hot start taq polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TrueStart Hot Start Taq DNA Polymerase
    Description:

    Catalog Number:
    EP0611
    Price:
    None
    Score:
    85
    Buy from Supplier
    Name:
    Platinum Taq Green Hot Start DNA Polymerase
    Description:
    Invitrogen Platinum Taq Green Hot Start DNA Polymerase provides Platinum Taq DNA Polymerase with a 10X Green PCR Buffer. Platinum Taq DNA Polymerase is a convenient and reliable "hot start" thermostable DNA polymerase for PCR that provides enhanced specificity over that of Taq DNA Polymerase. The "hot start" property of the enzyme is conferred by thermolabile monoclonal antibodies that render Taq DNA polymerase inactive until the initial PCR denaturation step, thus preventing the extention of nonspecifically annealed primers and improving product yield. Features of Platinum Taq Green Hot Start DNA Polymerase include: • High specificity and increased yields with antibody-mediated hot-start PCR • Convenient room-temperature reaction setup • Direct gel loading with green PCR buffer • Versatile formulation for broad range of amplicons About Platinum Taq DNA Polymerase Platinum Taq DNA Polymerase is a recombinant Taq DNA polymerase complexed with proprietary Platinum antibodies. The antibodies dissociate during the initial PCR denaturation step and the DNA polymerase regains its full activity. Just as with Taq DNA Polymerase, Platinum Taq DNA Polymerase has a non-template-dependent terminal transferase activity that adds a 3' deoxyadenosine to product ends and has a 5'→3' exonuclease activity. Platinum Taq Green Hot Start DNA Polymerase is provided with green PCR buffer that contains a density reagent and two tracking dyes and allows for direct gel loading of PCR products. The optional KB Extender used with Platinum Taq DNA Polymerase enables more versatility in PCR assays with long or GC-rich amplicons. Use Platinum Taq Green Hot Start DNA Polymerase for the amplification of DNA from complex genomic, viral, and plasmid templates, as well as in RT-PCR. Note: For superior PCR performance, we recommend the next-generation enzyme Platinum II Taq Hot-start DNA Polymerase. Platinum II Taq Hot-Start DNA Polymerase is designed for universal primer annealing and fast, easy PCR with its unique combination of innovative buffer, high-performance engineered Taq DNA polymerase, and superior hot-start technology. Platinum II Taq Hot-Start DNA Polymerase can be used with Platinum II Green PCR Buffer that is supplemented with a density reagent and two tracking dyes for direct loading of PCR products on gels.
    Catalog Number:
    11966018
    Price:
    None
    Applications:
    Amplification of Bisulfite-Treated DNA|Genotyping & Genomic Profiling|Hot Start PCR|PCR|PCR & Real-Time PCR|PCR Genotyping|RNAi, Epigenetics & Non-Coding RNA Research|Routine PCR|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Methylation Analysis|Sequencing|SNP Genotyping|Gene Expression Analysis & Genotyping
    Size:
    120 reactions
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, PCR Enzymes & Kits
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher hot start taq polymerase
    Invitrogen Platinum Taq Green Hot Start DNA Polymerase provides Platinum Taq DNA Polymerase with a 10X Green PCR Buffer. Platinum Taq DNA Polymerase is a convenient and reliable "hot start" thermostable DNA polymerase for PCR that provides enhanced specificity over that of Taq DNA Polymerase. The "hot start" property of the enzyme is conferred by thermolabile monoclonal antibodies that render Taq DNA polymerase inactive until the initial PCR denaturation step, thus preventing the extention of nonspecifically annealed primers and improving product yield. Features of Platinum Taq Green Hot Start DNA Polymerase include: • High specificity and increased yields with antibody-mediated hot-start PCR • Convenient room-temperature reaction setup • Direct gel loading with green PCR buffer • Versatile formulation for broad range of amplicons About Platinum Taq DNA Polymerase Platinum Taq DNA Polymerase is a recombinant Taq DNA polymerase complexed with proprietary Platinum antibodies. The antibodies dissociate during the initial PCR denaturation step and the DNA polymerase regains its full activity. Just as with Taq DNA Polymerase, Platinum Taq DNA Polymerase has a non-template-dependent terminal transferase activity that adds a 3' deoxyadenosine to product ends and has a 5'→3' exonuclease activity. Platinum Taq Green Hot Start DNA Polymerase is provided with green PCR buffer that contains a density reagent and two tracking dyes and allows for direct gel loading of PCR products. The optional KB Extender used with Platinum Taq DNA Polymerase enables more versatility in PCR assays with long or GC-rich amplicons. Use Platinum Taq Green Hot Start DNA Polymerase for the amplification of DNA from complex genomic, viral, and plasmid templates, as well as in RT-PCR. Note: For superior PCR performance, we recommend the next-generation enzyme Platinum II Taq Hot-start DNA Polymerase. Platinum II Taq Hot-Start DNA Polymerase is designed for universal primer annealing and fast, easy PCR with its unique combination of innovative buffer, high-performance engineered Taq DNA polymerase, and superior hot-start technology. Platinum II Taq Hot-Start DNA Polymerase can be used with Platinum II Green PCR Buffer that is supplemented with a density reagent and two tracking dyes for direct loading of PCR products on gels.
    https://www.bioz.com/result/hot start taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hot start taq polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania). .. Multiplex PCR was also carried out with a multiplexing kit (Qiagen, Hilden, Germany) along with Q-solution following the manufacturer’s instructions.

