hot start taq polymerase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HotStarTaq Plus DNA Polymerase
    Description:
    For fast and highly specific amplification in all applications. Kit contents: Qiagen HotStarTaq Plus DNA Polymerase, 50U, 5U/L, 10 min. at 97C. 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, 5' -> 3' Exonuclease Enzyme Activity, Genomic DNA and cDNA Sample, PCR Amplification Reaction, Ready-to-load PCR Buffer, Ideal for Fast and Highly Specific Amplification, Includes 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2. Benefits: High PCR specificity with minimal optimization. Fast 5-minute enzyme activation time. Ready-to-load PCR buffer for faster and easier handling
    Catalog Number:
    203601
    Price:
    None
    Category:
    HotStarTaq Plus DNA Polymerase
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen hot start taq polymerase
    HotStarTaq Plus DNA Polymerase
    For fast and highly specific amplification in all applications. Kit contents: Qiagen HotStarTaq Plus DNA Polymerase, 50U, 5U/L, 10 min. at 97C. 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, 5' -> 3' Exonuclease Enzyme Activity, Genomic DNA and cDNA Sample, PCR Amplification Reaction, Ready-to-load PCR Buffer, Ideal for Fast and Highly Specific Amplification, Includes 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2. Benefits: High PCR specificity with minimal optimization. Fast 5-minute enzyme activation time. Ready-to-load PCR buffer for faster and easier handling
    https://www.bioz.com/result/hot start taq polymerase/product/Qiagen
    Average 99 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    hot start taq polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: Paragraph title: Single-B-cell RT-PCR, sequencing, and cloning. ... The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and direct sequencing of amplicons. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The Vent DNA polymerase kit (New England BioLabs), which contains high-fidelity thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA.

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: The 3’ primer consisted of a set of single antisense α or β constant primers V-region cDNA was generated from RNA from T-cell clones using an outside primer set and the following amplification cocktail: 5μl 2X Super Script III/ Platinum Taq buffer (cat # 11753-100, ThermoFisher Scientific), 5μl of the 2.5μM (total primer concentration) α/β 5’-3’ outside primer mix, 0.1 μl SUPERase inhibitor (cat # AM2694, ThermoFisher Scientific), 0.1 μl RNAse OUT (cat # 10777019, ThermoFisher Scientific), 1 μl Super Script III/ Platinum Taq, 1.4-X μl cell PCR grade water, and cells for a final volume of 10 μl. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program.

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: Paragraph title: Cloning and Expression of Kirromycin ACP’s ... The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in .

    Article Title: Studies of the Genetics, Function, and Kinetic Mechanism of TagE, the Wall Teichoic Acid Glycosyltransferase in Bacillus subtili
    Article Snippet: HotStar TaqPCR reagents, gel extraction, and plasmid miniprep kits were purchased from Qiagen (Mississauga, Canada). .. Vent polymerase was obtained from New England Biolabs (Beverly, MA), the Expand PCR system was purchased from Roche Applied Science, and the GatewayTM cloning system was from Invitrogen.

    Amplification:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: An approximately 689 bp partial fragment of the mitochondrial cytochrome c oxidase subunit 1 gene (cox 1) was amplified with the primer pair NTF (5'-TGA TTG GTG GTT TTG GTA A-3') and NTR (5'-ATA AGT ACG AGT ATC AAT ATC-3') [ ]. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Total RNA was isolated from co-cultures (day 6 after seeding) using Total RNA Isolation Reagent according to the manufacturers protocol (ABgene, Epsom, United Kingdom). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR was run for 36 cycles with 60 s annealing, 60 s extension, and 30 s denaturation.

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Reverse primers VR1bio (5′-bio-TAGACTTCTGGGTGGCCAAAGAATCA-3′), VR1dbio (5′-bio-TAGACTTCTGGGTGGCCRAARAAYCA-3′) and VR1ibio (5′-bio-TAGACTTCTGGGTGICCIAAIAAICA-3′) were biotinylated and mixed at the same ratio 1 VR1bio: 1 VR1dbio: 2 VR1ibio. .. Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA). .. Each reaction contained 2.5 μl 10X buffer with MgCl2 , 50 μM of each dATP, dTTP, dCTP and dGTP, 0.4 μM each primer mix, 1 μl PCR product from the previous reaction, 0.5 U polymerase, and ddH2 O to total 25 μl.

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: DNA quantity and quality were analyzed with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). .. Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. Each PCR reaction mix (Qiagen) contained 200 µM dNTPs, 200 nM primers, 1× PCR buffer (1.5 mM MgCl2 , pH 8.7), 1× Q-Solution (Qiagen), 2.5 units polymerase, and 100 ng of template DNA in a final volume of 50 µl.

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: After RT, 25 μl water was added to each well to dilute the cDNA, and the cDNA plates were stored at −20°C. .. The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ). .. The cycler parameters were 94°C for 5 min, 50 cycles of 94°C for 30 s, 52 to 55°C for 30 s, and 72°C for 1 min, followed by 72°C for 10 min.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and direct sequencing of amplicons. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The Vent DNA polymerase kit (New England BioLabs), which contains high-fidelity thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA.

    Article Title: A Newly Emerging HIV-1 Recombinant Lineage (CRF58_01B) Disseminating among People Who Inject Drugs in Malaysia
    Article Snippet: Paragraph title: Study Subjects and HIV-1 near Full Length Genome Amplification ... Nested PCR was performed using QIAGEN HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany) to amplify 10 overlapping fragments corresponding to the near full length HIV-1 genome using primers listed in .

