hot start dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Hot Start Taq DNA Polymerase
    Description:
    Hot Start Taq DNA Polymerase 1 000 units
    Catalog Number:
    m0495l
    Price:
    265
    Size:
    1 000 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs hot start dna polymerase
    Hot Start Taq DNA Polymerase
    Hot Start Taq DNA Polymerase 1 000 units
    https://www.bioz.com/result/hot start dna polymerase/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    hot start dna polymerase - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. The promoter fragment was excised from PCR8-DARPP-32 by digesting it with Kpn I and Hin dIII, and then cloned in the pGL3-basic vector to produce the pGL3- DARPP-32 promoter luciferase reporter.

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. PCR products were gel purified, cloned into pGEM‐T Easy (Promega) and 10–15 clones sequenced using T7 and T3 primers at the Australian Genome Research Facility (Brisbane, Australia).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: Paragraph title: 2.1. Cloning and overexpression ... The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse).

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: AOA amoA gene was obtained from an environmental clone, cloned in plasmid pGEM-T (Promega, Mannheim, Germany) and multiplied in Escherichia coli JM109. .. Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls.

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. Approximately 100 ng of cleaned-up PCR product was cloned into vector pCR2.1-TOPO using the TOPO-TA cloning kit (Invitrogen) according to the manufacturer's instructions.

    Amplification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. The first amplification of 35 cycles used flanking primers in a 25 μl reaction.

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: In the second round of amplification, primers Ap1 ( 5’- TCTTGATAGGGATCCGCTAGGATA-3’ ) and Ap2 ( 5’-ACCGTGGTTCTGGACTATCTGGATC-3’ ), were used to amplify a 497 bp fragment which identifies the EBV type-1 EBNA2 gene product, whereas primers Bp1 ( 5’-CATGGTAGCCTTAGGACATA-3’ ) and Bp2 ( 5’-AGACTTAGTTGATGCCCTAG-3’ ) amplified a 150 bp fragment that characterizes EBV type-2 EBNA2 gene product. .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma). .. Restriction endonucleases were used according to the manufacturer’s specifications (Roche).

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: .. Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls. ..

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: .. IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: .. For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. The PCR program was 30 s at 94°C for initial denaturation, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 6 min, with a final extension time of 10 min at 68°C.

    Polymerase Chain Reaction:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite modified DNA was stored at −20°C and used for PCR within 2 months. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL). .. PCR reactions were run in duplicate (20 µl volume reactions).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. The first amplification of 35 cycles used flanking primers in a 25 μl reaction.

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: .. The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. For the first round of PCR using E2p1 and E2p2 primers, amplification conditions were as follows: after an initial heat activation step of 15 min at 95°C, 40 cycles of amplification were performed: denaturation for 5 min. at 95°C, annealing for 1 min. at 58°C, and extension for 1 min. at 72°C, followed by a final extension step of 10 min. at 72°C.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: PCR amplicons were sequenced bidirectionally using the Applied Biosystems Big Dye Terminator version 3.1 Cycle Sequencing Kit and an ABI 3130xl genetic analyzer. .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: To detect Calm1 , Calm2 , and Calm3 mRNAs, quantitative reverse transcriptase PCR (qRT–PCR) was performed using the SYBR Green Master Mix (Bio‐Rad) according to the manufacturer's instructions. .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Article Title: Coding sequences of sarcoplasmic reticulum calcium ATPase regulatory peptides and expression of calcium regulatory genes in recurrent exertional rhabdomyolysis, et al. Coding sequences of sarcoplasmic reticulum calcium ATPase regulatory peptides and expression of calcium regulatory genes in recurrent exertional rhabdomyolysis
    Article Snippet: .. Each reaction contained 2 μL of sample cDNA, 2 μL of 2.5 mM dNTPs, 2 μL of 10× PCR buffer, 1 μL of EvaGreen dye, 1.5 μL of 1:10 ROX reference dye dilution, 0.125 μL of Hot Start taq DNA Polymerase, 2 μL of 1.6 μM forward primer, 2 μL of 1600 μM reverse primer, and 7.4 μL of sterile nuclease‐free distilled water. ..