    Amplification:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: For MSP, bisulfite-treated DNA was amplified with primers specific for the methylated (M) and unmethylated (U) promoter region of either the HHIP (from − 230 to − 87 bp upstream of the transcriptional start site), the IGFBP3 (from − 180 to − 13 bp upstream of the transcriptional start site), or the SFRP1 (from + 36 to + 175 bp downstream of the transcriptional start site) gene. .. For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Standard PCR with the MY09/MY11 primers was performed as previously described [ , ]. .. Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA). .. Then, PCR was performed using the product of the first reaction as a template in 50 mM KCl, 10 mM TrisHCl (pH 8.3), 200 mM of each deoxynucleoside triphosphate, 3.5 mM MgCl2 , 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA), and 50 pmol each of the GP5+ (5’-TTTGTTACTGTGGTAGATACTAC-3′) and GP6+ (3’-CTTATACTAAATGTCAAATAAAAAG-5′) primers.

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA). .. Then, PCR was performed using the product of the first reaction as a template in 50 mM KCl, 10 mM TrisHCl (pH 8.3), 200 mM of each deoxynucleoside triphosphate, 3.5 mM MgCl2 , 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA), and 50 pmol each of the GP5+ (5’-TTTGTTACTGTGGTAGATACTAC-3′) and GP6+ (3’-CTTATACTAAATGTCAAATAAAAAG-5′) primers.

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: Briefly, one million PBMCs from each of the nine select pediatric cross-neutralizers were pooled and total RNA was isolated by Trizol reagent (Sigma) and then reverse transcribed to cDNA, using the Reverse aid M-MuLV reverse transcriptase (Thermo). .. For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. An equimolar mixture of pooled heavy and light chain DNA was used in the second round of assembly PCR using Pfu DNA polymerase.

    Article Title: Association of Interleukin-1β and Gene Polymorphisms with Liver Pathogenesis in Hepatitis B Virus Infection among Eastern Indian Population
    Article Snippet: The primers used in the PCR amplification are; pil-1βf (5′-TGGCATTGATCTGGTTCATC-3′) and pil-1βr (5′-GTTTAGGATCTTCCCACTT-3′). .. Briefly 5 μl of extracted DNA was amplified in a 25 μl reaction volume containing 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 1 U of hot start Taq polymerase (AmpliTaq Gold DNA polymerase, Applied Biosystems, Foster City, CA, USA) and 10 pmol of each primer. .. The thermal cycling parameters were as follows: initial denaturation and Taq activation at 94 °C for 10 min, 35 cycles of denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s, and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 10 min. After that, 15 μl of amplified products were digested with 5U of AvaI (New England Biolabs Inc.) restriction enzyme in a final reaction volume of 20 μl at 37 °C for 3 h. The digested PCR products were then analyzed by 3% agarose gel electrophoresis stained with ethidium bromide and MspI digested pUC19 vector was used as molecular weight marker.

    Article Title: Tumor Cell Heterogeneity in Small Cell Lung Cancer (SCLC): Phenotypical and Functional Differences Associated with Epithelial-Mesenchymal Transition (EMT) and DNA Methylation Changes
    Article Snippet: The first amplicon of Vimentin between nt +608 to +703 with respect to the TSS contained twelve and the second amplicon (spanning +468 to +537 with respect to the TSS) eight CpG sites, respectively. .. Each 25 µl PCR reaction contained 1.5 mM MgCl2, 0.4 mM dNTP, 0.03 U/µl Hot start Taq DNA polymerase (Invitrogen, CA, USA), 0.16 µM forward and reverse primer and 1 µl of bisulfite treated DNA.

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: MSP reactions were carried out at the following conditions: hot start at 94 °C for 4 min, followed by 38 cycles of 94 °C for 30 s, gene-specific annealing temperature (see above) for 30 s, 72 °C for 45 s, and final extension at 72 °C for 10 min. One percent agarose gel electrophoresis was performed to visualize DNA amplicons. .. For pyrosequencing, 100 ng bisulfite-treated DNA was first amplified in a PCR reaction, using 1 U hot start Taq polymerase (Thermo Scientific), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-F, GGGAGGAGAGAGGAGTTT and HHIP-R, AACCAACCTCCAAAATACTAAACC at 55 °C; IGFBP3-F, TGGTTTTTTGAGATTTAAATGTAAGTTAGA and IGFBP3-R, ATCACCCCAATCACTCCTA at 57 °C; SFRP1-F, GGAGTTAGAGATTAGTTTGGTTAATATGG and SFRP1-R, AAAAACCTAAATCATACTTACAACC at 54 °C; and LINE1-F and LINE1-R (assay X58075, Qiagen) at 55 °C. .. PCR reactions were run at 95 °C for 4 min and 45 cycles of 95 °C for 20 s, gene-specific annealing temperature (see above) for 20 s, and 72 °C for 30 s. PCR products were sequenced with the corresponding sequencing primers HHIP-Seq, TTTAGGATTGAGTTTTTGTTTTAAG; IGFBP3-Seq, TTGGGTTATTTAGGTTTTATATAG; and SFRP1-Seq, GGTAAGAGGTTGTAATTTTAGTTAT using PyroMark Gold Q24 reagents (Qiagen).

    Article Title: LOC134466 methylation promotes oncogenesis of endometrial carcinoma through LOC134466/hsa-miR-196a-5p/TAC1 axis
    Article Snippet: Bisulfite-modified DNA was then amplified with two primer sets that differentiate methylated from unmethylated DNA. .. Meanwhile, we performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific).

