hot start taq polymerase (TaKaRa)
Structured Review
Hot Start Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hot start taq polymerase/product/TaKaRa
Average 99 stars, based on 30 article reviews
Price from $9.99 to $1999.99
Related Products / Commonly Used Together
Images
Related Articles
Methylation Sequencing:Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: Paragraph title: Bisulfite sequencing ... Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: Paragraph title: Bisulfite Sequencing ... Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Clone Assay:Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Centrifugation:Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells Article Snippet: Beads were collected by brief centrifugation, and the immunocomplexes were eluted by freshly prepared elution buffer (100 mM NaHCO3 , 1% SDS). .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Amplification:Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma Article Snippet: PCR and pyrosequencing for LINE-1 were performed as previously reported using TaKaRa Taq™ Hot Start Version (Takara, Japan). .. A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Hot-Start Taq DNA polymerase (Takara, Shiga Japan) in a 40 ml volume. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma Article Snippet: Genomic DNA was bisulfited-modified with a Zymo DNA Modification Kit (Zymo Research, Orange, CA, USA) following the manufacturer’s instructions. .. The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Pentraxin 3 (PTX3) promoter methylation associated with PTX3 plasma levels and neutrophil to lymphocyte ratio in coronary artery disease Article Snippet: Plasma was separated within 2 h of blood collection and kept at −80 °C until it was used further for analysis. .. 2.4 DNA was amplified using a methylation-specific primer set, PTX3-MF: 5′-CGTTTGCGGTTAGGAGTATTC-3′ and PTX3-MR: 5′-CAAAACGTCGTCCGTAACTTA-3′, or a non-methylation-specific primer set, PTX3-UF: 5′-TGTGT TTGTGGTTAGGAGTATTTG-3′ and PTX3-UR: 5′-CAA AACATCATCCATAACTTA-3′, in a total volume of 20 µL, using 0.5 units of Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics Article Snippet: PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Hot Start Taq DNA polymerase (TaKaRa Biosystems, Dalian, China) and approximately 60 ng of genomic DNA. .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and DNA Synthesis:Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Standard complentary DNA synthesis by reverse transcription of the RNA was then performed using random primers and SuperScript™ III RNase H-Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). .. Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Positive Control:Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation Article Snippet: The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of Polymerase Chain Reaction:Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma Article Snippet: PCR and pyrosequencing for LINE-1 were performed as previously reported using TaKaRa Taq™ Hot Start Version (Takara, Japan). .. A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: To detect exon 18 mutations (G719X), and exon 21 mutations (L858R and L861Q), the Cycleave method was used based on the basic principle of realtime polymerase chain reaction. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using Article Title: From Pig Breeding Environment to Subsequently Produced Pork: Comparative Analysis of Antibiotic Resistance Genes and Bacterial Community Composition Article Snippet: Paragraph title: PCR Detection of ARGs ... The PCRs were performed in a total volume of 25 μL including 1 μL of extracted DNA, 2.5 μL of Taq reaction buffer, 0.2 mM dNTPs, 0.2 μM primers, and 0.625 units of Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells Article Snippet: Chromatin was then de-crosslinked for 5 h at 65°C. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: Two multiplex PCR reactions were designed. .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The second PCR reaction in 20 µl volume contained 1x GC Buffer I, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics Article Snippet: Paragraph title: PCR‐based metabarcoding ... PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: DNA was precipitated with ethanol and washed with 75% ethanol three times before being resuspended in H2 O. .. The DNA was PCR-amplified with Takara Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation Article Snippet: The MSP primer sequences of each gene for the unmethylated and methylated reactions were determined as described previously [ , - ]. .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: The primers were designed by online Primer3 and their specificity was tested by BLAST [ ]. .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Electrophoresis:Article Title: From Pig Breeding Environment to Subsequently Produced Pork: Comparative Analysis of Antibiotic Resistance Genes and Bacterial Community Composition Article Snippet: The PCRs were performed in a total volume of 25 μL including 1 μL of extracted DNA, 2.5 μL of Taq reaction buffer, 0.2 mM dNTPs, 0.2 μM primers, and 0.625 units of Microarray:Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: The DNA was PCR-amplified with Takara Incubation:Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells Article Snippet: Immunocomplexes were mixed with 60 μl of 50% protein G agarose suspension, followed by incubation for 1 h at 4°C with rotation. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: The sample was then digested with 25 µg/mL RNase A for overnight incubation at 37°C and extracted with phaselock tubes again as described above. .. The DNA was PCR-amplified with Takara Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Formalin-fixed Paraffin-Embedded:Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: Also, from FFPE tissues, DNA was extracted using the recover all total nucleic acid isolation kit (Ambion, USA). .. Bisulfite-modified DNA was amplified by PCR using In Silico:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: An in silico analysis using the UCSC Genome Bioinformatics Site ( http://genome.ucsc.edu ) was performed to identify the CpG sites associated with the proximal promoter for each gene. .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Expressing:Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: DNA was precipitated with ethanol and washed with 75% ethanol three times before being resuspended in H2 O. .. The DNA was PCR-amplified with Takara Modification:Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Prior to the analysis of the methylation status of the target genes, the presence of bisulfite modified DNA in each sample was determined by amplification of 133-bp DNA fragment of the β-actin gene, which was used for quality control ( ). .. Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics Article Snippet: The forward primer was LepF (5′ ATTCAACCAATCATAAAGATATTGG 3′), and the reverse primer (mlCOIintBeeR, 5′ GGDGGRTAWANDGTTCANCCHGTHCC 3′) was modified from mlCOIintR (Leray et al .), based on 160 bee COI reference sequences downloaded from GenBank. .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Gas Chromatography:Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Hot-Start Taq DNA polymerase (Takara, Dalian, Liaoning, China), 1 µl of primer mixture 1 and about 20 ng of genomic DNA. .. The second PCR reaction in 20 µl volume contained 1x GC Buffer I, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: The primers were designed by online Primer3 and their specificity was tested by BLAST [ ]. .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Ligation:Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Sequencing:Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: Bisulfite-modified DNA was amplified by PCR using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The selected 5 SNPs were genotyped with the method of polymerase chain reaction (PCR)-ligase detection reaction (LDR) on an ABI Prism 377 Sequence Detection System (Applied Biosystems, Foster City, CA, USA), as previously reported [ , ] with technical supports from the Shanghai Genesky Biotechnology Company (Shanghai, China). .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: High‐throughput monitoring of wild bee diversity and abundance via mitogenomics Article Snippet: To build Illumina‐ready PCR amplicons, we attached the standard Illumina HP10 or HP11 sequencing primers, an 8‐bp index sequence, a 0‐ to 5‐bp ‘heterogeneity spacer’ to the 5′ end of LepF, and mlCOIintBeeR (Fig. S3), following Fadrosh et al . ( ). .. PCRs were performed in 20 μL reaction volumes containing 2 μL of 10X buffer, 1·5 mM MgCl2 , 0·2 mM dNTPs, 0·2 μM each primer, 0·6 U Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation Article Snippet: Two sets of primers were used to amplify each region of interest: one pair recognized a sequence in which CpG sites were unmethylated (bisulfite-modified to UpG), and the other recognized a sequence in which CpG sites were methylated (unmodified by bisulfite treatment). .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: Paragraph title: Sequencing analysis ... PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and DNA Extraction:Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: Paragraph title: DNA isolation, bisulfite conversion and bisulfite specific PCR ... Bisulfite-modified DNA was amplified by PCR using Combined Bisulfite Restriction Analysis Assay:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Briefly, 1 µg of genomic DNA was subjected to bisulfite modification treatment using the EpiTect Plus kit (QIAGEN). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Methylation:Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma Article Snippet: Paragraph title: Measurement of LINE-1 methylation by pyrosequencing ... A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Article Title: GPX3 suppresses tumor migration and invasion via the FAK/AKT pathway in esophageal squamous cell carcinoma Article Snippet: Paragraph title: Bisulfite modification of genomic DNA and methylation-specific PCR (MSP) ... The bisulfite-modified genomic DNA was amplified using either primer-methylated or primer-unmethylated in a total volume of 10 µl containing 0.25 µl of Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: COBRA was used to assess the methylation status of the specific CpG sites located in the promoter regions of somatostatin (SST ) and insulin (INS ). .. Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Paragraph title: Primer design and methylation detection ... Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: CpG-rich 5' regions in DUSP-1 gene methylation status were assessed by bisulfite sequencing PCR (BSP) (Methyl Primer Express v 1.0, Thermo Fisher Scientific, USA): DUSP-1 (rat) forward CAGGGGAGCAGGGCAGGT-GTCC; DUSP-1 (rat) reverse CACCAAAGC-CAAAAGCAAAGAC; DUSP-1 (human) forward AGTTTGGAGTTAAGGTGATAGAA; DUSP-1 (human) reverse CTATTCCTAATCT-TATAACCCCC. .. Bisulfite-modified DNA was amplified by PCR using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: Briefly, pooled samples were digested with Proteinase K (PK) and treated with sodium bisulfite to convert all unmethylated cytosine to uracil using an EZ DNA Methylation-Direct Kit (Zymo Research). .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Pentraxin 3 (PTX3) promoter methylation associated with PTX3 plasma levels and neutrophil to lymphocyte ratio in coronary artery disease Article Snippet: Plasma was separated within 2 h of blood collection and kept at −80 °C until it was used further for analysis. .. 2.4 DNA was amplified using a methylation-specific primer set, PTX3-MF: 5′-CGTTTGCGGTTAGGAGTATTC-3′ and PTX3-MR: 5′-CAAAACGTCGTCCGTAACTTA-3′, or a non-methylation-specific primer set, PTX3-UF: 5′-TGTGT TTGTGGTTAGGAGTATTTG-3′ and PTX3-UR: 5′-CAA AACATCATCCATAACTTA-3′, in a total volume of 20 µL, using 0.5 units of Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation Article Snippet: Paragraph title: Methylation-specific polymerase chain reaction (MSP) ... The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: Briefly, pooled samples were digested with Proteinase K (PK) and treated with sodium bisulfite to convert all unmethylated cytosine to uracil using an EZ DNA Methylation-Direct Kit (Zymo Research). .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Mutagenesis:Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Paragraph title: EGFR Mutation Analysis ... Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Isolation:Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: A total of 500 ng of isolated DNA was bisulfite-converted using Zymo EZ DNA methylation kit (cat no D5005, USA). .. Bisulfite-modified DNA was amplified by PCR using Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: Genomic DNA was isolated from peripheral blood using QIAamp DNA Blood Mini Kit (QIAGEN, Valencia, CA, USA). .. PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Size-exclusion Chromatography:Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Labeling:Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: The DNA was PCR-amplified with Takara Purification:Article Title: UHRF1 is an Independent Prognostic Factor and a Potential Therapeutic Target of Esophageal Squamous Cell Carcinoma Article Snippet: A total volume of 40 µl of PCR amplification reagent consisted of the forward and reverse primers (each 0.1 µmol/l), 0.2 mmol/l dNTPs, 10× PCR buffers, 2.5 U of Takara Article Title: Differences among lesions with exon 19, exon 21 EGFR mutations and wild types in surgically resected non-small cell lung cancer Article Snippet: Genomic DNA was isolated and purified from formalin-fixed paraffin-embedded tissues using the GTpure FFPE Tissue DNA Extraction Kit (GeneTech, Shanghai, China) in accordance with the manufacturer’s instructions. .. Each PCR assay contained forward and reverse primers (each 4 pmol), 2 μl template DNA solution, and 2 units of Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells Article Snippet: Chromatin was then de-crosslinked for 5 h at 65°C. .. After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Article Title: The Regulatory Effects of Lateral Hypothalamus Area GABAB Receptor on Gastric Ischemia-Reperfusion Injury in Rats Article Snippet: Purification and reverse transcription RNA was performed as described above. .. Real time PCR was performed in a total volume of 50 μL with 1 μL reverse transcribed cDNA, 3 μL of each primer in hot start buffer, 0.5 μL Article Title: A gain-of-function senescence bypass screen identifies the homeobox transcription factor DLX2 as a regulator of ATM–p53 signaling Article Snippet: The DNA was PCR-amplified with Takara Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Reverse Transcription Polymerase Chain Reaction:Article Title: Dynamic expression of Epac and Rap1 in mouse oocytes and preimplantation embryos Article Snippet: Standard complentary DNA synthesis by reverse transcription of the RNA was then performed using random primers and SuperScript™ III RNase H-Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). .. Epac1 and Rap1a mRNA were detected by RT-PCR with mRNA primer pairs using Polyacrylamide Gel Electrophoresis:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Nested PCR:Article Title: Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56 °C for 1 h. For samples of 104 PFFs, 800 MII oocytes and 200, 100, 200, 25 and 25 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, in each group, digestion was performed in M-Digestion Buffer supplemented with PK at 50 °C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98 °C for 10 min and 64 °C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of CenRep, Dnmt1, Oct4, Nanog and Sox2 using the primers described in and Article Title: Epigenetic Modification Agents Improve Gene-Specific Methylation Reprogramming in Porcine Cloned Embryos Article Snippet: For semen, the sperm was collected by centrifugation, washed in SMB solution (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl and 2% SDS) and incubated in SMB solution supplemented with 40 mM dithiothreitol and 0.3 mg/ml PK at 56°C for 1 h. For samples of 103 PFFs, 200 MII oocytes and 200, 100, 50, 25 and 20 pooled zona pellucida-removed embryos at the 1-cell, 2-cell, 4-cell, 8-cell and blastocyst stages, respectively, digestion was performed in M-Digestion Buffer supplemented with PK at 50°C for 20 min. After digestion, a CT (cytosine to thymine) conversion reagent was added at 98°C for 10 min and 64°C for 2.5 h. Then, the samples were desalted, purified and diluted with M-Elution Buffer. .. Subsequently, nested PCR was carried out to amplify the target regions of Oct4 and Thy1 using the primers described in and Chromatin Immunoprecipitation:Article Title: Yin Yang-1 increases apoptosis through Bax activation in pancreatic cancer cells Article Snippet: Paragraph title: Chromatin immunoprecipitation (ChIP) ... After treatment with RNase A and proteinase K, DNA was purified with spin columns and eluted in 50 μl of elution buffer C. An aliquot (2 μl) of each sample was subjected to PCR analysis using Software:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: Bisulfite-modified DNA was amplified by PCR using Article Title: HIRA Gene is Lower Expressed in the Myocardium of Patients with Tetralogy of Fallot Article Snippet: PCR was accomplished in a 10 μl reaction mixture, which contained 1 μl of genomic DNA (10 ng/μl), 0.8 μl mixture of forward and reverse primers, 1.6 μl of dNTP (2.5 mmol/L each), 5 μl of ×2 GC Buffer I/II (Mg2+ plus), 0.1 μl of Real-time Polymerase Chain Reaction:Article Title: The Regulatory Effects of Lateral Hypothalamus Area GABAB Receptor on Gastric Ischemia-Reperfusion Injury in Rats Article Snippet: Purification and reverse transcription RNA was performed as described above. .. Real time PCR was performed in a total volume of 50 μL with 1 μL reverse transcribed cDNA, 3 μL of each primer in hot start buffer, 0.5 μL Multiplex Assay:Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: Two multiplex PCR reactions were designed. .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Agarose Gel Electrophoresis:Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U In Vitro:Article Title: Aberrant promoter methylation of cancer-related genes in human breast cancer Article Snippet: Modified DNA was amplified in a total volume of 25 µl solution containing 0.8 U Spectrophotometry:Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: DNA samples were air dried and quantified using an ND1000 spectrophotometer (Thermo Scientific) and stored at −20ºC. .. Bisulfite-modified DNA was amplified by PCR using DNA Methylation Assay:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Paragraph title: DNA methylation analysis ... Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of Article Title: DUSP-1 gene expression is not regulated by promoter methylation in diabetes-associated cardiac hypertrophy Article Snippet: A total of 500 ng of isolated DNA was bisulfite-converted using Zymo EZ DNA methylation kit (cat no D5005, USA). .. Bisulfite-modified DNA was amplified by PCR using Article Title: Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation Article Snippet: DNA methylation of CpG islands was then determined by PCR using specific primers for either methylated or unmethylated DNA. .. The PCR amplifications were carried out with treated DNA as template in a total volume of 25 μl containing 25 pM of each primers, 25 μM deoxynucleoside triphosphates, 30 ng of bisulfate-treated DNA, 1 U of DNA Purification:Article Title: Association between WT1 polymorphisms and susceptibility to breast cancer: results from a case-control study in a southwestern Chinese population Article Snippet: According to the manufacturer’s instructions, DNA was extracted from peripheral blood leukocytes using Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, USA). .. The first PCR reaction in 20 µl contained 1x PCR buffer, 3.0 mM Mg2+ , 0.3 mM dNTP, 1 U of Staining:Article Title: Epigenetic reprogramming using 5-azacytidine promotes an anti-cancer response in pancreatic adenocarcinoma cells Article Snippet: Then, COBRA PCR was performed as follows: after an initial denaturation step at 94 °C for 3 min, the following thermal cycles were repeated 40 times: 94 °C for 10 s, 55 °C for 50 s, and 72 °C for 1 min. Each COBRA PCR was performed in a total volume of 10 µL, which contained 0.5 units of |