hiscribe t7 high yield rna synthesis kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HiScribe T7 High Yield RNA Synthesis Kit
    Description:

    Catalog Number:
    E2040S
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs hiscribe t7 high yield rna synthesis kit

    https://www.bioz.com/result/hiscribe t7 high yield rna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    hiscribe t7 high yield rna synthesis kit - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen).

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: The resulting PCR products were digested and cloned into pcDNA3.1. .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions.

    Luciferase:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Efficacy and Immunogenicity of Unmodified and Pseudouridine-Modified mRNA Delivered Systemically with Lipid Nanoparticles in Vivo
    Article Snippet: DNA plasmids (Invitrogen) containing a T7 promoter upstream of the sequences for luciferase (Luc), or erythropoietin (EPO), or scrambled EPO coding region (scramble) mRNA were used as templates for mRNA synthesis. .. DNA plasmids were linearized using restriction enzyme XbaI (New England Biolabs, Ipswich, MA) and transcribed using the HiScribe T7 RNA Synthesis Kit (New England Biolabs).

    Positive Control:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. Reactions were incubated with the long RNA substrate and RNasin at 37°C for a 30-min time course.

    Synthesized:

    Article Title: mRNA and DNA selection via protein multimerization: YB-1 as a case study
    Article Snippet: In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The Cas9 encoding plasmid pT3TS-nCas9n (Addgene) was linearized with XbaI (NEB) and capped mRNA generated with the mMessage mMachine T3 Transcription Kit (Life Technologies) followed by polyadenylation with the Poly(A) Tailing Kit (Life Technologies).

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: CRISPR mutations were generated as described. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. Founder fish were generated by injecting 150 pg of Cas9 mRNA and 50 pg of guide RNA into NHGRI-1 embryos.

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: The DCR-1 ribonuclease assay was performed as described previously . .. Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. GST-DCR-1 proteins were synthesized using the TNT Coupled Reticulocyte Lysate System and affinity purified by Glutathione Sepharose 4B beads.

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications. .. Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications.

    Autoradiography:

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare).

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions. .. Cell lysates were prepared from MEFs in radioimmuneprecipitation assay buffer followed by sonication and centrifugation.

    Construct:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The Cas9 encoding plasmid pT3TS-nCas9n (Addgene) was linearized with XbaI (NEB) and capped mRNA generated with the mMessage mMachine T3 Transcription Kit (Life Technologies) followed by polyadenylation with the Poly(A) Tailing Kit (Life Technologies).

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: Pri-let-7a template for in vitro transcription was generated from the pri-miRNA -pcDNA3 construct described above. .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions.

    Electrophoresis:

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications. .. Stem I of 7SK RNA (5′-GGAUGUGAGGGCGAUCUGGCUGCGACAUCUGUCACCCCAUUGAUCGCCAGGGUUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUCCCUCACCGCUCC-3′) was synthesized using T7 RNA polymerase from PCR-generated DNA templates.

    Incubation:

    Article Title: A versatile system for rapid multiplex genome-edited CAR T cell generation
    Article Snippet: Cas9 mRNA was transcribed in vitro using mMESSAGE mMACHINE T7 ULTRA kits (Life Technologies, AM1345, Carlsbad, CA). gRNA were transcribed using a HiScribeTM T7 High Yield RNA Synthesis Kit (NEB). .. For chemical CRISPR, 20 μg of Cas9 mRNA and 10 μg of gRNA were mixed with CAR T cells.

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. Reactions were incubated with the long RNA substrate and RNasin at 37°C for a 30-min time course.

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. .. 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions.

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. GST-DCR-1 proteins were synthesized using the TNT Coupled Reticulocyte Lysate System and affinity purified by Glutathione Sepharose 4B beads.

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions. .. Cell lysates were prepared from MEFs in radioimmuneprecipitation assay buffer followed by sonication and centrifugation.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA). .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Amplification:

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates for in vitro transcription of the T3D S4 gene segment were generated from pT7-S4T3D by PCR amplification using T3D_T7S4 primers ( ). .. Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications.

    Article Title: Impact of RNA structure on ZFP36L2 interaction with luteinizing hormone receptor mRNA
    Article Snippet: For the mouse LHR mRNA, its cDNA template was amplified from the plasmid pcDNA3.1-mLHR using the primers CMV-For and pcDNA-Rev2 (5′-CGCAAATGGGCGGTAGGCGTG-3′, 5′-GGCTGATCAGCGAGCTCTAGCATT-3′, respectively). .. This PCR product, containing a T7 promoter at the 5′ end, was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), and the RNA was purified using an Ambion MEGAClear Transcription Clean-up Kit (Thermo Fisher).

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The PCR product was amplified in a 50 μL reaction using Phusion High-Fidelity Polymerase (NEB, Ipswich, MA) and a thermocycler protocol of: 1 min at 98°C, 9 cycles of 30 s 98°C, 15 s at 55°C, 1 min 72°C, and 5 min at 72°C. .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Activity Assay:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: Paragraph title: Agarose Gel RNase Activity Assay ... 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: Paragraph title: In vitro assay for sgRNA activity ... The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Modification:

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. .. RNA was purified with reagents from the Total RNA Kit I (Omega Bio-Tek) according to the RNA Cleanup protocol from the RNeasy Mini Handbook (Qiagen).

    Article Title: Impact of RNA structure on ZFP36L2 interaction with luteinizing hormone receptor mRNA
    Article Snippet: This PCR product, containing a T7 promoter at the 5′ end, was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), and the RNA was purified using an Ambion MEGAClear Transcription Clean-up Kit (Thermo Fisher). .. This PCR product was used for a transcription reaction with a T7 RNA synthesis kit followed by a cleanup step, as mentioned above.

    Flow Cytometry:

    Article Title: Systematic reconstruction of binding and stability landscapes of the fluorogenic aptamer spinach
    Article Snippet: Bonding between the flow and control PDMS layer was achieved by using off-ratio method. .. The transcription of Spinach DNA mutants was initiated upon introduction of an in vitro transcription (IVT) solution (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, USA) into the 640 microchambers containing the DNA spots.

    Gas Chromatography:

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: PCR was employed to add on a 5′ T7 promoter (5′-TCG TAA TAC GAC TCA CTA TAG GGA TAT CCA TCA CAC TGG CGG CC-3′) and (5′- GCT GAT CAG CGA GCT CTA GC-3′). .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions.