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Using purified genomic DNA, a 139-bp product was amplified with the following primers: forward primer 5’-CCAGGGCCCCTAACCTCTGCA-3’ and the reverse primer 5’-GGGAGCGCGGAGTGCAATTCA-3’. .. Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA. .. The thermal protocol for amplification included 35 cycles of denaturation at 95 °C for 60 s, annealing at 62 °C for 60 s, and elongation at 72 °C for 60 s. Ten microliters of the amplicons were digested with 1 unit Bst UI (New England Biolabs, Hitchin, UK) in a total volume of 20 μL at 37 °C overnight.

    Mass Spectrometry:

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: Each PCR reaction incorporated ~20 ng of sodium bisulphite-modified DNA. .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany). .. The cycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 36 cycles of 94°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec, and a final step at 72°C for 5 min. For each set of MS-PCR, human blood lymphocyte DNA treated with bisulfite (Zymo Research Corporation) served as an unmethylated DNA control, and as a positive methylation control, Bisulfite-converted Universal Methylated Human DNA Standard (Zymo Research Corporation) was used.

    Synthesized:

    Article Title: Genetic diversity and parentage in farmer selections of cacao from Southern Sulawesi, Indonesia revealed by microsatellite markers
    Article Snippet: Primers were synthesized by Proligo (Boulder, CO) and forward primers were 5′-labeled using WellRED fluorescent dyes (Beckman Coulter, Inc., Fullerton, CA). .. PCR was performed as described in , using commercial hot-start PCR SuperMix that had been fortified with an additional 30 U/ml of hot-start Taq DNA polymerase (Invitrogen Platinum Taq , Carlsbad, CA, or Eppendorf HotMaster Taq , Brinkman, Westbury, NY).

    Construct:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: A pediatric anti-HIV-1 subtype C scFv recombinant phage library was constructed as described previously ( , , , ) with a few modifications. .. For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: The role of KIF14 in patient-derived primary cultures of high-grade serous ovarian cancer cells
    Article Snippet: Paragraph title: End-point and real-time PCR ... For end-point PCR, 1 μL of the RT reaction was added to a 25 μL PCR reaction containing 0.5 U Hot Start Taq Polymerase (Fermentas, Burlington, ON), 0.2 mM dNTPs, 1.5 mM MgCl2 and KIF14 primers; cycling conditions were previously described [ ].

    Article Title: Selective use of multiple vitamin D response elements underlies the 1 ?,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
    Article Snippet: Paragraph title: Total RNA extraction, cDNA synthesis and real-time PCR ... Per reaction, 0.3 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 62°C and 40 s at 72°C.

    Article Title: Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor
    Article Snippet: Real-time quantitative PCR was performed in an IQ-cycler (BioRad, Hercules, CA, USA) using the dye SybrGreen I (Molecular Probes, Leiden, The Netherlands). .. Per reaction, 1 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Random Hexamer Labeling:

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Expressing:

    Article Title: The role of KIF14 in patient-derived primary cultures of high-grade serous ovarian cancer cells
    Article Snippet: For end-point PCR, 1 μL of the RT reaction was added to a 25 μL PCR reaction containing 0.5 U Hot Start Taq Polymerase (Fermentas, Burlington, ON), 0.2 mM dNTPs, 1.5 mM MgCl2 and KIF14 primers; cycling conditions were previously described [ ]. .. TBP was used as an endogenous control, and products were visualized by gel electrophoresis and ethidium bromide staining.

    Transformation Assay:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA).

    Countercurrent Chromatography:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. An equimolar mixture of pooled heavy and light chain DNA was used in the second round of assembly PCR using Pfu DNA polymerase.

    Electroporation:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. The scFvs were resolved on agarose gel and purified using gel extraction kit (Qiagen).

    Activation Assay:

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA). .. Then, PCR was performed using the product of the first reaction as a template in 50 mM KCl, 10 mM TrisHCl (pH 8.3), 200 mM of each deoxynucleoside triphosphate, 3.5 mM MgCl2 , 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA), and 50 pmol each of the GP5+ (5’-TTTGTTACTGTGGTAGATACTAC-3′) and GP6+ (3’-CTTATACTAAATGTCAAATAAAAAG-5′) primers.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Paragraph title: Multiplex RT-PCR ... Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Article Title: Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor
    Article Snippet: Paragraph title: RNA extraction and real-time quantitative RT–PCR ... Per reaction, 1 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Sequencing:

    Article Title: Tumor Cell Heterogeneity in Small Cell Lung Cancer (SCLC): Phenotypical and Functional Differences Associated with Epithelial-Mesenchymal Transition (EMT) and DNA Methylation Changes
    Article Snippet: The 5′end of the sequence-specific reverse primer used for VIM amplicon 1 and amplicon 2 was biotin labeled. .. Each 25 µl PCR reaction contained 1.5 mM MgCl2, 0.4 mM dNTP, 0.03 U/µl Hot start Taq DNA polymerase (Invitrogen, CA, USA), 0.16 µM forward and reverse primer and 1 µl of bisulfite treated DNA.

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania). .. Multiplex PCR was also carried out with a multiplexing kit (Qiagen, Hilden, Germany) along with Q-solution following the manufacturer’s instructions.