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Paragraph title: PCR amplification of the triosephosphate isomerase gene ... 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: First strand DNA was synthesized with m-MLV Reverse Transcriptase (Promega, ABC, DEF) from 2.5 µg of total RNA. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment. .. PCR conditions were: 5 min 95°C; 32x: 30 sec 98°C, 30 sec 58°C, 1 min 72°C; 10 min 71°C.

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: Reactions were carried out in a thermocycler using a single tube RT-PCR program (50°C, 15 min; 19 cycles: 95°C, 15 s; 60°C, 4 min; then 4°C hold. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program. .. Products were purified and cloned using the Topo-XL cloning kit (cat. # K4750-20, ThermoFisher Scientific) and sequenced to obtain the CDR3 sequences for both α and β chains.

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: All primer sequences will be supplied by the corresponding author upon request. .. PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.). .. Purified RT-PCR products were prepared for 454 amplicon sequencing by use of GS FLX Titanium Rapid Library Preparation Kit (Roche) and RL-MID tags (Roche) to allow multiplexed sequencing.

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: Analytical HPLC was performed on a Varian ProStar system. .. The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in . .. Fragments were cloned in pET30Ek/LIC (Novagen/Merck Millipore) using the manufacturer’s protocol.

    Article Title: Rapid evolution of mouse Y centromere repeat DNA belies recent sequence stability
    Article Snippet: Paragraph title: PCR amplification of Ymin ... HotStar polymerase (QIAGEN) or Expand Long Template PCR System (Roche) were used for all PCR reactions.

    Positive Control:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    Synthesized:

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: First strand DNA was synthesized with m-MLV Reverse Transcriptase (Promega, ABC, DEF) from 2.5 µg of total RNA. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Quantitative RT-PCR:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Mouse anti hTransferrin Receptor antibody and Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR were from Invitrogen (Taastrup, Denmark). .. HotStarTaq Plus DNA Polymerase was from Qiagen (Copenhagen, Denmark).

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Total RNA was isolated from co-cultures (day 6 after seeding) using Total RNA Isolation Reagent according to the manufacturers protocol (ABgene, Epsom, United Kingdom). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR was run for 36 cycles with 60 s annealing, 60 s extension, and 30 s denaturation.

    SYBR Green Assay:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The program Geneious (version 5.3.6; Biomatters Ltd., Auckland, New Zealand) was used to concatenate and align the remaining sequences and to identify sites for PCR primer design. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.). .. Selected PCR primers were tested for specificity against genomic DNA from 22 type strains within the order Campylobacterales , including Arcobacter spp. (i.e., A. butzleri , A. cryaerophilus , and A. skirrowii ), Campylobacter spp. (i.e., Campylobacter coli , C. concisus , C. curvus , Campylobacter fetus subsp. fetus , C. hominis , C. hyointestinalis subsp. hyointestinalis , C. insulaenigrae , C. jejuni , C. jejuni subsp. doylei , C. lanienae , C. lari , C. mucosalis , C. showae , C. sputorum subsp. sputorum , and C. upsaliensis ), and Helicobacter spp. (i.e., H. canadensis , H. pullorum , and H. pylori ).

    Incubation:

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: Briefly, frozen plates with single B-cell RNAs were thawed at room temperature, and RT was carried out by adding to each well 3 μl random hexamers at 150 ng/μl (Gene Link, Hawthorne, NY), 2 μl dNTPs (each at 10 mM), and 1 μl SuperScript II (Invitrogen), followed by incubation at 42°C for 2 h. We note that these RT parameters may be suboptimal compared to those described previously ( , ). .. The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: 2 μl of DNA template were used and the prepared master mix was incubated in the Eppendorf Pro-S thermal cycler (Hamburg, Germany) under the following conditions: initial hot start at 95°C for 5 min, 35 amplification cycles at 94°C for 45 s, 50°C for 45 s (58°C for secondary PCR), 72°C for 60 s and a final extension at 72°C for 10 min. .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in . .. A single colony was then used to inoculate 3 mL of LB (Luria Burtani) medium containing 34 μg/mL chloramphenicol and 50 μg/mL kanamycin which was cultured overnight at 37 °C with shaking at 250 rpm.

    Activity Assay:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark).

    In Silico:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: Paragraph title: Primer design and in silico evaluation. ... Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.).

    Expressing:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR products were run in 1.5% agarose gels and visualized using Midori Green DNA stain (5 μl/100 ml gel) and a fluorchemQ image station (Alpha Innotech/Cell Biosciences, Santa Clara, CA, USA).

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: From each sorted cell, the variable regions of IgG heavy and light chains were amplified by RT-PCR and cloned into expression vectors as previously described ( ). .. The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: Paragraph title: Cloning and Expression of Kirromycin ACP’s ... The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in .

    Transformation Assay:

    Article Title: Studies of the Genetics, Function, and Kinetic Mechanism of TagE, the Wall Teichoic Acid Glycosyltransferase in Bacillus subtili
    Article Snippet: HotStar TaqPCR reagents, gel extraction, and plasmid miniprep kits were purchased from Qiagen (Mississauga, Canada). .. Cloning was performed in the E. coli strain Novablue (Novagen, Madison, WI) according to established protocols ( ).