    Hemagglutination Assay:

    Article Title: mRNA and DNA selection via protein multimerization: YB-1 as a case study
    Article Snippet: In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Generated:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The Cas9 encoding plasmid pT3TS-nCas9n (Addgene) was linearized with XbaI (NEB) and capped mRNA generated with the mMessage mMachine T3 Transcription Kit (Life Technologies) followed by polyadenylation with the Poly(A) Tailing Kit (Life Technologies).

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: DNA templates for in vitro transcription were generated by PCR using Crimson Taq DNA Polymerase (New England BioLabs, Inc.) and Bm HRG-1 gene–specific PCR primers (designed to yield a PCR product corresponding to ∼400 bp and also containing a T7 promoter sequence followed by 2 guanine bases at the 5′ end for transcription by T7 RNA polymerase; left primer: 5′-TAATACGACTCACTATAGGGGGCTTTGACATGCAAGATGA-3′, right primer: 5′-TAATACGACTCACTATAGGGATACCACGCCGAAAGCATAG-3′) (Integrated DNA Technology). .. Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation.

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: CRISPR mutations were generated as described. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: PCR was employed to add on a 5′ T7 promoter (5′-TCG TAA TAC GAC TCA CTA TAG GGA TAT CCA TCA CAC TGG CGG CC-3′) and (5′- GCT GAT CAG CGA GCT CTA GC-3′). .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions. .. Cell lysates were prepared from MEFs in radioimmuneprecipitation assay buffer followed by sonication and centrifugation.

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates for in vitro transcription of the T3D S4 gene segment were generated from pT7-S4T3D by PCR amplification using T3D_T7S4 primers ( ). .. Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications.

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit. .. The in vitro transcription reaction is highly sensitive to RNase contamination.

    Imaging:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. As a positive control, RNase III (NEB) was incubated with the long substrate RNA in 1× NEB RNaseIII buffer at 37°C for a 30-min time course.

    Polymerase Chain Reaction:

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: DNA templates for in vitro transcription were generated by PCR using Crimson Taq DNA Polymerase (New England BioLabs, Inc.) and Bm HRG-1 gene–specific PCR primers (designed to yield a PCR product corresponding to ∼400 bp and also containing a T7 promoter sequence followed by 2 guanine bases at the 5′ end for transcription by T7 RNA polymerase; left primer: 5′-TAATACGACTCACTATAGGGGGCTTTGACATGCAAGATGA-3′, right primer: 5′-TAATACGACTCACTATAGGGATACCACGCCGAAAGCATAG-3′) (Integrated DNA Technology). .. Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation.

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: All retroviral insertional mutations were genotyped using allele-specific primers for PCR and agarose gel analysis. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: PCR was employed to add on a 5′ T7 promoter (5′-TCG TAA TAC GAC TCA CTA TAG GGA TAT CCA TCA CAC TGG CGG CC-3′) and (5′- GCT GAT CAG CGA GCT CTA GC-3′). .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions.

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates for in vitro transcription of the T3D S4 gene segment were generated from pT7-S4T3D by PCR amplification using T3D_T7S4 primers ( ). .. Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications.

    Article Title: Impact of RNA structure on ZFP36L2 interaction with luteinizing hormone receptor mRNA
    Article Snippet: For the mouse LHR mRNA, its cDNA template was amplified from the plasmid pcDNA3.1-mLHR using the primers CMV-For and pcDNA-Rev2 (5′-CGCAAATGGGCGGTAGGCGTG-3′, 5′-GGCTGATCAGCGAGCTCTAGCATT-3′, respectively). .. This PCR product, containing a T7 promoter at the 5′ end, was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), and the RNA was purified using an Ambion MEGAClear Transcription Clean-up Kit (Thermo Fisher). .. For the human LHR mRNA, a T7 promoter was introduced to the 5′ end of the plasmid pUC57-hLHCGR during PCR amplification using the primers T7FwhLHR and RevhLHR (5′-TAATACGACTCACTATAGGGTTCGCCGGCCATGAAGC-3 and 5′-TTAGCCACATGTGGCTAGTGGC-3′, respectively).

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The products for each sgRNA were cleaned using SpinSmart™ PCR Purification & Gel Extraction Kit (Denville Scientific, Holliston, MA). .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Staining:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. As a positive control, RNase III (NEB) was incubated with the long substrate RNA in 1× NEB RNaseIII buffer at 37°C for a 30-min time course.

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare).

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA). .. The DNA target amplicon was then added and the reaction was incubated for 2h at 37°C.

    Mutagenesis:

    Article Title: Systematic reconstruction of binding and stability landscapes of the fluorogenic aptamer spinach
    Article Snippet: The transcription of Spinach DNA mutants was initiated upon introduction of an in vitro transcription (IVT) solution (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, USA) into the 640 microchambers containing the DNA spots. .. During a 2 h incubation step the chip surface was heated to 37°C using an ITO heating glass slide (Tokai Hit, Japan).

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Paragraph title: Generation of zebrafish slc39a14 null mutant ... The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen).

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: Paragraph title: Mutation generation ... In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Labeling:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity in a range of substrate RNA concentrations, 10 nM 5′ Cy3 labeled p(A)20 (Dharmacon) was held constant and unlabeled p(A)19 (Dharmacon) was titrated into reactions at concentrations ranging from 0 nM to 10 μM unlabeled RNA. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Purification:

    Article Title: mRNA and DNA selection via protein multimerization: YB-1 as a case study
    Article Snippet: In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. The transcription mixture was supplemented with fluorescent nucleotides, Atto680-UTP (for 2Luc and Luc mRNAs) or DY776-UTP (for HA-YB-1 mRNA) (Jena Bioscience).

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The Cas9 encoding plasmid pT3TS-nCas9n (Addgene) was linearized with XbaI (NEB) and capped mRNA generated with the mMessage mMachine T3 Transcription Kit (Life Technologies) followed by polyadenylation with the Poly(A) Tailing Kit (Life Technologies).