    Binding Assay:

    Article Title: The role of KIF14 in patient-derived primary cultures of high-grade serous ovarian cancer cells
    Article Snippet: For end-point PCR, 1 μL of the RT reaction was added to a 25 μL PCR reaction containing 0.5 U Hot Start Taq Polymerase (Fermentas, Burlington, ON), 0.2 mM dNTPs, 1.5 mM MgCl2 and KIF14 primers; cycling conditions were previously described [ ]. .. For real-time PCR, RT reaction products were diluted 10-fold with RNAse/DNAse-free ddH2 O, and 1.5 L was added to 1X TaqMan PCR master mix (Applied Biosystems, Life Technologies, Carlsbad, CA) and 1X TaqMan Gene Expression Assay primer-probe mix for KIF14 (Hs00978216_m1).

    Methylation:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: Paragraph title: Methylation-specific polymerase chain reaction (MSP) ... For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Article Title: LOC134466 methylation promotes oncogenesis of endometrial carcinoma through LOC134466/hsa-miR-196a-5p/TAC1 axis
    Article Snippet: Paragraph title: Methylation-Specific PCR (MSP) ... Meanwhile, we performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific).

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: Primers distinguishing unmethylated from methylated alleles were previously published by Ma et al , and their sequences were as follows: Methylated forward: 5′-TATTGAGTTTGTTTAGTAGGGCGTC-3′ and reverse: 5′-AATAACAACCGAACAACTCCG-3′; and unmethylated forward: 5′-TGAGTTTGTTTAGTAGGGTGTTG-3′ and reverse: 5′-ATAACAACCAAACAACTCCAA-3′. .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany).

    Article Title: Epigenetically silenced miR-34b/c as a novel faecal-based screening marker for colorectal cancer
    Article Snippet: Briefly, 2 μ l of bisulfite-converted genomic DNA served as the PCR template. .. The 1 × PCR buffer supplemented with 1.5 m MgCl2 , 0.25 m of each primer, 0.2 μ of dNTPs, 0.1 μ g μ l−1 BSA and 0.25 U of Hot Start Taq polymerase (Applied Biosystems) in a total volume of 20 μ l. Cycling conditions for methylated and unmethylated strand of miR-34b/c were as follows: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. For unmethylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 30 s and extension at 68°C for 30 s, and a final extension at 68°C for 7 min. For methylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. Qiagen's methylated and unmethylated control DNAs served as a reaction control for PCR. .. Faecal DNA was obtained as previously described ( ).

    Isolation:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: Briefly, one million PBMCs from each of the nine select pediatric cross-neutralizers were pooled and total RNA was isolated by Trizol reagent (Sigma) and then reverse transcribed to cDNA, using the Reverse aid M-MuLV reverse transcriptase (Thermo). .. For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA).

    Article Title: Selective use of multiple vitamin D response elements underlies the 1 ?,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
    Article Snippet: Total RNA was extracted using the Mini RNA Isolation II kit (Zymo Research, HiSS Diagnostics, Freiburg, Germany) and cDNA synthesis was performed for 1 h at 37°C using 1 µg of total RNA as a template, in the presence of 100 pmol oligodT18 primer and 40 U reverse transcriptase (Fermentas, Vilnius, Lithuania). .. Per reaction, 0.3 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 62°C and 40 s at 72°C.

    Article Title: Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor
    Article Snippet: Total RNA was extracted using using the Mini RNA Isolation II kit (Zymo Research, HiSS Diagnostics, Freiburg, Germany) and cDNA synthesis was performed for 1 h at 37°C using 1 µg of total RNA as a template, 100 pmol oligodT18 primer and 40 U reverse transcriptase (Fermentas, Vilnius, Lithuania). .. Per reaction, 1 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Multiplex PCR:

    Article Title: Aquaculture Can Promote the Presence and Spread of Antibiotic-Resistant Enterococci in Marine Sediments
    Article Snippet: Two Multiplex-PCR assays were developed to detect simultaneously tet (M), tet (L) and tet (O) and erm (B), erm (A) and mef , respectively. .. The PCR cycling program was as follows: 95°C for 10 min, followed by 35 cycles at 94°C for 30 s, 53°C [tet (M), tet (L), tet (O)] or 54°C [erm (B), erm (A), mef ] for 30 s, 72°C for 90 s and final extension at 72°C for 7 min. Each mix contained 600 µM dNTPs, 6 mM MgCl2 , 1× Buffer, 0.5 µM of each primer [1 µM of those targeting tet (M)], and 1.25 U hot-start Taq DNA polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA).

    Multiplex Assay:

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Paragraph title: Multiplex RT-PCR ... Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Labeling:

    Article Title: Tumor Cell Heterogeneity in Small Cell Lung Cancer (SCLC): Phenotypical and Functional Differences Associated with Epithelial-Mesenchymal Transition (EMT) and DNA Methylation Changes
    Article Snippet: The 5′end of the sequence-specific reverse primer used for VIM amplicon 1 and amplicon 2 was biotin labeled. .. Each 25 µl PCR reaction contained 1.5 mM MgCl2, 0.4 mM dNTP, 0.03 U/µl Hot start Taq DNA polymerase (Invitrogen, CA, USA), 0.16 µM forward and reverse primer and 1 µl of bisulfite treated DNA.

    Purification:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: Two micrograms of purified genomic DNA was used for bisulfite-mediated conversion of unmethylated cytosine using the Epitec Bisulfite Kit (Qiagen, Hilden, Germany). .. For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. Full length scFvs were amplified by pull-through PCR reaction using Hot start Taq DNA polymerase and forward primer PTFw 5′ CCT TTC TAT GCG GCC CAG CCG GCC ATG GCC 3′ and reverse primers PAK kappa Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC GTT TRA T 3′, and PAK lambda Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC CTA RRA C 3′ (R = G and A).

