Journal: Malaria Journal

Article Title: Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections

doi: 10.1186/1475-2875-11-295

Figure Lengend Snippet: Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

Article Snippet: , Pf real-time PCR , Pf_RTPCR_F , ATGGATATCTGGATTGATTTTA TTTATGA , Hot FirePol EvaGreen HRM Mix Solis Biodyne 1X (#08- 33-00001), Primers 250 nM, 5 μl template Primary PCR products 1:1000, total volume 20 μl , 95°C-15 min. 40 cycles: 95°C-10 sec./62°C-20 sec./ 72°C-25 sec. 95°C-1 min. 40°C-1 min , From 65 to 90°C, increment 0.2°C for 0.05 sec. , 78.8-79.6°C.

Techniques: Real-time Polymerase Chain Reaction, Sequencing