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: DNA templates for in vitro transcription were generated by PCR using Crimson Taq DNA Polymerase (New England BioLabs, Inc.) and Bm HRG-1 gene–specific PCR primers (designed to yield a PCR product corresponding to ∼400 bp and also containing a T7 promoter sequence followed by 2 guanine bases at the 5′ end for transcription by T7 RNA polymerase; left primer: 5′-TAATACGACTCACTATAGGGGGCTTTGACATGCAAGATGA-3′, right primer: 5′-TAATACGACTCACTATAGGGATACCACGCCGAAAGCATAG-3′) (Integrated DNA Technology). .. Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation. .. The dsRNA was processed into hsiRNA using ShortCut RNase III (New England BioLabs, Inc.), purified by ethanol precipitation and resuspended in distilled H2 O. Agarose gel electrophoresis alongside the siRNA Marker (New England BioLabs, Inc.) was used to examine the size and purity of the Bm HRG-1 hsiRNA.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the SeV DI is highlighted in boldface.

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. Reactions were incubated with the long RNA substrate and RNasin at 37°C for a 30-min time course.

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: The DCR-1 ribonuclease assay was performed as described previously . .. Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. GST-DCR-1 proteins were synthesized using the TNT Coupled Reticulocyte Lysate System and affinity purified by Glutathione Sepharose 4B beads.

    Article Title: High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9
    Article Snippet: Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions. .. For Cas9 mRNA, the zebrafish codon optimized cas9 plasmid pT3TS-nls-zCas9-nls was used as template ( ).

    Article Title: Efficacy and Immunogenicity of Unmodified and Pseudouridine-Modified mRNA Delivered Systemically with Lipid Nanoparticles in Vivo
    Article Snippet: DNA plasmids were linearized using restriction enzyme XbaI (New England Biolabs, Ipswich, MA) and transcribed using the HiScribe T7 RNA Synthesis Kit (New England Biolabs). .. DNA plasmids were linearized using restriction enzyme XbaI (New England Biolabs, Ipswich, MA) and transcribed using the HiScribe T7 RNA Synthesis Kit (New England Biolabs).

    Article Title: dCas9-targeted locus-specific protein isolation method identifies histone gene regulators
    Article Snippet: Paragraph title: In Vitro sgRNA Transcription and Purification. ... The dsDNA template was used with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) to generate ssRNA ∼100 bases in length.

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications. .. Stem I of 7SK RNA (5′-GGAUGUGAGGGCGAUCUGGCUGCGACAUCUGUCACCCCAUUGAUCGCCAGGGUUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUCCCUCACCGCUCC-3′) was synthesized using T7 RNA polymerase from PCR-generated DNA templates.

    Article Title: Impact of RNA structure on ZFP36L2 interaction with luteinizing hormone receptor mRNA
    Article Snippet: For the mouse LHR mRNA, its cDNA template was amplified from the plasmid pcDNA3.1-mLHR using the primers CMV-For and pcDNA-Rev2 (5′-CGCAAATGGGCGGTAGGCGTG-3′, 5′-GGCTGATCAGCGAGCTCTAGCATT-3′, respectively). .. This PCR product, containing a T7 promoter at the 5′ end, was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), and the RNA was purified using an Ambion MEGAClear Transcription Clean-up Kit (Thermo Fisher). .. For the human LHR mRNA, a T7 promoter was introduced to the 5′ end of the plasmid pUC57-hLHCGR during PCR amplification using the primers T7FwhLHR and RevhLHR (5′-TAATACGACTCACTATAGGGTTCGCCGGCCATGAAGC-3 and 5′-TTAGCCACATGTGGCTAGTGGC-3′, respectively).

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The products for each sgRNA were cleaned using SpinSmart™ PCR Purification & Gel Extraction Kit (Denville Scientific, Holliston, MA). .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Sequencing:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The Cas9 encoding plasmid pT3TS-nCas9n (Addgene) was linearized with XbaI (NEB) and capped mRNA generated with the mMessage mMachine T3 Transcription Kit (Life Technologies) followed by polyadenylation with the Poly(A) Tailing Kit (Life Technologies).

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: DNA templates for in vitro transcription were generated by PCR using Crimson Taq DNA Polymerase (New England BioLabs, Inc.) and Bm HRG-1 gene–specific PCR primers (designed to yield a PCR product corresponding to ∼400 bp and also containing a T7 promoter sequence followed by 2 guanine bases at the 5′ end for transcription by T7 RNA polymerase; left primer: 5′-TAATACGACTCACTATAGGGGGCTTTGACATGCAAGATGA-3′, right primer: 5′-TAATACGACTCACTATAGGGATACCACGCCGAAAGCATAG-3′) (Integrated DNA Technology). .. Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9
    Article Snippet: The targeting oligo was annealed with an 80-nt chimeric sgRNA core sequence: (5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′). .. Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions.

    Article Title: dCas9-targeted locus-specific protein isolation method identifies histone gene regulators
    Article Snippet: The 19-bp targeted DNA sequence was inserted into the middle of a 58-bp primer behind a T7 promoter sequence (5′-TTAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3′). .. The dsDNA template was used with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) to generate ssRNA ∼100 bases in length.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: sgRNA templates were PCR-generated using primers Guide Template F and R (see Table ) containing a T7 promoter region, Cas9 homology region, and the guide sequence being tested. .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Small Interfering RNA:

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: Paragraph title: Bm HRG-1 hairpin small interfering RNA preparation ... Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation.

    CRISPR:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: The CRISPR design tool (see URLs) was used to identify a target region in exon 5 of zebrafish slc39a14 that is present in all transcripts ( ) . .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen).

    Article Title: A versatile system for rapid multiplex genome-edited CAR T cell generation
    Article Snippet: Paragraph title: CAR T cell gene editing with one-shot protein and chemical CRISPR ... Cas9 mRNA was transcribed in vitro using mMESSAGE mMACHINE T7 ULTRA kits (Life Technologies, AM1345, Carlsbad, CA). gRNA were transcribed using a HiScribeTM T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: CRISPR mutations were generated as described. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. Founder fish were generated by injecting 150 pg of Cas9 mRNA and 50 pg of guide RNA into NHGRI-1 embryos.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA). .. A ~1 kb region centered on each CRISPR target was amplified from cacao DNA (Scavina 6 genotype) using primers NPR3-F1/R1 and NPR3-F2/R2 (Table ) and these amplicons were also cleaned using SpinSmart columns.

    IA:

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA). .. The DNA target amplicon was then added and the reaction was incubated for 2h at 37°C.

    Chromatin Immunoprecipitation:

    Article Title: Systematic reconstruction of binding and stability landscapes of the fluorogenic aptamer spinach
    Article Snippet: Paragraph title: Microfluidic chip ... The transcription of Spinach DNA mutants was initiated upon introduction of an in vitro transcription (IVT) solution (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, USA) into the 640 microchambers containing the DNA spots.