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Using purified genomic DNA, a 139-bp product was amplified with the following primers: forward primer 5’-CCAGGGCCCCTAACCTCTGCA-3’ and the reverse primer 5’-GGGAGCGCGGAGTGCAATTCA-3’. .. Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA.

    Polymerase Chain Reaction:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: Paragraph title: Methylation-specific polymerase chain reaction (MSP) ... For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Standard PCR with the MY09/MY11 primers was performed as previously described [ , ]. .. Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA).

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA). .. Then, PCR was performed using the product of the first reaction as a template in 50 mM KCl, 10 mM TrisHCl (pH 8.3), 200 mM of each deoxynucleoside triphosphate, 3.5 mM MgCl2 , 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA), and 50 pmol each of the GP5+ (5’-TTTGTTACTGTGGTAGATACTAC-3′) and GP6+ (3’-CTTATACTAAATGTCAAATAAAAAG-5′) primers. .. Amplifications were performed in a Mastercycler Nexus (Eppendorf, Hamburg, DE) with an activation at 94 °C for 7 min and 25 cycles (first step) or 15 cycles (second step) at 94 °C for 45 s, 56 °C (first step) or 46 °C (second step) for 45 s and 72 °C for 1 min.

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. An equimolar mixture of pooled heavy and light chain DNA was used in the second round of assembly PCR using Pfu DNA polymerase.

    Article Title: Aquaculture Can Promote the Presence and Spread of Antibiotic-Resistant Enterococci in Marine Sediments
    Article Snippet: PCR assays were performed in a final volume of 50 µl containing 5 µl of DNA (diluted 100 times or undiluted and purified) using a T Personal thermal cycler (Biometra, Göttingen, Germany). .. The PCR cycling program was as follows: 95°C for 10 min, followed by 35 cycles at 94°C for 30 s, 53°C [tet (M), tet (L), tet (O)] or 54°C [erm (B), erm (A), mef ] for 30 s, 72°C for 90 s and final extension at 72°C for 7 min. Each mix contained 600 µM dNTPs, 6 mM MgCl2 , 1× Buffer, 0.5 µM of each primer [1 µM of those targeting tet (M)], and 1.25 U hot-start Taq DNA polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA). .. The resistance genes bla Z and aac (6′)-Ie aph (2 ″)-Ia were sought as previously described .

    Article Title: The role of KIF14 in patient-derived primary cultures of high-grade serous ovarian cancer cells
    Article Snippet: To confirm RT, 1 L of each reaction was tested in endpoint PCR for KIF14 and the housekeeping gene HPRT (hypoxanthine phosphoribosyl transferase) as described [ ]. .. For end-point PCR, 1 μL of the RT reaction was added to a 25 μL PCR reaction containing 0.5 U Hot Start Taq Polymerase (Fermentas, Burlington, ON), 0.2 mM dNTPs, 1.5 mM MgCl2 and KIF14 primers; cycling conditions were previously described [ ]. .. TBP was used as an endogenous control, and products were visualized by gel electrophoresis and ethidium bromide staining.

    Article Title: Association of Interleukin-1β and Gene Polymorphisms with Liver Pathogenesis in Hepatitis B Virus Infection among Eastern Indian Population
    Article Snippet: The primers used in the PCR amplification are; pil-1βf (5′-TGGCATTGATCTGGTTCATC-3′) and pil-1βr (5′-GTTTAGGATCTTCCCACTT-3′). .. Briefly 5 μl of extracted DNA was amplified in a 25 μl reaction volume containing 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 1 U of hot start Taq polymerase (AmpliTaq Gold DNA polymerase, Applied Biosystems, Foster City, CA, USA) and 10 pmol of each primer.

    Article Title: Tumor Cell Heterogeneity in Small Cell Lung Cancer (SCLC): Phenotypical and Functional Differences Associated with Epithelial-Mesenchymal Transition (EMT) and DNA Methylation Changes
    Article Snippet: The first amplicon of Vimentin between nt +608 to +703 with respect to the TSS contained twelve and the second amplicon (spanning +468 to +537 with respect to the TSS) eight CpG sites, respectively. .. Each 25 µl PCR reaction contained 1.5 mM MgCl2, 0.4 mM dNTP, 0.03 U/µl Hot start Taq DNA polymerase (Invitrogen, CA, USA), 0.16 µM forward and reverse primer and 1 µl of bisulfite treated DNA. .. For CDH1 0.16 µM forward primer and 0.03 µl tailed reverse primer and 0.14 µM universal biotinylated primer was used.

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: MSP reactions were carried out at the following conditions: hot start at 94 °C for 4 min, followed by 38 cycles of 94 °C for 30 s, gene-specific annealing temperature (see above) for 30 s, 72 °C for 45 s, and final extension at 72 °C for 10 min. One percent agarose gel electrophoresis was performed to visualize DNA amplicons. .. For pyrosequencing, 100 ng bisulfite-treated DNA was first amplified in a PCR reaction, using 1 U hot start Taq polymerase (Thermo Scientific), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-F, GGGAGGAGAGAGGAGTTT and HHIP-R, AACCAACCTCCAAAATACTAAACC at 55 °C; IGFBP3-F, TGGTTTTTTGAGATTTAAATGTAAGTTAGA and IGFBP3-R, ATCACCCCAATCACTCCTA at 57 °C; SFRP1-F, GGAGTTAGAGATTAGTTTGGTTAATATGG and SFRP1-R, AAAAACCTAAATCATACTTACAACC at 54 °C; and LINE1-F and LINE1-R (assay X58075, Qiagen) at 55 °C. .. PCR reactions were run at 95 °C for 4 min and 45 cycles of 95 °C for 20 s, gene-specific annealing temperature (see above) for 20 s, and 72 °C for 30 s. PCR products were sequenced with the corresponding sequencing primers HHIP-Seq, TTTAGGATTGAGTTTTTGTTTTAAG; IGFBP3-Seq, TTGGGTTATTTAGGTTTTATATAG; and SFRP1-Seq, GGTAAGAGGTTGTAATTTTAGTTAT using PyroMark Gold Q24 reagents (Qiagen).