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: .. IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. The PCR program was 30 s at 94°C for initial denaturation, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 6 min, with a final extension time of 10 min at 68°C.

    TA Cloning:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Construct:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: .. IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Real-time Polymerase Chain Reaction:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL). .. PCR reactions were run in duplicate (20 µl volume reactions).

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: Paragraph title: Real-time PCR ... Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls.

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Luciferase:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: Paragraph title: DARPP-32 promoter and luciferase activity assays ... To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: .. IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Activity Assay:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: Paragraph title: DARPP-32 promoter and luciferase activity assays ... To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA).

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: .. IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Expressing:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Genes with > log2 fold higher or lower expression in MFM vs. control muscle were also evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Modification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite modified DNA was stored at −20°C and used for PCR within 2 months. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Crystallization Assay:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The recombinant protein used for crystallization comprised residues 20–247 of HpαCA plus six additional residues from the TEV cleavage site (GIDPFT).

    Over Expression:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: Paragraph title: 2.1. Cloning and overexpression ... The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse).

    Countercurrent Chromatography:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Transfection:

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. Sub-confluent cells cultured in 6-well plates were transiently co-transfected with luciferase reporter and internal control plasmids, using the DNAfectin Transfection Reagent according to the manufacture’s protocol.

    Ligation:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. The deletion constructs were made by amplifying the pGL3- DARPP-32 plasmid with hot-start DNA polymerase, using specific primers designed with Kpn I and Hin dIII restriction sites, followed by ligation of the digested fragments.

    Cell Culture:

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. Sub-confluent cells cultured in 6-well plates were transiently co-transfected with luciferase reporter and internal control plasmids, using the DNAfectin Transfection Reagent according to the manufacture’s protocol.

    Generated:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. Primers were located in exon 1, forward: GTATTCTGAGAGGCTGCTGCTTAG and exon 11, reverse: TTCATTTGGCTTGTTACTCTTCTTG.

    DNA Sequencing:

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Sequencing:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: .. The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: BROCA sequencing included the following genes: ATM , ATR , BABAM1 , BAP1 , BARD1 , BLM , BRCA1 , BRCA2 , BRCC36 , BRE , BRIP1 , CDK12 , CHEK1 , CHEK2 , DCLRE1C , FAM175A , FANCC , ID4 , LIG4 , MLH1 , MRE11A , MSH2 , MSH6 , NBN , PALB2 , PIK3CA , PMS2 , PRKDC , PTEN , RAD50 , RAD51 , RAD51B , RAD51C , RAD51D , RBBP8 , SLX4 , TOPBP1 , TP53 , TP53BP1 , UIMC1 , USP28 , XRCC2 , XRCC3 , XRCC4 , XRCC5 , and XRCC6, and only clear loss-of-function mutations were reported ( ). .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Recombinant:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The recombinant protein used for crystallization comprised residues 20–247 of HpαCA plus six additional residues from the TEV cleavage site (GIDPFT).

    DNA Extraction:

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: DNA manipulation DNA isolation was performed using the PureLink Genomic DNA mini kit (Life Technologies) except for TraDIS library genomic DNA isolation (see below). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Fluorescence:

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls. .. To obtain melting curves, samples were heated to 95°C for 60s and cooled to 55°C for 60s followed by a temperature increase from 55°C to 95°C by 0.5°C per cycle with continuous fluorescence measurement.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Methylation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Paragraph title: Promoter methylation analysis ... Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Paragraph title: 2.6. Methylation profiling – mouse germ cells ... Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Isolation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Promoter methylation analysis Genomic DNA was isolated by Proteinase K treatment, following a phenol-chloroform extraction protocol. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: DNA was extracted (Qiagen, DNeasy kit) from freshly isolated germ cells and bisulfite‐treated (Zymo Research, EZ DNA Methylation Kit). .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: Isolation of plasmid DNA was carried out using the QIAprep spin miniprep kit (Qiagen). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: Nitrobacter winogradskyi DSM 10237 was grown in mixotrophic Nitrobacter medium (DSMZ Medium 756a) and genomic DNA was isolated from a 2-ml aliquot of the culture according to Wilson [ ]. .. Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls.