    Countercurrent Chromatography:

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Presence of mixed infection was detected by visualizing the occurrence of bands in the agarose gel at 332-bp for assemblage A amplified using primers AssAF (5′-CGC CGT ACA CCT GTC-3′) and AssAR (5′-AGC AAT GAC AAC CTC CTT CC-3′) and at 400-bp for assemblage B amplified using primers AssBF (5′-GTT GTT GTT GCT CCC TCC TTT-3′) and AssBR (5′-CCG GCT CAT AGG CAA TTA CA-3′). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    RAST Test:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The RAST ( ) and BLAST ( ) tools were also used to compare the A. butzleri genomic sequences to those of four Arcobacter skirrowii (PRJNA307998) and six Arcobacter cryaerophilus (PRJNA307600) strains that were sequenced as part of the current project; any A. butzleri ORFs that were detected in A. skirrowii or A. cryaerophilus were removed from consideration. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.).

    Concentration Assay:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: An approximately 689 bp partial fragment of the mitochondrial cytochrome c oxidase subunit 1 gene (cox 1) was amplified with the primer pair NTF (5'-TGA TTG GTG GTT TTG GTA A-3') and NTR (5'-ATA AGT ACG AGT ATC AAT ATC-3') [ ]. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. Final extension was performed at 72 °C for 10 min.

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark).

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: RNA concentration was determined by spectroscopy (NanoDrop, Witec, Luzern, Switzerland). .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: Reactions were carried out in a thermocycler using a single tube RT-PCR program (50°C, 15 min; 19 cycles: 95°C, 15 s; 60°C, 4 min; then 4°C hold. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program. .. Products were purified and cloned using the Topo-XL cloning kit (cat. # K4750-20, ThermoFisher Scientific) and sequenced to obtain the CDR3 sequences for both α and β chains.

    Article Title: Studies of the Genetics, Function, and Kinetic Mechanism of TagE, the Wall Teichoic Acid Glycosyltransferase in Bacillus subtili
    Article Snippet: Ampicillin was used at a concentration of 50 μg/ml ( E. coli ), whereas spectinomycin was used at a concentration of 150 μg/ml ( B. subtilis ). .. HotStar TaqPCR reagents, gel extraction, and plasmid miniprep kits were purchased from Qiagen (Mississauga, Canada).

    Genomic Sequencing:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The RAST ( ) and BLAST ( ) tools were also used to compare the A. butzleri genomic sequences to those of four Arcobacter skirrowii (PRJNA307998) and six Arcobacter cryaerophilus (PRJNA307600) strains that were sequenced as part of the current project; any A. butzleri ORFs that were detected in A. skirrowii or A. cryaerophilus were removed from consideration. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.).

    Infection:

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Presence of mixed infection was detected by visualizing the occurrence of bands in the agarose gel at 332-bp for assemblage A amplified using primers AssAF (5′-CGC CGT ACA CCT GTC-3′) and AssAR (5′-AGC AAT GAC AAC CTC CTT CC-3′) and at 400-bp for assemblage B amplified using primers AssBF (5′-GTT GTT GTT GCT CCC TCC TTT-3′) and AssBR (5′-CCG GCT CAT AGG CAA TTA CA-3′). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Light Microscopy:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Generated:

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: The 3’ primer consisted of a set of single antisense α or β constant primers V-region cDNA was generated from RNA from T-cell clones using an outside primer set and the following amplification cocktail: 5μl 2X Super Script III/ Platinum Taq buffer (cat # 11753-100, ThermoFisher Scientific), 5μl of the 2.5μM (total primer concentration) α/β 5’-3’ outside primer mix, 0.1 μl SUPERase inhibitor (cat # AM2694, ThermoFisher Scientific), 0.1 μl RNAse OUT (cat # 10777019, ThermoFisher Scientific), 1 μl Super Script III/ Platinum Taq, 1.4-X μl cell PCR grade water, and cells for a final volume of 10 μl. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program.

    Polymerase Chain Reaction:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: An approximately 689 bp partial fragment of the mitochondrial cytochrome c oxidase subunit 1 gene (cox 1) was amplified with the primer pair NTF (5'-TGA TTG GTG GTT TTG GTA A-3') and NTR (5'-ATA AGT ACG AGT ATC AAT ATC-3') [ ]. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. Final extension was performed at 72 °C for 10 min.

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Total RNA was isolated from co-cultures (day 6 after seeding) using Total RNA Isolation Reagent according to the manufacturers protocol (ABgene, Epsom, United Kingdom). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR was run for 36 cycles with 60 s annealing, 60 s extension, and 30 s denaturation.

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Cycling parameters were as follows: 94°C for 5 min; 25 cycles of 94°C for 30s, 61°C for 20s, 72°C for 2 min 30s; and 72° for 5 min. For the second step of the nested PCR , previously published primers and protocols ( ; ) were used to amplify the 658bp barcoding region of COI , using the first PCR amplicon as template. .. Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA).

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: DNA quantity and quality were analyzed with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). .. Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. Each PCR reaction mix (Qiagen) contained 200 µM dNTPs, 200 nM primers, 1× PCR buffer (1.5 mM MgCl2 , pH 8.7), 1× Q-Solution (Qiagen), 2.5 units polymerase, and 100 ng of template DNA in a final volume of 50 µl.