    Article Title: LOC134466 methylation promotes oncogenesis of endometrial carcinoma through LOC134466/hsa-miR-196a-5p/TAC1 axis
    Article Snippet: Paragraph title: Methylation-Specific PCR (MSP) ... Meanwhile, we performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific).

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: Each PCR reaction incorporated ~20 ng of sodium bisulphite-modified DNA. .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany). .. The cycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 36 cycles of 94°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec, and a final step at 72°C for 5 min. For each set of MS-PCR, human blood lymphocyte DNA treated with bisulfite (Zymo Research Corporation) served as an unmethylated DNA control, and as a positive methylation control, Bisulfite-converted Universal Methylated Human DNA Standard (Zymo Research Corporation) was used.

    Article Title: Epigenetically silenced miR-34b/c as a novel faecal-based screening marker for colorectal cancer
    Article Snippet: Briefly, 2 μ l of bisulfite-converted genomic DNA served as the PCR template. .. The 1 × PCR buffer supplemented with 1.5 m MgCl2 , 0.25 m of each primer, 0.2 μ of dNTPs, 0.1 μ g μ l−1 BSA and 0.25 U of Hot Start Taq polymerase (Applied Biosystems) in a total volume of 20 μ l. Cycling conditions for methylated and unmethylated strand of miR-34b/c were as follows: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. For unmethylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 30 s and extension at 68°C for 30 s, and a final extension at 68°C for 7 min. For methylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. Qiagen's methylated and unmethylated control DNAs served as a reaction control for PCR. .. Faecal DNA was obtained as previously described ( ).

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Article Title: Selective use of multiple vitamin D response elements underlies the 1 ?,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
    Article Snippet: Real-time quantitative PCR was performed in an IQ-cycler (BioRad, Hercules, CA, USA) using the dye SybrGreen I (Molecular Probes, Leiden, The Netherlands). .. Per reaction, 0.3 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 62°C and 40 s at 72°C. .. The sequences of the gene-specific primer pairs for the human CYP24, CYP27B1, METTL1, VDIR and the reference gene RPLP0 are listed in .

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Genotyping for the IL28B rs12979860 C/T polymorphism was performed by a PCR-based restriction fragment length polymorphism assay. .. Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA.

    Article Title: Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor
    Article Snippet: Real-time quantitative PCR was performed in an IQ-cycler (BioRad, Hercules, CA, USA) using the dye SybrGreen I (Molecular Probes, Leiden, The Netherlands). .. Per reaction, 1 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C. .. Fold inductions were calculated using the formula 2−(ΔΔCt) , where ΔΔCt is the ΔCt(stimulus) -ΔCt(solvent) ,ΔCt is Ct(p21 )-Ct(ARP0 ) and Ct is the cycle at which the threshold is crossed.

    Gel Extraction:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. Full length scFvs were amplified by pull-through PCR reaction using Hot start Taq DNA polymerase and forward primer PTFw 5′ CCT TTC TAT GCG GCC CAG CCG GCC ATG GCC 3′ and reverse primers PAK kappa Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC GTT TRA T 3′, and PAK lambda Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC CTA RRA C 3′ (R = G and A).

    Nested PCR:

    Article Title: Frequency of HPV in oral cavity squamous cell carcinoma
    Article Snippet: Paragraph title: Nested PCR using MY09/MY11 and GP5+ /GP6+ primers ... Each sample was amplified with 50 pmol each of the primers MY09 (5’-CGTCCMARRGGAWACTGATC-3′) and MY11 (5’-GCMCAGGGWCATAAYAATGG-3′) in the presence of 6 mM MgCl2 buffer, 200 mmol (each) dATP, dCTP, and dGTP, 600 mmol dUTP, and 7.5 U of Hot Start Taq DNA polymerase (Invitrogen, Waltham, MA, USA).

    Polymorphism Assay:

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Genotyping for the IL28B rs12979860 C/T polymorphism was performed by a PCR-based restriction fragment length polymorphism assay. .. Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA.

    Hot Start PCR:

    Article Title: LOC134466 methylation promotes oncogenesis of endometrial carcinoma through LOC134466/hsa-miR-196a-5p/TAC1 axis
    Article Snippet: Bisulfite-modified DNA was then amplified with two primer sets that differentiate methylated from unmethylated DNA. .. Meanwhile, we performed Hot-start PCR at an annealing temperature of 60 °C using hot-start Taq DNA polymerase (Thermo Fisher Scientific). .. We used TRIzol reagent (Invitrogen, Carlsbad, USA) to extract the total RNA endometrial carcinoma tissues and corresponding healthy tissues.

