TaKaRa hot start taq dna polymerase mix
    Sequencing electropherogram of (CA)7 . PCR of the mtDNA D-loop (CA)7 was performed using EX <t>Taq</t> <t>DNA</t> polymerase and F7/R5 primer pairs (A) or F5/R5 primer pairs (B). The sequencing electropherogram using the F5 primer is the same as (data not shown). (C) PCR was performed using a different proofreading DNA polymerase KOD and F7/R5 primer pairs. (D) PCR of genomic (CA)7 of the NAALAD2 gene was performed using EX Taq DNA polymerase. An arrow indicates a representative position used to evaluate a variant allele. PCR, polymerase chain reaction; mtDNA, mitochondrial DNA; NB, normal breast epithelia; NLN, normal lymph node; BC, breast cancer; NL16, normal liver; F, forward; R, reverse. NL16 is a different patient with a (CA)4 repeat.
    Hot Start Taq Dna Polymerase Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start taq dna polymerase mix/product/TaKaRa
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot start taq dna polymerase mix - by Bioz Stars, 2019-12
    83/100 stars
    		  Buy from Supplier
    taq polymerase  (TaKaRa)
    75
    TaKaRa taq polymerase
    Sequencing electropherogram of (CA)7 . PCR of the mtDNA D-loop (CA)7 was performed using EX <t>Taq</t> <t>DNA</t> polymerase and F7/R5 primer pairs (A) or F5/R5 primer pairs (B). The sequencing electropherogram using the F5 primer is the same as (data not shown). (C) PCR was performed using a different proofreading DNA polymerase KOD and F7/R5 primer pairs. (D) PCR of genomic (CA)7 of the NAALAD2 gene was performed using EX Taq DNA polymerase. An arrow indicates a representative position used to evaluate a variant allele. PCR, polymerase chain reaction; mtDNA, mitochondrial DNA; NB, normal breast epithelia; NLN, normal lymph node; BC, breast cancer; NL16, normal liver; F, forward; R, reverse. NL16 is a different patient with a (CA)4 repeat.
    Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/TaKaRa
    Average 75 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-12
    75/100 stars
    		  Buy from Supplier

    Image Search Results


    Sequencing electropherogram of (CA)7 . PCR of the mtDNA D-loop (CA)7 was performed using EX Taq DNA polymerase and F7/R5 primer pairs (A) or F5/R5 primer pairs (B). The sequencing electropherogram using the F5 primer is the same as (data not shown). (C) PCR was performed using a different proofreading DNA polymerase KOD and F7/R5 primer pairs. (D) PCR of genomic (CA)7 of the NAALAD2 gene was performed using EX Taq DNA polymerase. An arrow indicates a representative position used to evaluate a variant allele. PCR, polymerase chain reaction; mtDNA, mitochondrial DNA; NB, normal breast epithelia; NLN, normal lymph node; BC, breast cancer; NL16, normal liver; F, forward; R, reverse. NL16 is a different patient with a (CA)4 repeat.

    Journal: Oncology Letters

    Article Title: Caution for simple sequence repeat number variation in the mitochondrial DNA D-loop to determine cancer-specific variants

    doi: 10.3892/ol.2018.9809

    Figure Lengend Snippet: Sequencing electropherogram of (CA)7 . PCR of the mtDNA D-loop (CA)7 was performed using EX Taq DNA polymerase and F7/R5 primer pairs (A) or F5/R5 primer pairs (B). The sequencing electropherogram using the F5 primer is the same as (data not shown). (C) PCR was performed using a different proofreading DNA polymerase KOD and F7/R5 primer pairs. (D) PCR of genomic (CA)7 of the NAALAD2 gene was performed using EX Taq DNA polymerase. An arrow indicates a representative position used to evaluate a variant allele. PCR, polymerase chain reaction; mtDNA, mitochondrial DNA; NB, normal breast epithelia; NLN, normal lymph node; BC, breast cancer; NL16, normal liver; F, forward; R, reverse. NL16 is a different patient with a (CA)4 repeat.

    Article Snippet: PCR was performed in 20-µl reactions using Takara EX Taq DNA polymerase Hot Start Version (Takara Bio Inc., Shiga, Japan) and KOD-Plus-Neo (Toyobo, Osaka, Japan) according to the manufacturer's instructions.

    Techniques: Sequencing, Polymerase Chain Reaction, Variant Assay