hot firepol evagreen hrm mix solis biodyne 1x  (Solis BioDyne)


Bioz Verified Symbol Solis BioDyne is a verified supplier
Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Solis BioDyne hot firepol evagreen hrm mix solis biodyne 1x
    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011
    Hot Firepol Evagreen Hrm Mix Solis Biodyne 1x, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot firepol evagreen hrm mix solis biodyne 1x/product/Solis BioDyne
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot firepol evagreen hrm mix solis biodyne 1x - by Bioz Stars, 2024-06
    95/100 stars

    Images

    1) Product Images from "Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections"

    Article Title: Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections

    Journal: Malaria Journal

    doi: 10.1186/1475-2875-11-295

    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011
    Figure Legend Snippet: Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

    Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

    hot firepol evagreen hrm mix solis biodyne 1x  (Solis BioDyne)


    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Solis BioDyne hot firepol evagreen hrm mix solis biodyne 1x
    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011
    Hot Firepol Evagreen Hrm Mix Solis Biodyne 1x, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot firepol evagreen hrm mix solis biodyne 1x/product/Solis BioDyne
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot firepol evagreen hrm mix solis biodyne 1x - by Bioz Stars, 2024-06
    95/100 stars

    Images

    1) Product Images from "Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections"

    Article Title: Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections

    Journal: Malaria Journal

    doi: 10.1186/1475-2875-11-295

    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011
    Figure Legend Snippet: Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

    Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

    hot firepol evagreen hrm mix solis biodyne 1x  (Solis BioDyne)


    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Solis BioDyne hot firepol evagreen hrm mix solis biodyne 1x
    Primers sequences and real - time PCR conditions used to detect Plasmodium species
    Hot Firepol Evagreen Hrm Mix Solis Biodyne 1x, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot firepol evagreen hrm mix solis biodyne 1x/product/Solis BioDyne
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot firepol evagreen hrm mix solis biodyne 1x - by Bioz Stars, 2024-06
    95/100 stars

    Images

    1) Product Images from "An innovative tool for moving malaria PCR detection of parasite reservoir into the field"

    Article Title: An innovative tool for moving malaria PCR detection of parasite reservoir into the field

    Journal: Malaria Journal

    doi: 10.1186/1475-2875-12-405

    Primers sequences and real - time PCR conditions used to detect Plasmodium species
    Figure Legend Snippet: Primers sequences and real - time PCR conditions used to detect Plasmodium species

    Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Solis BioDyne hot firepol evagreen hrm mix solis biodyne 1x
    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011
    Hot Firepol Evagreen Hrm Mix Solis Biodyne 1x, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot firepol evagreen hrm mix solis biodyne 1x/product/Solis BioDyne
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot firepol evagreen hrm mix solis biodyne 1x - by Bioz Stars, 2024-06
    95/100 stars
      Buy from Supplier

    Image Search Results


    Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

    Journal: Malaria Journal

    Article Title: Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections

    doi: 10.1186/1475-2875-11-295

    Figure Lengend Snippet: Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

    Article Snippet: , Pf real-time PCR , Pf_RTPCR_F , ATGGATATCTGGATTGATTTTA TTTATGA , Hot FirePol EvaGreen HRM Mix Solis Biodyne 1X (#08- 33-00001), Primers 250 nM, 5 μl template Primary PCR products 1:1000, total volume 20 μl , 95°C-15 min. 40 cycles: 95°C-10 sec./62°C-20 sec./ 72°C-25 sec. 95°C-1 min. 40°C-1 min , From 65 to 90°C, increment 0.2°C for 0.05 sec. , 78.8-79.6°C.

    Techniques: Real-time Polymerase Chain Reaction, Sequencing