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The program Geneious (version 5.3.6; Biomatters Ltd., Auckland, New Zealand) was used to concatenate and align the remaining sequences and to identify sites for PCR primer design. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.).

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ). .. The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Comparison of two commercial carbapenemase gene confirmatory assays in multiresistant Enterobacteriaceae and Acinetobacter baumannii-complex
    Article Snippet: PCR was performed in a Labcycler (SensoQuest, Göttingen, Germany). .. For each reaction, 25 μl reaction mixture consisted of 15 μl Primer Nucleotide Mix (PN-Mix Carba), 2.5 μl 10x polymerase buffer (Qiagen, Hilden, Germany), 2 μl UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific, Waltham, USA), 0.5 μl (= 2.5 units) HotStarTaq Plus DNA Polymerase (Qiagen, Hilden, Germany) and 5 μl sample DNA.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and direct sequencing of amplicons. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The Vent DNA polymerase kit (New England BioLabs), which contains high-fidelity thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA.

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: The PCR reaction mix consisted of 0.2 μM (0.4 μM for assemblage B) of each primer (Bio Basic Canada Inc). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl. .. 1 μl of DNA template was added for assemblage A and 2 μl was added for assemblage B for the PCR amplifications following the cycle parameter: initial hot start at 95°C for 5 min, initial denaturation at 94°C for 10 min and 35 amplification cycles at 94°C for 45 s, 64°C for 45 s (62°C for secondary PCR) and 72°C for 45 s. In all the PCR reactions, a Giardia -positive DNA sample and distilled water were used as a positive and negative control.

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: Reactions were carried out in a thermocycler using a single tube RT-PCR program (50°C, 15 min; 19 cycles: 95°C, 15 s; 60°C, 4 min; then 4°C hold. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program. .. Products were purified and cloned using the Topo-XL cloning kit (cat. # K4750-20, ThermoFisher Scientific) and sequenced to obtain the CDR3 sequences for both α and β chains.

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: All primer sequences will be supplied by the corresponding author upon request. .. PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.). .. Purified RT-PCR products were prepared for 454 amplicon sequencing by use of GS FLX Titanium Rapid Library Preparation Kit (Roche) and RL-MID tags (Roche) to allow multiplexed sequencing.

    Article Title: Rapid evolution of mouse Y centromere repeat DNA belies recent sequence stability
    Article Snippet: PCR amplification of M.m. domesticus Ymin HOR was also undertaken using forward primer, decoF1 5′-CACAGTGTAGAACACCGTAC-3′; reverse primer, decoR1 5′-CGTTTCTCATTATATATGTTTTTCTTC-3′. .. HotStar polymerase (QIAGEN) or Expand Long Template PCR System (Roche) were used for all PCR reactions. .. BAC 110P17 DNA was purified using a QIAGEN Maxi Prep kit, 2 μg digested with 20 U of EcoRI (Roche), and the fragments separated by electrophoresis on a 0.8% agarose gel.

    Article Title: Novel Coronavirus and Astrovirus in Delaware Bay Shorebirds
    Article Snippet: After primer and adaptor trimming, length filtering, masking of low complexity regions and subtraction of ribosomal and host sequences, sequence reads were assembled using Newbler Assembler (v 2.3, 454 Life Sciences) and analyzed at nucleotide (nt) and amino acid (aa) level by using homology search programs Blastn and Fastx against NCBI Refseq and GenBank databases ( http://www.ncbi.nlm.nih.gov ). .. Sequence-specific PCR was conducted with HotStar polymerase (Qiagen) and random hexamer-primed cDNA (Superscript II, Invitrogen). .. Amplified products were subjected to direct dideoxy sequencing (Genewiz, South Plainfield, NJ, USA).

    Negative Control:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Sequencing:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. Each PCR reaction mix (Qiagen) contained 200 µM dNTPs, 200 nM primers, 1× PCR buffer (1.5 mM MgCl2 , pH 8.7), 1× Q-Solution (Qiagen), 2.5 units polymerase, and 100 ng of template DNA in a final volume of 50 µl.

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The Basic Local Alignment Search Tool (BLAST) ( ) and a program developed in-house (Concatenator) were used to compare ORFs between A. butzleri strains; those that were redundant or missing from any strains or that varied in terms of their length or sequence were removed from consideration. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.).

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: Paragraph title: Single-B-cell RT-PCR, sequencing, and cloning. ... The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and direct sequencing of amplicons. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The Vent DNA polymerase kit (New England BioLabs), which contains high-fidelity thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA.

    Article Title: A Newly Emerging HIV-1 Recombinant Lineage (CRF58_01B) Disseminating among People Who Inject Drugs in Malaysia
    Article Snippet: All six study subjects were recruited during a molecular epidemiological study conducted during 2009–2011 among inmates of a prison and attendees of a needle syringe exchange program (n = 258) in Kuala Lumpur, Malaysia based on initial HIV-1 gag -RT genes amplification and sequencing. .. Nested PCR was performed using QIAGEN HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany) to amplify 10 overlapping fragments corresponding to the near full length HIV-1 genome using primers listed in .