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: Total RNA was isolated from cell lines using the RNeasy Plus Mini Kit (QIAGEN). .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: Transcript Analysis by Reverse Transcription Polymerase Chain Reaction The total cellular RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer.

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: For cDNA synthesis using total RNA isolated from rat cortical neurons, 2 μg total RNA for each sample was treated with 1 unit of DNase I (Thermo Fisher Scientific) at 37°C for 30 min. DNase‐treated RNA was split in two: 1 μg was used for cDNA synthesis and the rest 1 μg for minus reverse transcriptase (−RT) reactions. .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Activation Assay:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. For the first round of PCR using E2p1 and E2p2 primers, amplification conditions were as follows: after an initial heat activation step of 15 min at 95°C, 40 cycles of amplification were performed: denaturation for 5 min. at 95°C, annealing for 1 min. at 58°C, and extension for 1 min. at 72°C, followed by a final extension step of 10 min. at 72°C.

    Purification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. PCR products were gel purified, cloned into pGEM‐T Easy (Promega) and 10–15 clones sequenced using T7 and T3 primers at the Australian Genome Research Facility (Brisbane, Australia).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. PCR products were cleaned up using the QIAquick PCR purification kit (Qiagen) according to the manufacturer's instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. Primers were located in exon 1, forward: GTATTCTGAGAGGCTGCTGCTTAG and exon 11, reverse: TTCATTTGGCTTGTTACTCTTCTTG.

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: Paragraph title: 4.5. Transcript Analysis by Reverse Transcription Polymerase Chain Reaction ... The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer.

    Quantitative RT-PCR:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Genes with > log2 fold higher or lower expression in MFM vs. control muscle were also evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL).

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. For quantitative RT-PCR, RNA was tested for quality on a Bioanalyzer (Agilent).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: Paragraph title: cDNA synthesis and quantitative RT–PCR ... For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Gel Extraction:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Nested PCR:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Paragraph title: EBV genotyping by nested PCR of the EBNA-2 gene ... Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Plasmid Preparation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: Isolation of plasmid DNA was carried out using the QIAprep spin miniprep kit (Qiagen). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: AOA amoA gene was obtained from an environmental clone, cloned in plasmid pGEM-T (Promega, Mannheim, Germany) and multiplied in Escherichia coli JM109. .. Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls.

    Article Title: ETS1 is associated with cisplatin resistance through IKKα/NF-κB pathway in cell line MDA-MB-231
    Article Snippet: IKKα promoter and luciferase activity assays To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Xho I sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. Approximately 100 ng of cleaned-up PCR product was cloned into vector pCR2.1-TOPO using the TOPO-TA cloning kit (Invitrogen) according to the manufacturer's instructions.

    Software:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: Trace sequences were analyzed using Sequencher version 4.9 software (Gene Codes Corporation) and ABI Sequence Scanner version 1.0 software. .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    SYBR Green Assay:

    Article Title: Conversion of monoculture cropland and open grassland to agroforestry alters the abundance of soil bacteria, fungi and soil-N-cycling genes
    Article Snippet: .. Amplification was performed with 1:100 dilutions of the DNA extracts in 4 μl reaction volume that contained the following: 3 μl mastermix (buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , pH 8.3 at 25°C); varying MgCl2 concentrations ( ); 100 μM of each deoxyribonucleoside triphosphate (Bioline, Luckenwalde, Germany); 0.3, 0.5 or 1.0 μM of each primer , 0.1X SYBR Green I solution (Invitrogen, Karlsruhe, Germany); 1 mg/ml bovine serum albumin; 0.03 u Hot Start Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts, USA)); and 1 μl template DNA solution or double-distilled H2 O for negative controls. ..

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Agarose Gel Electrophoresis:

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. Aliquots of 25 µL of PCR products were separated on a 2% agarose gel using the standard GeneRuler 100 bp DNA Ladder (Thermo Scientific).