    Plasmid Preparation:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Oligonucleotides with compatible overhangs (Fwd 5′-TAGGCCTTCGGGTTTGACCCCA-3′ and Rev 5′-AAACTGGGGTCAAACCCGAAGG-3′) were annealed as described by Hwang et al . and cloned into the qDR274 vector (Addgene) digested with BsaI (NEB). .. The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York. .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: pET-28a- yefM-yoeB Sa 1 was digested with XhoI (NEB) at 37°C for 3 h. The fully linearized plasmid was extracted once with 24.5:24.5:1 phenol:chloroform:isoamyl alcohol and twice with chloroform, precipitated with 3 M NaOAc, pH 5.3, and 100% EtOH, and resuspended in nuclease-free water. .. 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. .. RNA was purified with reagents from the Total RNA Kit I (Omega Bio-Tek) according to the RNA Cleanup protocol from the RNeasy Mini Handbook (Qiagen).

    Article Title: High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9
    Article Snippet: Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions. .. Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions.

    Article Title: Impact of RNA structure on ZFP36L2 interaction with luteinizing hormone receptor mRNA
    Article Snippet: For the mouse LHR mRNA, its cDNA template was amplified from the plasmid pcDNA3.1-mLHR using the primers CMV-For and pcDNA-Rev2 (5′-CGCAAATGGGCGGTAGGCGTG-3′, 5′-GGCTGATCAGCGAGCTCTAGCATT-3′, respectively). .. This PCR product, containing a T7 promoter at the 5′ end, was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), and the RNA was purified using an Ambion MEGAClear Transcription Clean-up Kit (Thermo Fisher).

    Positron Emission Tomography:

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: pET-28a- yefM-yoeB Sa 1 was digested with XhoI (NEB) at 37°C for 3 h. The fully linearized plasmid was extracted once with 24.5:24.5:1 phenol:chloroform:isoamyl alcohol and twice with chloroform, precipitated with 3 M NaOAc, pH 5.3, and 100% EtOH, and resuspended in nuclease-free water. .. 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions.

    Agarose Gel Electrophoresis:

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: All retroviral insertional mutations were genotyped using allele-specific primers for PCR and agarose gel analysis. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: Paragraph title: Agarose Gel RNase Activity Assay ... 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions.

    Article Title: High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9
    Article Snippet: The quality of the assembled oligos was checked on a 2.5% agarose gel. .. Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA). .. The DNA target amplicon was then added and the reaction was incubated for 2h at 37°C.

    In Vitro:

    Article Title: Systematic reconstruction of binding and stability landscapes of the fluorogenic aptamer spinach
    Article Snippet: The valve protected a circular surface area with a diameter of ∼60 μm during a passivation step of the reactive NeutrAvidin. .. The transcription of Spinach DNA mutants was initiated upon introduction of an in vitro transcription (IVT) solution (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, USA) into the 640 microchambers containing the DNA spots. .. During a 2 h incubation step the chip surface was heated to 37°C using an ITO heating glass slide (Tokai Hit, Japan).

    Article Title: mRNA and DNA selection via protein multimerization: YB-1 as a case study
    Article Snippet: Linearized plasmids, pT3Luc, pSP72–2Luc and pcDNA3-HA-YB-1 (provided by Dr. Dmitry Lyabin) were used as templates for RNA synthesis by T7 polymerase of Luc (∼1500 nt), 2Luc (∼3000 nt) and YB-1 mRNA (∼1500 nt), respectively. .. In vitro Transcription was performed by HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. Short 91 nt RNA was synthesized by the same way using linearized plasmid pBluesript II SK encoding region (from 1339 nt to 1430 nt) of 3′UTR YB-1 mRNA (provided by Alexander Doronin).

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: DNA templates for in vitro transcription were generated by PCR using Crimson Taq DNA Polymerase (New England BioLabs, Inc.) and Bm HRG-1 gene–specific PCR primers (designed to yield a PCR product corresponding to ∼400 bp and also containing a T7 promoter sequence followed by 2 guanine bases at the 5′ end for transcription by T7 RNA polymerase; left primer: 5′-TAATACGACTCACTATAGGGGGCTTTGACATGCAAGATGA-3′, right primer: 5′-TAATACGACTCACTATAGGGATACCACGCCGAAAGCATAG-3′) (Integrated DNA Technology). .. Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation.

    Article Title: A versatile system for rapid multiplex genome-edited CAR T cell generation
    Article Snippet: CD4 and CD8 T cells at an equal ratio were stimulated by CD3/CD28 Dynabeads and transduced by lentiviral CD19 (PSCA)-CAR or the one-shot CRISPR CD19 (PSCA)-CAR on day 1. .. Cas9 mRNA was transcribed in vitro using mMESSAGE mMACHINE T7 ULTRA kits (Life Technologies, AM1345, Carlsbad, CA). gRNA were transcribed using a HiScribeTM T7 High Yield RNA Synthesis Kit (NEB). .. Cas9 protein was purchased from PNA Bio (CP01).

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: In brief, in vitro fertilization was performed by using oocytes from wild-type TAB5 zebrafish females and cryo-preserved sperm samples carrying the desired mutations. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York. .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: Menin Is Required for Optimal Processing of the MicroRNA let-7a
    Article Snippet: Pri-let-7a template for in vitro transcription was generated from the pri-miRNA -pcDNA3 construct described above. .. Radiolabeled pri-let-7a was generated using the T7 High Yield RNA Synthesis kit (New England Biolabs) in the presence of [32 P]UTP according to the manufacturer's instructions.

    Article Title: High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9
    Article Snippet: The quality of the assembled oligos was checked on a 2.5% agarose gel. .. Approximately 2–3 µL of gRNA template was then used to transcribe RNA by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England BioLabs) according to the manufacturer's instructions. .. The sgRNAs were precipitated using isopropanol/sodium acetate (pH 5.2).

    Article Title: A multiplexed system for quantitative comparisons of chromatin landscapes
    Article Snippet: Paragraph title: 5. In vitro transcription ... To the eluted DNA, we added NTP buffer mix and T7 RNA polymerase mix according to manufacturer's instructions (HiScribe T7 Quick High Yield RNA Synthesis kit, New England BioLabs E2050S).

    Article Title: dCas9-targeted locus-specific protein isolation method identifies histone gene regulators
    Article Snippet: Paragraph title: In Vitro sgRNA Transcription and Purification. ... The dsDNA template was used with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) to generate ssRNA ∼100 bases in length.