    Article Title: Novel Coronavirus and Astrovirus in Delaware Bay Shorebirds
    Article Snippet: After primer and adaptor trimming, length filtering, masking of low complexity regions and subtraction of ribosomal and host sequences, sequence reads were assembled using Newbler Assembler (v 2.3, 454 Life Sciences) and analyzed at nucleotide (nt) and amino acid (aa) level by using homology search programs Blastn and Fastx against NCBI Refseq and GenBank databases ( http://www.ncbi.nlm.nih.gov ). .. Sequence-specific PCR was conducted with HotStar polymerase (Qiagen) and random hexamer-primed cDNA (Superscript II, Invitrogen). .. Amplified products were subjected to direct dideoxy sequencing (Genewiz, South Plainfield, NJ, USA).

    Cellular Antioxidant Activity Assay:

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Presence of mixed infection was detected by visualizing the occurrence of bands in the agarose gel at 332-bp for assemblage A amplified using primers AssAF (5′-CGC CGT ACA CCT GTC-3′) and AssAR (5′-AGC AAT GAC AAC CTC CTT CC-3′) and at 400-bp for assemblage B amplified using primers AssBF (5′-GTT GTT GTT GCT CCC TCC TTT-3′) and AssBR (5′-CCG GCT CAT AGG CAA TTA CA-3′). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Molecular Weight:

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: High molecular weight RNA (≥ 200 nt.) was purified using the MirVana kit (Ambion). .. PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.).

    DNA Extraction:

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: DNA was extracted from peripheral blood leukocytes using Roche’s DNA Isolation Kit for Mammalian Blood (Indianapolis, IN, USA). .. Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc).

    Article Title: Comparison of two commercial carbapenemase gene confirmatory assays in multiresistant Enterobacteriaceae and Acinetobacter baumannii-complex
    Article Snippet: The undiluted cell suspensions were subjected to automated DNA extraction by MagNAPure 96 (Roche Diagnostics, Mannheim, Germany). .. For each reaction, 25 μl reaction mixture consisted of 15 μl Primer Nucleotide Mix (PN-Mix Carba), 2.5 μl 10x polymerase buffer (Qiagen, Hilden, Germany), 2 μl UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific, Waltham, USA), 0.5 μl (= 2.5 units) HotStarTaq Plus DNA Polymerase (Qiagen, Hilden, Germany) and 5 μl sample DNA.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: Paragraph title: DNA extraction, PCR amplification, and sequencing of amplicons. ... The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    Nucleic Acid Electrophoresis:

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and direct sequencing of amplicons. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    Real-time Polymerase Chain Reaction:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The program Geneious (version 5.3.6; Biomatters Ltd., Auckland, New Zealand) was used to concatenate and align the remaining sequences and to identify sites for PCR primer design. .. Primers for endpoint and qPCR were designed for optimal use with HotStarTaq Plus DNA polymerase (Qiagen Inc., Toronto, ON, Canada) and QuantiTect SYBR green (Qiagen Inc.). .. Selected PCR primers were tested for specificity against genomic DNA from 22 type strains within the order Campylobacterales , including Arcobacter spp. (i.e., A. butzleri , A. cryaerophilus , and A. skirrowii ), Campylobacter spp. (i.e., Campylobacter coli , C. concisus , C. curvus , Campylobacter fetus subsp. fetus , C. hominis , C. hyointestinalis subsp. hyointestinalis , C. insulaenigrae , C. jejuni , C. jejuni subsp. doylei , C. lanienae , C. lari , C. mucosalis , C. showae , C. sputorum subsp. sputorum , and C. upsaliensis ), and Helicobacter spp. (i.e., H. canadensis , H. pullorum , and H. pylori ).

    Isolation:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Total RNA was isolated from co-cultures (day 6 after seeding) using Total RNA Isolation Reagent according to the manufacturers protocol (ABgene, Epsom, United Kingdom). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR was run for 36 cycles with 60 s annealing, 60 s extension, and 30 s denaturation.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The Vent DNA polymerase kit (New England BioLabs), which contains high-fidelity thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA.

    RNA Extraction:

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: Paragraph title: RNA Extraction and RT-PCR ... PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.).

    Purification:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. PCR products were electrophoresed in 1.5% agarose gel and visualized under UV-light.

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. Each PCR reaction mix (Qiagen) contained 200 µM dNTPs, 200 nM primers, 1× PCR buffer (1.5 mM MgCl2 , pH 8.7), 1× Q-Solution (Qiagen), 2.5 units polymerase, and 100 ng of template DNA in a final volume of 50 µl.

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: All primer sequences will be supplied by the corresponding author upon request. .. PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.). .. Purified RT-PCR products were prepared for 454 amplicon sequencing by use of GS FLX Titanium Rapid Library Preparation Kit (Roche) and RL-MID tags (Roche) to allow multiplexed sequencing.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: Paragraph title: Single-B-cell RT-PCR, sequencing, and cloning. ... The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ).

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: Paragraph title: RT PCR ... The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Article Title: T-cell responses to KSHV infection: a systematic approach
    Article Snippet: Reactions were carried out in a thermocycler using a single tube RT-PCR program (50°C, 15 min; 19 cycles: 95°C, 15 s; 60°C, 4 min; then 4°C hold. .. The cDNA was then diluted 1:1 with PCR grade water and then used in two separate 2nd round PCR reactions using either the α or β inside nested primer set using the following amplification cocktail: 4.5μl first round RT-PCR reaction, 2.5μl 10X HotStar Taq buffer (cat # 203605, Qiagen), 0.5 μl dNTP (cat. #, Bio-39053 Bioline), 5μl 5X Q solution (Qiagen), 1.5 μl each of both the 10 μM (total primer concentration) α or β 5’ inside primer and α or β 3’ inside primer mix, 0.17 μl HotStar Taq (cat # 203605, Qiagen), and 9.3 μl water for a final volume of 25 μl. and amplified with a 95°C, 15 s; 51 cycles: 94°C, 15 s; 50°C, 30 s, 72°C, 60 s; 72°C, 10 min, then 4°C hold thermocycler program. .. Products were purified and cloned using the Topo-XL cloning kit (cat. # K4750-20, ThermoFisher Scientific) and sequenced to obtain the CDR3 sequences for both α and β chains.