    Spectrophotometry:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. RNA concentrations were determined with a spectrophotometer (NanoDrop; Thermo Fisher Scientific).

    DNA Methylation Assay:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite treatment of 200 ng genomic DNA was performed using Zymo DNA Methylation Gold Kit (Zymo Research, Irvine, CA, USA). .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: DNA was extracted (Qiagen, DNeasy kit) from freshly isolated germ cells and bisulfite‐treated (Zymo Research, EZ DNA Methylation Kit). .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Concentration Assay:

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    CTG Assay:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Staining:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. Visualization was performed by GelRed staining (Biotium Inc., Fremont, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 hot star high fidelity dna polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Q5 Hot Star High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hot star high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    q5 hot star high fidelity dna polymerase - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs epimark
    Polymerase chain reaction amplification bias observed with NEB <t>EpiMark.</t> Normalized read counts versus methylation levels for 10 kb windows from chromosome five for (A–C) NEB EpiMark from 4-, 8-, and 15-cycles of PCR. (D–F) Normalized read numbers for each 10 kb window were compared between different PCR cycle numbers and correlation scores were determined as indicated in the upper right hand of the plot. All R 2 values reported reflect Pearson correlation coefficients.
    Epimark, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epimark/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    epimark - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs phusion hot start flex
    Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, <t>Phusion</t> and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.
    Phusion Hot Start Flex, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start flex/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    phusion hot start flex - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I

    Journal: BMC Biotechnology

    Article Title: Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins

    doi: 10.1186/s12896-016-0316-3

    Figure Lengend Snippet: Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I

    Article Snippet: Finally, extension was performed at 70 °C for 3 s for KOD Hot Start DNA polymerase, 72 °C for 30 s for Pfu Turbo and Taq, and 72 °C for 15 s for Q5® Hot Star High Fidelity DNA polymerase.

    Techniques: Negative Control

    Polymerase chain reaction amplification bias observed with NEB EpiMark. Normalized read counts versus methylation levels for 10 kb windows from chromosome five for (A–C) NEB EpiMark from 4-, 8-, and 15-cycles of PCR. (D–F) Normalized read numbers for each 10 kb window were compared between different PCR cycle numbers and correlation scores were determined as indicated in the upper right hand of the plot. All R 2 values reported reflect Pearson correlation coefficients.

    Journal: Frontiers in Genetics

    Article Title: Methylated DNA is over-represented in whole-genome bisulfite sequencing data

    doi: 10.3389/fgene.2014.00341

    Figure Lengend Snippet: Polymerase chain reaction amplification bias observed with NEB EpiMark. Normalized read counts versus methylation levels for 10 kb windows from chromosome five for (A–C) NEB EpiMark from 4-, 8-, and 15-cycles of PCR. (D–F) Normalized read numbers for each 10 kb window were compared between different PCR cycle numbers and correlation scores were determined as indicated in the upper right hand of the plot. All R 2 values reported reflect Pearson correlation coefficients.

    Article Snippet: Three different enzyme mixtures were used to amplify bisulfite-converted adapter ligated DNA: Kapa HiFi Uracil+ (cat-KK2802, Kapa Biosystems), Pfu Turbo Cx Hotstart DNA polymerase (Agilent Technologies, Santa Clara, CA, cat-600410, USA), and EpiMark (New England Biolabs., Ipswich, MA, cat-M0490S, USA).

    Techniques: Polymerase Chain Reaction, Amplification, Methylation

    Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, Phusion and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.

    Journal: Nucleic Acids Research

    Article Title: Solid-phase cloning for high-throughput assembly of single and multiple DNA parts

    doi: 10.1093/nar/gkv036

    Figure Lengend Snippet: Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, Phusion and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.

    Article Snippet: DNA parts were amplified with Phusion® Hot-Start Flex (2 U/μl, New England Biolabs, Ipswich, MA, USA) by the following PCR program: 98°C for 30 s, 30 cycles of 98°C 8 s, 25 s annealing with temperature depending on primer melting temperature and 72°C for 20 s/kb, before ending with 72°C for 7 min followed by 4°C hold.

    Techniques: Activity Assay, Selection, Construct