    Article Title: Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication
    Article Snippet: Templates for in vitro transcription of the T3D S4 gene segment were generated from pT7-S4T3D by PCR amplification using T3D_T7S4 primers ( ). .. Templates were transcribed in vitro using a HiScribe T7 high-yield RNA synthesis kit (New England BioLabs) according to the manufacturer's instructions with the following modifications. .. For synthesis of radiolabeled RNA, 125 ng of PCR product was used in the presence of radiolabeled [α-32 P]UTP (PerkinElmer) in 20-μl reaction mixtures at room temperature for 2 h. For synthesis of nonradiolabeled RNA, 2 μg of plasmid DNA template was used in 40-μl reaction mixtures at 37°C for 2 h. DNA templates were degraded by on-column incubation with PureLink DNase (ThermoFisher).

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: For T7 in vitro transcription, follow manufacturer’s instructions. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: Paragraph title: In vitro assay for sgRNA activity ... The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Spectrophotometry:

    Article Title: Heme acquisition in the parasitic filarial nematode Brugia malayi
    Article Snippet: Bm HRG-1 specific double-stranded (ds)RNA was prepared using the T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Inc.) and purified by isopropanol precipitation. .. The dsRNA was processed into hsiRNA using ShortCut RNase III (New England BioLabs, Inc.), purified by ethanol precipitation and resuspended in distilled H2 O. Agarose gel electrophoresis alongside the siRNA Marker (New England BioLabs, Inc.) was used to examine the size and purity of the Bm HRG-1 hsiRNA.

    Produced:

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: To measure NOCT activity against a long mRNA substrate analog, RNA substrate template was generated by polymerase chain reaction (PCR) using primers listed in and a plasmid containing the Renilla Luciferase ORF. .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research). .. Reactions were incubated with the long RNA substrate and RNasin at 37°C for a 30-min time course.

    Concentration Assay:

    Article Title: Systematic reconstruction of binding and stability landscapes of the fluorogenic aptamer spinach
    Article Snippet: Automated perfusion operations on chip included the following sequential steps: (i) coating of the epoxy-coated glass slide with biotinylated BSA (Thermo Scientific, Germany), (ii) NeutrAvidin (Thermo Scientific, Germany), (iii) ROX-labeled anchor DNA with conjugated biotin at a concentration of 10 μM (Sigma Aldrich, Germany). .. The transcription of Spinach DNA mutants was initiated upon introduction of an in vitro transcription (IVT) solution (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, USA) into the 640 microchambers containing the DNA spots.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: The construct was sequence-verified and gRNA generated using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) followed by DNase I (NEB) digestion and purification with RNeasy MiniKit (Qiagen). .. The synthesized mRNA was purified using the RNeasy MiniKit.

    Article Title: The structure of human Nocturnin reveals a conserved ribonuclease domain that represses target transcript translation and abundance in cells
    Article Snippet: The divalent metal ions tested (Mg2+ , Mn2+ , Ca2+ and Zn2+ ) were added to assay buffer at a final concentration of 2.0 mM and combined with NOCT64–431 or CNOT6L158–555 . .. RNA substrate was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using an RNA Clean and Concentrator -25 Kit (Zymo Research).

    Article Title: Light Activation of Staphylococcus aureus Toxin YoeBSa1 Reveals Guanosine-Specific Endoribonuclease Activity
    Article Snippet: 1 μg linearized plasmid was used as template for standard RNA synthesis with the T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. .. RNase assays were performed according to a modified published method.

    Article Title: Efficacy and Immunogenicity of Unmodified and Pseudouridine-Modified mRNA Delivered Systemically with Lipid Nanoparticles in Vivo
    Article Snippet: DNA plasmids were linearized using restriction enzyme XbaI (New England Biolabs, Ipswich, MA) and transcribed using the HiScribe T7 RNA Synthesis Kit (New England Biolabs). .. All mRNAs were purified after the transcription and tailing steps using MEGAClear RNA purification columns (Life Technologies, Beverly, MA).

    Stripping Membranes:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Marker:

    Article Title: A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis
    Article Snippet: Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare). .. Briefly, 32 P-labeled 189 bp dsRNA was synthesized by T7 High Yield RNA Synthesis Kit (New England Biolabs) using pPD129.36 as the template and purified by G-50 MicroSpin columns (GE Healthcare).

    Gel Extraction:

    Article Title: Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao
    Article Snippet: The products for each sgRNA were cleaned using SpinSmart™ PCR Purification & Gel Extraction Kit (Denville Scientific, Holliston, MA). .. The templates were used to generate the sgRNAs using HiScribe T7 High Yield RNA Synthesis Kit (NEB) that were quantified using Qubit RNA BR Assay Kit (ThermoFisher Scientific, Waltham, MA).

    Fluorescence In Situ Hybridization:

    Article Title: Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues
    Article Snippet: The resulted F1 fish were genotyped to verify the mutations and then used for producing an F2 generation which was used for phenotypic screening. .. In brief, CRISPR targets were selected by combining NHGRI-1 and CRISPRscan target site predictions., Cas9 mRNA was synthesized using mMesage mMachine (Ambion) and guide RNA synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs high yield rna synthesis kit
    The ubiquitously-expressed E3 ubiquitin ligase UBR2 physically interacts with L1-ORF1p but does not regulate its abundance in the cerebrum. ( A ) Ubr2 transcript abundance in multiple adult tissues was determined from ENCODE <t>RNA</t> sequencing data GSE36025 ( Lin et al., 2014 ) by calculating the total number of reads mapped to the Ubr2 locus per million reads mapped in the dataset, and normalising this to the length of the Ubr2 locus. ( B, C ) Co-immunoprecipitations (co-IPs) from HEK293T cells co-transfected with T7 epitope-tagged hL1-ORF1p and mouse UBR2-GFP expression constructs. GFP alone was used as a negative control. ( D ) Genotyping of Ubr2 −/− mice. An Xba I restriction site and premature stop codon (asterisk) are introduced into exon 3 of Ubr2 by CRISPR/Cas9, and mice genotyped by amplifying a region encompassing exon 3 (primers indicated by arrows) and digesting the <t>PCR</t> product with Xba I. Three Ubr2 −/− mice, and Ubr2 +/+ and distilled water (dH 2 O) controls are shown. ( E ) Western blots showing endogenous UBR2 and mL1-ORF1p expression in Ubr2 +/+ and Ubr2 −/− mouse cerebrum. β-actin was used as a loading control. Positions of epitope-tagged proteins and pre-stained molecular weight markers in kD are indicated. Quantification of endogenous mL1-ORF1p abundance and L1 RNA abundance relative to β-actin in Ubr2 +/+ and Ubr2 −/− mouse cerebrum is also shown. Relative abundance was normalized to the mean of the Ubr2 +/+ control mice. Error bars indicate SEM, MW markers (kD for protein, bp for DNA) are shown beside blots and gels. No significant difference in either mL1-ORF1p or L1 RNA abundance was detected between wild-type and mutant tissue ( t -test, p=0.4 for mL1-ORF1p; -test, p=0.6 for L1 RNA). DOI: http://dx.doi.org/10.7554/eLife.26152.013
    High Yield Rna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high yield rna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    high yield rna synthesis kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    The ubiquitously-expressed E3 ubiquitin ligase UBR2 physically interacts with L1-ORF1p but does not regulate its abundance in the cerebrum. ( A ) Ubr2 transcript abundance in multiple adult tissues was determined from ENCODE RNA sequencing data GSE36025 ( Lin et al., 2014 ) by calculating the total number of reads mapped to the Ubr2 locus per million reads mapped in the dataset, and normalising this to the length of the Ubr2 locus. ( B, C ) Co-immunoprecipitations (co-IPs) from HEK293T cells co-transfected with T7 epitope-tagged hL1-ORF1p and mouse UBR2-GFP expression constructs. GFP alone was used as a negative control. ( D ) Genotyping of Ubr2 −/− mice. An Xba I restriction site and premature stop codon (asterisk) are introduced into exon 3 of Ubr2 by CRISPR/Cas9, and mice genotyped by amplifying a region encompassing exon 3 (primers indicated by arrows) and digesting the PCR product with Xba I. Three Ubr2 −/− mice, and Ubr2 +/+ and distilled water (dH 2 O) controls are shown. ( E ) Western blots showing endogenous UBR2 and mL1-ORF1p expression in Ubr2 +/+ and Ubr2 −/− mouse cerebrum. β-actin was used as a loading control. Positions of epitope-tagged proteins and pre-stained molecular weight markers in kD are indicated. Quantification of endogenous mL1-ORF1p abundance and L1 RNA abundance relative to β-actin in Ubr2 +/+ and Ubr2 −/− mouse cerebrum is also shown. Relative abundance was normalized to the mean of the Ubr2 +/+ control mice. Error bars indicate SEM, MW markers (kD for protein, bp for DNA) are shown beside blots and gels. No significant difference in either mL1-ORF1p or L1 RNA abundance was detected between wild-type and mutant tissue ( t -test, p=0.4 for mL1-ORF1p; -test, p=0.6 for L1 RNA). DOI: http://dx.doi.org/10.7554/eLife.26152.013

    Journal: eLife

    Article Title: Mobilization of LINE-1 retrotransposons is restricted byTex19.1 in mouse embryonic stem cells

    doi: 10.7554/eLife.26152

    Figure Lengend Snippet: The ubiquitously-expressed E3 ubiquitin ligase UBR2 physically interacts with L1-ORF1p but does not regulate its abundance in the cerebrum. ( A ) Ubr2 transcript abundance in multiple adult tissues was determined from ENCODE RNA sequencing data GSE36025 ( Lin et al., 2014 ) by calculating the total number of reads mapped to the Ubr2 locus per million reads mapped in the dataset, and normalising this to the length of the Ubr2 locus. ( B, C ) Co-immunoprecipitations (co-IPs) from HEK293T cells co-transfected with T7 epitope-tagged hL1-ORF1p and mouse UBR2-GFP expression constructs. GFP alone was used as a negative control. ( D ) Genotyping of Ubr2 −/− mice. An Xba I restriction site and premature stop codon (asterisk) are introduced into exon 3 of Ubr2 by CRISPR/Cas9, and mice genotyped by amplifying a region encompassing exon 3 (primers indicated by arrows) and digesting the PCR product with Xba I. Three Ubr2 −/− mice, and Ubr2 +/+ and distilled water (dH 2 O) controls are shown. ( E ) Western blots showing endogenous UBR2 and mL1-ORF1p expression in Ubr2 +/+ and Ubr2 −/− mouse cerebrum. β-actin was used as a loading control. Positions of epitope-tagged proteins and pre-stained molecular weight markers in kD are indicated. Quantification of endogenous mL1-ORF1p abundance and L1 RNA abundance relative to β-actin in Ubr2 +/+ and Ubr2 −/− mouse cerebrum is also shown. Relative abundance was normalized to the mean of the Ubr2 +/+ control mice. Error bars indicate SEM, MW markers (kD for protein, bp for DNA) are shown beside blots and gels. No significant difference in either mL1-ORF1p or L1 RNA abundance was detected between wild-type and mutant tissue ( t -test, p=0.4 for mL1-ORF1p; -test, p=0.6 for L1 RNA). DOI: http://dx.doi.org/10.7554/eLife.26152.013

    Article Snippet: Complementary oligonucleotides ( ) targeting exon 3 of UBR2 were annealed and cloned into plasmid pX335 , amplified by PCR, then in vitro transcribed using a T7 Quick High Yield RNA Synthesis kit (NEB) to generate paired guide RNAs.

    Techniques: RNA Sequencing Assay, Transfection, Expressing, Construct, Negative Control, Mouse Assay, CRISPR, Polymerase Chain Reaction, Western Blot, Staining, Molecular Weight, Mutagenesis