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: Paragraph title: RNA Extraction and RT-PCR ... PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.).

    Cell Culture:

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: HMEC-1 cells were plated in a 25 cm2 cell culture flask and grown to confluency. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in . .. Plasmids harboring each kirromycin ACP were co-transformed with plasmid pSU20-Sfp into E. coli BL21(DE3).

    Spectroscopy:

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: RNA concentration was determined by spectroscopy (NanoDrop, Witec, Luzern, Switzerland). .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Gel Extraction:

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. Each PCR reaction mix (Qiagen) contained 200 µM dNTPs, 200 nM primers, 1× PCR buffer (1.5 mM MgCl2 , pH 8.7), 1× Q-Solution (Qiagen), 2.5 units polymerase, and 100 ng of template DNA in a final volume of 50 µl.

    Article Title: Spatio-temporal regulation of ADAR editing during development in porcine neural tissues
    Article Snippet: All primer sequences will be supplied by the corresponding author upon request. .. PCR amplification using primers against A-to-I editing regions of the mRNAs listed in was done using HotStarTaq Plus (Qiagen) and products were purified using Ultra-Sep Gel Extraction Kit (E.Z.N.A.). .. Purified RT-PCR products were prepared for 454 amplicon sequencing by use of GS FLX Titanium Rapid Library Preparation Kit (Roche) and RL-MID tags (Roche) to allow multiplexed sequencing.

    Article Title: Studies of the Genetics, Function, and Kinetic Mechanism of TagE, the Wall Teichoic Acid Glycosyltransferase in Bacillus subtili
    Article Snippet: Ampicillin was used at a concentration of 50 μg/ml ( E. coli ), whereas spectinomycin was used at a concentration of 150 μg/ml ( B. subtilis ). .. HotStar TaqPCR reagents, gel extraction, and plasmid miniprep kits were purchased from Qiagen (Mississauga, Canada). .. Vent polymerase was obtained from New England Biolabs (Beverly, MA), the Expand PCR system was purchased from Roche Applied Science, and the GatewayTM cloning system was from Invitrogen.

    Nested PCR:

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Paragraph title: Nested PCR ... Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA).

    Article Title: Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
    Article Snippet: After RT, 25 μl water was added to each well to dilute the cDNA, and the cDNA plates were stored at −20°C. .. The IgG heavy and light chain variable regions were amplified independently by nested PCR in 50 μl volumes, using 5 μl cDNA as the template, with HotStarTaq Plus DNA polymerase (Qiagen) and primer mixtures described previously ( , ). .. The cycler parameters were 94°C for 5 min, 50 cycles of 94°C for 30 s, 52 to 55°C for 30 s, and 72°C for 1 min, followed by 72°C for 10 min.

    Article Title: A Newly Emerging HIV-1 Recombinant Lineage (CRF58_01B) Disseminating among People Who Inject Drugs in Malaysia
    Article Snippet: HIV-1 Viral RNA was extracted from plasma samples using the NucliSENS easyMAG automated platform (bioMerieux, Durham, North Carolina, USA) according to the manufacturer's recommendation and reverse transcribed into cDNA using SuperScript III RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, California, USA) and random hexamers (Applied Biosystems, USA) according to the manufacturer's instructions. .. Nested PCR was performed using QIAGEN HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany) to amplify 10 overlapping fragments corresponding to the near full length HIV-1 genome using primers listed in . .. Purified PCR products were directly sequenced using ABI PRISM 3730XL DNA Analyzer (Applied Biosystems, Foster City, California, USA) and assembled to produce near full length genomes (∼9 kb).

    Article Title: Novel Coronavirus and Astrovirus in Delaware Bay Shorebirds
    Article Snippet: Sequence-specific PCR was conducted with HotStar polymerase (Qiagen) and random hexamer-primed cDNA (Superscript II, Invitrogen). .. Amplified products were subjected to direct dideoxy sequencing (Genewiz, South Plainfield, NJ, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Presence of mixed infection was detected by visualizing the occurrence of bands in the agarose gel at 332-bp for assemblage A amplified using primers AssAF (5′-CGC CGT ACA CCT GTC-3′) and AssAR (5′-AGC AAT GAC AAC CTC CTT CC-3′) and at 400-bp for assemblage B amplified using primers AssBF (5′-GTT GTT GTT GCT CCC TCC TTT-3′) and AssBR (5′-CCG GCT CAT AGG CAA TTA CA-3′). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Gas Chromatography:

    Article Title: Direct DNA Amplification from Crude Clinical Samples Using a PCR Enhancer Cocktail and Novel Mutants of Taq
    Article Snippet: The gene targets SIM2 (human homolog of single-minded 2), DIP2A (human disco-interacting protein 2A), and SLC19A (human chromosome 21 genome region) were amplified from purified human genomic DNA and 5% whole blood with different DNA polymerases in the absence or presence of PCR enhancer. .. FastStart Taq was applied with GC Solution, HotStarTaq Plus with Q-Solution, plain Taq with Hi-Spec Additive, and OT and OKT with PEC. .. As shown in , A and B, with purified DNA none of the enzymes could yield specific products in the absence of enhancer, and some commercial enzymes failed to do so even in the presence of it.