    Article Title: Genetic diversity and parentage in farmer selections of cacao from Southern Sulawesi, Indonesia revealed by microsatellite markers
    Article Snippet: Primers were synthesized by Proligo (Boulder, CO) and forward primers were 5′-labeled using WellRED fluorescent dyes (Beckman Coulter, Inc., Fullerton, CA). .. PCR was performed as described in , using commercial hot-start PCR SuperMix that had been fortified with an additional 30 U/ml of hot-start Taq DNA polymerase (Invitrogen Platinum Taq , Carlsbad, CA, or Eppendorf HotMaster Taq , Brinkman, Westbury, NY). .. The amplified microsatellite loci were separated by capillary electrophoresis as previously described ( , ).

    Plasmid Preparation:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. The scFvs were resolved on agarose gel and purified using gel extraction kit (Qiagen).

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania). .. Multiplex PCR was also carried out with a multiplexing kit (Qiagen, Hilden, Germany) along with Q-solution following the manufacturer’s instructions.

    Software:

    Article Title: Aquaculture Can Promote the Presence and Spread of Antibiotic-Resistant Enterococci in Marine Sediments
    Article Snippet: For each target gene, several sequences deposited in the NCBI database were converted into FASTA format using the NCBI Genome Workbench software ( http://www.ncbi.nlm.nih.gov/tools/gbench/ ), aligned using the ClustalXII software ( http://www.clustal.org/ ), and the primers were designed on the conserved regions using the NetPrimer software ( http://www.premierbiosoft.com/netprimer/index.html ). .. The PCR cycling program was as follows: 95°C for 10 min, followed by 35 cycles at 94°C for 30 s, 53°C [tet (M), tet (L), tet (O)] or 54°C [erm (B), erm (A), mef ] for 30 s, 72°C for 90 s and final extension at 72°C for 7 min. Each mix contained 600 µM dNTPs, 6 mM MgCl2 , 1× Buffer, 0.5 µM of each primer [1 µM of those targeting tet (M)], and 1.25 U hot-start Taq DNA polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA).

    Article Title: Genetic diversity and parentage in farmer selections of cacao from Southern Sulawesi, Indonesia revealed by microsatellite markers
    Article Snippet: PCR was performed as described in , using commercial hot-start PCR SuperMix that had been fortified with an additional 30 U/ml of hot-start Taq DNA polymerase (Invitrogen Platinum Taq , Carlsbad, CA, or Eppendorf HotMaster Taq , Brinkman, Westbury, NY). .. The amplified microsatellite loci were separated by capillary electrophoresis as previously described ( , ).

    Electrophoresis:

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA. .. The thermal protocol for amplification included 35 cycles of denaturation at 95 °C for 60 s, annealing at 62 °C for 60 s, and elongation at 72 °C for 60 s. Ten microliters of the amplicons were digested with 1 unit Bst UI (New England Biolabs, Hitchin, UK) in a total volume of 20 μL at 37 °C overnight.

    RNA Extraction:

    Article Title: Selective use of multiple vitamin D response elements underlies the 1 ?,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
    Article Snippet: Paragraph title: Total RNA extraction, cDNA synthesis and real-time PCR ... Per reaction, 0.3 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 62°C and 40 s at 72°C.

    Article Title: Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor
    Article Snippet: Paragraph title: RNA extraction and real-time quantitative RT–PCR ... Per reaction, 1 U Hot Start Taq polymerase (Fermentas) and 3 mM MgCl2 were used and the PCR cycling conditions were: 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Recombinant:

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: A pediatric anti-HIV-1 subtype C scFv recombinant phage library was constructed as described previously ( , , , ) with a few modifications. .. For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA).

    Agarose Gel Electrophoresis:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C. .. For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Article Title: CD4-Binding Site Directed Cross-Neutralizing scFv Monoclonals from HIV-1 Subtype C Infected Indian Children
    Article Snippet: For construction of scFv, the heavy chain and light chain variable region genes were amplified using specific primers (IDT) (Table S2 in Supplementary Material) ( ) and hot start Taq DNA polymerase (Fermentas, USA). .. Full length scFvs were amplified by pull-through PCR reaction using Hot start Taq DNA polymerase and forward primer PTFw 5′ CCT TTC TAT GCG GCC CAG CCG GCC ATG GCC 3′ and reverse primers PAK kappa Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC GTT TRA T 3′, and PAK lambda Sfi 5′ TCA GCA TGG CCC CCG AGG CCG CAC CTA RRA C 3′ (R = G and A).

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania). .. Multiplex PCR was also carried out with a multiplexing kit (Qiagen, Hilden, Germany) along with Q-solution following the manufacturer’s instructions.

    In Vitro:

    Article Title: Overexpression of UHRF1 promotes silencing of tumor suppressor genes and predicts outcome in hepatoblastoma
    Article Snippet: As a control for MSP, we used in vitro methylated genomic DNA that has been treated for 4 h with 40 U CpG methyltransferase (M. SssI), NEBuffer2 (10×), and SAM (1:20) at 37 °C, followed by heat inactivation for 20 min at 65 °C. .. For MSP, we used 1 U hot start Taq polymerase (Thermo Scientific, Schwerte, Germany), 1× hot start Taq buffer, 2 mM dNTPs, 1.5 mM MgCl2 , 100 ng bisulfite-treated DNA, and 500 nM of the following forward and reverse primers (5′– > 3′ orientation) and annealing temperatures: HHIP-M-F, AGTAGTCGGGTATGTTCGGAATTTTC and HHIP-M-R, GAACCTTCGAAACCAACCTCG at 53 °C; IGFBP3-M-F, GCGAGTTTCGAGTTGTACGTTTTC and IGFBP3-M-R, GCCGACCGCTATATAAAAACCG at 61 °C; SFRP1-M-F, TTTGTAGTTTTCGGAGTTAGTGTCGC and SFRP1-M-R, CGACCCTCGACCTACGATCG at 58 °C; HHIP-U-F, TTGTAGTAGTTGGGTAGTTTTGGAATTTTT and HHIP-U-R, AAACCTTAAAACCAACCTCAAAA at 53 °C; IGFBP3-U-F, TTGGGTGAGTTTTGAGTTGTATGTTTTT and IGFBP3-U-R, AAACACACCAACCACTATATAAAAACCAAA at 61 °C; and SFRP1-U-F, TTTTGTAGTTTTTGGAGTTAGTGTTGTGTG and SFRP1-U-R, CAATAACAACCCTCAACCTACAATCAA at 58 °C.

    Concentration Assay:

    Article Title: Epigenetically silenced miR-34b/c as a novel faecal-based screening marker for colorectal cancer
    Article Snippet: Finally, the converted DNA was re-suspended in 40 μ l distiled water to a final concentration of 25–30 ng μ l−1 . .. The 1 × PCR buffer supplemented with 1.5 m MgCl2 , 0.25 m of each primer, 0.2 μ of dNTPs, 0.1 μ g μ l−1 BSA and 0.25 U of Hot Start Taq polymerase (Applied Biosystems) in a total volume of 20 μ l. Cycling conditions for methylated and unmethylated strand of miR-34b/c were as follows: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. For unmethylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 30 s and extension at 68°C for 30 s, and a final extension at 68°C for 7 min. For methylated strand of miR-148a: preheating at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s and extension at 72°C for 30 s, and a final extension at 72°C for 7 min. Qiagen's methylated and unmethylated control DNAs served as a reaction control for PCR.

    Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
    Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

    Staining:

    Article Title: Impact of Interleukin 28B Genotype on the Virological Responses in Chronic Hepatitis C Treatment
    Article Snippet: Amplification was performed in a total volume of 50 μL containing 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 0.01% Tween-20, 0.2 mmol/L deoxyribonucleotides, 2 - 4 pmol of each primer, 2.0 mmol/L MgCl2 , 0.5 units hot-start Taq DNA polymerase (Thermo Taq, Thermo Scientific, Pittsburgh, PA, USA), and approximately 10 ng of genomic DNA. .. The thermal protocol for amplification included 35 cycles of denaturation at 95 °C for 60 s, annealing at 62 °C for 60 s, and elongation at 72 °C for 60 s. Ten microliters of the amplicons were digested with 1 unit Bst UI (New England Biolabs, Hitchin, UK) in a total volume of 20 μL at 37 °C overnight.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher maxma hot start taq dna polymerase
    Comparison of different concentrations of <t>Taq</t> -polymerase in PCR with Amplifluor-like SNP markers for ‘trouble-shooting’ of allele discrimination. The identicial PCR protocol was applied with the same <t>DNA</t> samples from a wheat collection from Kazakhstan and the same marker W58, using 0.5 units ( a ) or 0.1 units ( b ) of Maxima Hot-start Taq -polymerase (ThermoFisher, USA). X- and Y-axes show Relative amplification units, ΔRn, for FAM and VIC fluorescence signals, respectively, as determined by the qPCR instrument
    Maxma Hot Start Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxma hot start taq dna polymerase/product/Thermo Fisher
    Average 97 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    maxma hot start taq dna polymerase - by Bioz Stars, 2019-12
    97/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of different concentrations of Taq -polymerase in PCR with Amplifluor-like SNP markers for ‘trouble-shooting’ of allele discrimination. The identicial PCR protocol was applied with the same DNA samples from a wheat collection from Kazakhstan and the same marker W58, using 0.5 units ( a ) or 0.1 units ( b ) of Maxima Hot-start Taq -polymerase (ThermoFisher, USA). X- and Y-axes show Relative amplification units, ΔRn, for FAM and VIC fluorescence signals, respectively, as determined by the qPCR instrument

    Journal: BMC Plant Biology

    Article Title: Advantages of Amplifluor-like SNP markers over KASP in plant genotyping

    doi: 10.1186/s12870-017-1197-x

    Figure Lengend Snippet: Comparison of different concentrations of Taq -polymerase in PCR with Amplifluor-like SNP markers for ‘trouble-shooting’ of allele discrimination. The identicial PCR protocol was applied with the same DNA samples from a wheat collection from Kazakhstan and the same marker W58, using 0.5 units ( a ) or 0.1 units ( b ) of Maxima Hot-start Taq -polymerase (ThermoFisher, USA). X- and Y-axes show Relative amplification units, ΔRn, for FAM and VIC fluorescence signals, respectively, as determined by the qPCR instrument

    Article Snippet: The PCR cocktail contained 2 x Master-mix with the following reagents in final concentrations: 1 x PCR Buffer, 1.8 mM MgCl2 , 0.2 mM each of dNTPs, 0.25 μM each fluorescent label probe, 0.15 μM of each forward primer, 0.78 μM of reverse primer and 0.5 units of Taq DNA polymerase (GenLab, Astana, Kazakhstan) or 0.1 units of Maxima Hot-Start Taq -polymerase (ThermoFisher, USA).

    Techniques: Polymerase Chain Reaction, Marker, Amplification, Fluorescence, Real-time Polymerase Chain Reaction