    Tex19.1 does not inhibit L1 translation. ( A ) qRT-PCR for A, T f and G f active subtypes of L1 in P16 testes. L1 subtype mRNA abundance was measured relative to β-actin, and normalised to the mean Tex19.1 +/− control level. Two animals for each genotype are shown. ( B ) Oligo(dT) pull-downs from P16 testes. Oligo(dT) cellulose beads were used to isolate poly(A) RNA from testis lysates, and associated proteins analysed by Western blotting with indicated antibodies. 200 or 500 µg poly(A) RNA was added as a competitor. The poly(A) RNA binding protein PABP1 was used as a positive control. TEX19.1 is not detectably associated with poly(A) RNA in testes. C. Sucrose density gradient enrichment of translation intermediates from P18 testes. The protein content of the fractions was monitored by reading absorbance at 254 nm, and peaks corresponding to messenger ribonucleoproteins (mRNPs), 40S ribosomal subunits, monosomes and polysomes are indicated. Western blots for TEX19.1, β-actin and PABP1 are shown for each fraction. TEX19.1 is not detectably associated with actively translating polysomes in testes. D. qRT-PCR for L1 mRNA in mRNP + 40S, monosome, and polysome fractions in sucrose gradients from Tex19.1 +/− and Tex19.1 −/− P18 testes. L1 mRNA abundance was measured relative to β-actin in each fraction, and normalized to one of the heterozygous control animals. A proportion of L1 mRNA associates with polysomes consistent with previous reports ( Tanaka et al., 2011 ). Meiotic arrest and increased spermatocyte death between P16 and P22 in Tex19.1 −/− testes ( Ollinger et al., 2008 ) may be generating some differences in testicular cell composition in these P18 samples and causing subtle differences in L1 mRNA distribution between Tex19.1 +/− and Tex19.1 −/− samples. However, there is no statistically significant increase in polysome-associated L1 mRNA in Tex19.1 −/− P18 testes (t-test, p=0.4). Error bars indicate SEM for technical replicates. DOI: http://dx.doi.org/10.7554/eLife.26152.004

    Journal: eLife

    Article Title: Mobilization of LINE-1 retrotransposons is restricted byTex19.1 in mouse embryonic stem cells

    doi: 10.7554/eLife.26152

    Figure Lengend Snippet: Tex19.1 does not inhibit L1 translation. ( A ) qRT-PCR for A, T f and G f active subtypes of L1 in P16 testes. L1 subtype mRNA abundance was measured relative to β-actin, and normalised to the mean Tex19.1 +/− control level. Two animals for each genotype are shown. ( B ) Oligo(dT) pull-downs from P16 testes. Oligo(dT) cellulose beads were used to isolate poly(A) RNA from testis lysates, and associated proteins analysed by Western blotting with indicated antibodies. 200 or 500 µg poly(A) RNA was added as a competitor. The poly(A) RNA binding protein PABP1 was used as a positive control. TEX19.1 is not detectably associated with poly(A) RNA in testes. C. Sucrose density gradient enrichment of translation intermediates from P18 testes. The protein content of the fractions was monitored by reading absorbance at 254 nm, and peaks corresponding to messenger ribonucleoproteins (mRNPs), 40S ribosomal subunits, monosomes and polysomes are indicated. Western blots for TEX19.1, β-actin and PABP1 are shown for each fraction. TEX19.1 is not detectably associated with actively translating polysomes in testes. D. qRT-PCR for L1 mRNA in mRNP + 40S, monosome, and polysome fractions in sucrose gradients from Tex19.1 +/− and Tex19.1 −/− P18 testes. L1 mRNA abundance was measured relative to β-actin in each fraction, and normalized to one of the heterozygous control animals. A proportion of L1 mRNA associates with polysomes consistent with previous reports ( Tanaka et al., 2011 ). Meiotic arrest and increased spermatocyte death between P16 and P22 in Tex19.1 −/− testes ( Ollinger et al., 2008 ) may be generating some differences in testicular cell composition in these P18 samples and causing subtle differences in L1 mRNA distribution between Tex19.1 +/− and Tex19.1 −/− samples. However, there is no statistically significant increase in polysome-associated L1 mRNA in Tex19.1 −/− P18 testes (t-test, p=0.4). Error bars indicate SEM for technical replicates. DOI: http://dx.doi.org/10.7554/eLife.26152.004

    Article Snippet: Complementary oligonucleotides ( ) targeting exon 3 of UBR2 were annealed and cloned into plasmid pX335 , amplified by PCR, then in vitro transcribed using a T7 Quick High Yield RNA Synthesis kit (NEB) to generate paired guide RNAs.

    Techniques: Quantitative RT-PCR, Western Blot, RNA Binding Assay, Positive Control, T-Test

    TEX19 orthologs interact with UBR2 and L1-ORF1p. ( A ) Co-immunoprecipitations (co-IPs) from stable HEK293 cell lines expressing either TEX19.1-YFP or YFP alone transiently transfected with FLAG-UBR2. Anti-YFP immunoprecipitates (IPs), inputs, and supernatants (SUP) were Western blotted with anti-FLAG and anti-YFP antibodies. ( B ) Reciprocal co-IP for panel A. HEK293T cells were transiently transfected with TEX19.1-YFP and either FLAG-UBR2 or FLAG alone, and anti-FLAG IPs and their inputs were Western blotted with anti-FLAG and anti-YFP antibodies. Positions of FLAG-UBR2, TEX19.1-YFP, YFP alone and pre-stained molecular weight markers in kD are indicated. ( C ) Co-immunoprecipitation from HEK293T cells co-transfected with TEX19.1-YFP and mCherry-tagged mL1-ORF1p expression constructs and IPd for mCherry. YFP or mCherry alone were used as negative controls. Anti-mCherry IP inputs and IPs were Western blotted with anti-mCherry or anti-YFP antibodies. Positions of pre-stained molecular weight markers in kD are indicated.( D ) Co-IPs from HEK293T cells co-transfected with epitope-tagged hL1-ORF1p and human TEX19-YFP expression constructs. YFP was used as a negative control. IP inputs and IPs were Western blotted with anti-T7 or anti-YFP antibodies. ( E ) Diagram showing the domain structure of mouse and human TEX19 orthologs. A conserved TEX19 domain is present at the N-terminus of both proteins, but the C-terminal region of mouse TEX19.1 is not conserved in the truncated human TEX19 protein. ( F ) Mouse L1-ORF1 RA p mutants used to test for RNA-independent interactions have impaired mobilization. Plates of G418-resistant colonies from L1 retrotransposition assays in HeLa cells. Assays for mouse L1 (pCEPL1SM-T7) and mouse L1 carrying the R297A and R298A mutations in the RNA binding domain of ORF1p that reduce its affinity for RNA ( Martin et al., 2005 ) (pCEPL1SM-T7-ORF1 RA ). DOI: http://dx.doi.org/10.7554/eLife.26152.006