    Plasmid Preparation:

    Article Title: Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase
    Article Snippet: The genes encoding kirromycin ACP’s were amplified from cosmids 1C24 and 2C23 ( ) using HotStar HighFidelity polymerase (Qiagen) and the primers listed in . .. Fragments were cloned in pET30Ek/LIC (Novagen/Merck Millipore) using the manufacturer’s protocol.

    Article Title: Studies of the Genetics, Function, and Kinetic Mechanism of TagE, the Wall Teichoic Acid Glycosyltransferase in Bacillus subtili
    Article Snippet: Ampicillin was used at a concentration of 50 μg/ml ( E. coli ), whereas spectinomycin was used at a concentration of 150 μg/ml ( B. subtilis ). .. HotStar TaqPCR reagents, gel extraction, and plasmid miniprep kits were purchased from Qiagen (Mississauga, Canada). .. Vent polymerase was obtained from New England Biolabs (Beverly, MA), the Expand PCR system was purchased from Roche Applied Science, and the GatewayTM cloning system was from Invitrogen.

    Software:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR products were run in 1.5% agarose gels and visualized using Midori Green DNA stain (5 μl/100 ml gel) and a fluorchemQ image station (Alpha Innotech/Cell Biosciences, Santa Clara, CA, USA).

    Electrophoresis:

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA). .. Each reaction contained 2.5 μl 10X buffer with MgCl2 , 50 μM of each dATP, dTTP, dCTP and dGTP, 0.4 μM each primer mix, 1 μl PCR product from the previous reaction, 0.5 U polymerase, and ddH2 O to total 25 μl.

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl. .. 1 μl of DNA template was added for assemblage A and 2 μl was added for assemblage B for the PCR amplifications following the cycle parameter: initial hot start at 95°C for 5 min, initial denaturation at 94°C for 10 min and 35 amplification cycles at 94°C for 45 s, 64°C for 45 s (62°C for secondary PCR) and 72°C for 45 s. In all the PCR reactions, a Giardia -positive DNA sample and distilled water were used as a positive and negative control.

    Functional Assay:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark).

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: The UHDRS includes motor (I), cognitive (II), behavioral (III), functional (IV), independence (V) and functional capacity scales (VI). .. Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc).

    Permeability:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Steady-state fluxes, permeability values were subsequently calculated. pH measurements of the media during the culture period and transcellular transport experiments were performed using a PHM 240 PH/ION meter equipped with a PHC2401-8 combined electrode (Meterlab—Radiometer Analytical, Lyon, France). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark).

    Agarose Gel Electrophoresis:

    Article Title: The first feline and new canine cases of Thelazia callipaeda (Spirurida: Thelaziidae) infection in Hungary
    Article Snippet: The PCR reaction was carried out in a final volume of 25 μl of mixture containing 0.5 U (0.1 μl) HotStarTaq Plus DNA polymerase (Qiagen, Hilden, Germany), 2.5 μl 10× CoralLoad Reaction buffer (including 15 mM MgCl2 ), 0.5 μl PCR nucleotide Mix (0.2 mM each), 0.5 μl (1.0 μM final concentration) of each primer, 15.9 μl ddH2 O and 5 μl of template DNA using the following thermal conditions: an initial denaturation step at 95 °C for 5 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 1 min and extension at 72 °C for 1 min. .. Reaction mixture without adding template DNA served as a negative control and sequenced Thelazia callipaeda DNA (confirmed by sequencing) was used as a positive control to test the efficacy of the reactions.

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA). .. Each reaction contained 2.5 μl 10X buffer with MgCl2 , 50 μM of each dATP, dTTP, dCTP and dGTP, 0.4 μM each primer mix, 1 μl PCR product from the previous reaction, 0.5 U polymerase, and ddH2 O to total 25 μl.

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: Presence of mixed infection was detected by visualizing the occurrence of bands in the agarose gel at 332-bp for assemblage A amplified using primers AssAF (5′-CGC CGT ACA CCT GTC-3′) and AssAR (5′-AGC AAT GAC AAC CTC CTT CC-3′) and at 400-bp for assemblage B amplified using primers AssBF (5′-GTT GTT GTT GCT CCC TCC TTT-3′) and AssBR (5′-CCG GCT CAT AGG CAA TTA CA-3′). .. 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl.

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Spectrophotometry:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Total RNA was isolated from co-cultures (day 6 after seeding) using Total RNA Isolation Reagent according to the manufacturers protocol (ABgene, Epsom, United Kingdom). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. PCR was run for 36 cycles with 60 s annealing, 60 s extension, and 30 s denaturation.

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: DNA quantity and quality were analyzed with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). .. Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc).

    Produced:

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: Cloned amplicons were produced as described elsewhere , and 15 to 20 clones of the 16S rRNA gene PCR products of each amplicon were sequenced and analyzed. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    Activation Assay:

    Article Title: Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons ( Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
    Article Snippet: The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. .. The amplification mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, 1.5 mM MgCl2 , 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.5 U of HotStarTaq Plus DNA polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template.

    CTG Assay:

    Article Title: JPH3 Repeat Expansions Cause a Progressive Akinetic-Rigid Syndrome with Severe Dementia and Putaminal Rim in a Five-Generation African-American Family
    Article Snippet: Genomic DNA was PCR amplified (32 cycles: 94°C for 20 s, 60°C for 30 s, and 72°C for 30 s) using the HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA, USA) with the following primer pair (forward: agatgccaccgcattcgg, and reverse: ggttccctgcacagaaaccatc). .. PCR products were examined on agarose gels, bands were precisely cut from gels, and DNA was purified with the Qiagen QIAquick Gel Extraction Kit prior to Sanger sequencing in the forward and reverse directions using the Applied Biosystems BigDye Terminator v3.1 chemistry (Life Technologies, Carlsbad, CA, USA) on an Applied Biosystems 3130XL Genetic Analyzer.

    Staining:

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: Midori green DNA stain was from Kem-En-Tech A/S (Taastrup, Denmark). .. HotStarTaq Plus DNA Polymerase was from Qiagen (Copenhagen, Denmark).

    Article Title: Paracellular Tightness and Claudin-5 Expression is Increased in the BCEC/Astrocyte Blood-Brain Barrier Model by Increasing Media Buffer Capacity During Growth
    Article Snippet: The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark). .. The isolated RNA was treated with DNAse I Amplification grade according to manufacturer's protocol (SIGMA-ALDRICH, Steinheim, Germany) prior to reverse transcription with Superscript™ III First-Strand Synthesis SuperMix for qRT-PCR according to manufacturers protocol (Invitrogen, Taastrup, Denmark). cDNA concentrations were determined by UV spectrophotometry and PCR reactions were carried out with approximately 1 μg cDNA/reaction using HotStarTaq Plus DNA Polymerase according to manufacturers protocol (Qiagen, Copenhagen, Denmark).

    Article Title: Development of a high-throughput microsphere-based molecular assay to identify fifteen common bloodmeal hosts of Culex mosquitoes
    Article Snippet: Targets were amplified using HotstarTaq Plus® DNA polymerase (Qiagen, Valencia, CA). .. Each reaction contained 2.5 μl 10X buffer with MgCl2 , 50 μM of each dATP, dTTP, dCTP and dGTP, 0.4 μM each primer mix, 1 μl PCR product from the previous reaction, 0.5 U polymerase, and ddH2 O to total 25 μl.

    Article Title: Molecular epidemiology of giardiasis among Orang Asli in Malaysia: application of the triosephosphate isomerase gene
    Article Snippet: 1.25 U of HotStarTaq® Plus DNA Polymerase (Qiagen, Hilden, Germany), 1 × PCR buffer (Qiagen, Hilden, Germany), 200 μM dNTP (Fermentas, Ontario, Canada), 1.5 mM MgCl2 (Qiagen, Hilden, Germany) and 0.1 mg/ml BSA (New England Biolabs, Ipswich, USA) to a final volume of 25 μl. .. 1 μl of DNA template was added for assemblage A and 2 μl was added for assemblage B for the PCR amplifications following the cycle parameter: initial hot start at 95°C for 5 min, initial denaturation at 94°C for 10 min and 35 amplification cycles at 94°C for 45 s, 64°C for 45 s (62°C for secondary PCR) and 72°C for 45 s. In all the PCR reactions, a Giardia -positive DNA sample and distilled water were used as a positive and negative control.

    Article Title: Bronchial Smooth Muscle Cells of Asthmatics Promote Angiogenesis through Elevated Secretion of CXC-Chemokines (ENA-78, GRO-?, and IL-8)
    Article Snippet: The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment. .. The obtained cDNA was subjected to amplification with HotStarTaq Plus DNA polymerase (Qiagen, Hombrechtikon, Switzerland) using the following primers: forward 5`- CAGTTACAGCTCTACCCTGCC -3, reverse 5`- CCAGGAGCAAGGACAGACCCC -3 generating a 451 bp spanning fragment.

    Variant Assay:

    Article Title: Comparison of two commercial carbapenemase gene confirmatory assays in multiresistant Enterobacteriaceae and Acinetobacter baumannii-complex
    Article Snippet: The report does not provide a specific variant of these carbapenemase gene families. .. For each reaction, 25 μl reaction mixture consisted of 15 μl Primer Nucleotide Mix (PN-Mix Carba), 2.5 μl 10x polymerase buffer (Qiagen, Hilden, Germany), 2 μl UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific, Waltham, USA), 0.5 μl (= 2.5 units) HotStarTaq Plus DNA Polymerase (Qiagen, Hilden, Germany) and 5 μl sample DNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen hot star taq polymerase
    Hot Star Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot star taq polymerase/product/Qiagen
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    hot star taq polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    81
    Qiagen hot start taq polymerase pcr master mix 2×
    Hot Start Taq Polymerase Pcr Master Mix 2×, supplied by Qiagen, used in various techniques. Bioz Stars score: 81/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start taq polymerase pcr master mix 2×/product/Qiagen
    Average 81 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot start taq polymerase pcr master mix 2× - by Bioz Stars, 2019-12
    81/100 stars
      Buy from Supplier

    99
    Qiagen taq polymerase
    Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results