    Journal: eLife

    Article Title: Mobilization of LINE-1 retrotransposons is restricted byTex19.1 in mouse embryonic stem cells

    doi: 10.7554/eLife.26152

    Figure Lengend Snippet: TEX19 orthologs interact with UBR2 and L1-ORF1p. ( A ) Co-immunoprecipitations (co-IPs) from stable HEK293 cell lines expressing either TEX19.1-YFP or YFP alone transiently transfected with FLAG-UBR2. Anti-YFP immunoprecipitates (IPs), inputs, and supernatants (SUP) were Western blotted with anti-FLAG and anti-YFP antibodies. ( B ) Reciprocal co-IP for panel A. HEK293T cells were transiently transfected with TEX19.1-YFP and either FLAG-UBR2 or FLAG alone, and anti-FLAG IPs and their inputs were Western blotted with anti-FLAG and anti-YFP antibodies. Positions of FLAG-UBR2, TEX19.1-YFP, YFP alone and pre-stained molecular weight markers in kD are indicated. ( C ) Co-immunoprecipitation from HEK293T cells co-transfected with TEX19.1-YFP and mCherry-tagged mL1-ORF1p expression constructs and IPd for mCherry. YFP or mCherry alone were used as negative controls. Anti-mCherry IP inputs and IPs were Western blotted with anti-mCherry or anti-YFP antibodies. Positions of pre-stained molecular weight markers in kD are indicated.( D ) Co-IPs from HEK293T cells co-transfected with epitope-tagged hL1-ORF1p and human TEX19-YFP expression constructs. YFP was used as a negative control. IP inputs and IPs were Western blotted with anti-T7 or anti-YFP antibodies. ( E ) Diagram showing the domain structure of mouse and human TEX19 orthologs. A conserved TEX19 domain is present at the N-terminus of both proteins, but the C-terminal region of mouse TEX19.1 is not conserved in the truncated human TEX19 protein. ( F ) Mouse L1-ORF1 RA p mutants used to test for RNA-independent interactions have impaired mobilization. Plates of G418-resistant colonies from L1 retrotransposition assays in HeLa cells. Assays for mouse L1 (pCEPL1SM-T7) and mouse L1 carrying the R297A and R298A mutations in the RNA binding domain of ORF1p that reduce its affinity for RNA ( Martin et al., 2005 ) (pCEPL1SM-T7-ORF1 RA ). DOI: http://dx.doi.org/10.7554/eLife.26152.006

    Article Snippet: Complementary oligonucleotides ( ) targeting exon 3 of UBR2 were annealed and cloned into plasmid pX335 , amplified by PCR, then in vitro transcribed using a T7 Quick High Yield RNA Synthesis kit (NEB) to generate paired guide RNAs.

    Techniques: Expressing, Transfection, Western Blot, Co-Immunoprecipitation Assay, Staining, Molecular Weight, Immunoprecipitation, Construct, Negative Control, RNA Binding Assay

    Tex19.1 expression is not detectable in brain. qRT-PCR for Tex19.1 in brain from wild-type mice. Cerebrum and cerebellum were isolated at P16. Embryonic placenta (E12.5) was used as a positive control. RNA abundance is expressed relative to β-actin, expression in two independent animals is shown. DOI: http://dx.doi.org/10.7554/eLife.26152.014

    Journal: eLife

    Article Title: Mobilization of LINE-1 retrotransposons is restricted byTex19.1 in mouse embryonic stem cells

    doi: 10.7554/eLife.26152

    Figure Lengend Snippet: Tex19.1 expression is not detectable in brain. qRT-PCR for Tex19.1 in brain from wild-type mice. Cerebrum and cerebellum were isolated at P16. Embryonic placenta (E12.5) was used as a positive control. RNA abundance is expressed relative to β-actin, expression in two independent animals is shown. DOI: http://dx.doi.org/10.7554/eLife.26152.014

    Article Snippet: Complementary oligonucleotides ( ) targeting exon 3 of UBR2 were annealed and cloned into plasmid pX335 , amplified by PCR, then in vitro transcribed using a T7 Quick High Yield RNA Synthesis kit (NEB) to generate paired guide RNAs.

    Techniques: Expressing, Quantitative RT-PCR, Mouse Assay, Isolation, Positive Control

    Schematic diagram of the padlock probe-based isothermal amplification assay for analyzing RNA splicing. (1) Nuclear extracts (NE) containing spliceosome complex are separated from HeLa cells for an in vitro RNA splicing assay. U1, U2, U4, U5 and U6 are major small nuclear ribonucleoproteins (snRNPs) that form the catalytic core of the spliceosome. (2) Under the catalysis of the spliceosome complex, the free 5′-exon is generated in the first step. In the second step, the free 5′-exon attacks the 3′ splice site, yielding ligated exons (spliced mRNA). (3) Padlock probes 1 (green) and 2 (red) are designed to specifically hybridize to the free 5′-exon and spliced mRNA, respectively. (4) Following these two recognition processes of the padlock probes, the amplified assay is realized through ligation, rolling circle amplification and nicking endonuclease-assisted fluorescence signal amplification.

    Journal: Chemical Science

    Article Title: RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336aClick here for additional data file.

    doi: 10.1039/c7sc01336a

    Figure Lengend Snippet: Schematic diagram of the padlock probe-based isothermal amplification assay for analyzing RNA splicing. (1) Nuclear extracts (NE) containing spliceosome complex are separated from HeLa cells for an in vitro RNA splicing assay. U1, U2, U4, U5 and U6 are major small nuclear ribonucleoproteins (snRNPs) that form the catalytic core of the spliceosome. (2) Under the catalysis of the spliceosome complex, the free 5′-exon is generated in the first step. In the second step, the free 5′-exon attacks the 3′ splice site, yielding ligated exons (spliced mRNA). (3) Padlock probes 1 (green) and 2 (red) are designed to specifically hybridize to the free 5′-exon and spliced mRNA, respectively. (4) Following these two recognition processes of the padlock probes, the amplified assay is realized through ligation, rolling circle amplification and nicking endonuclease-assisted fluorescence signal amplification.

    Article Snippet: Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB).

    Techniques: Amplification, In Vitro, Splicing Assay, Generated, Ligation, Fluorescence

    Comparison of the padlock probe-based isothermal amplification assay with the RT-PCR assay for detection of the two-step RNA splicing products. The major difference is that the amplified assay can be used for simultaneous detection of the intermediate and final products, while RT-PCR could not detect the intermediate products. (a) Fluorescence responses of the isothermal amplified assay under different conditions: in vitro splicing assays were conducted in the presence of NE (red curve) or absence of NE (black curve). The splicing products were analysed by the padlock probe-based isothermal amplified assay. (b) Gel electrophoresis of the RT-PCR products for in vitro RNA splicing: 40 pM CDC pre-mRNA was incubated in the presence of NE (lane 1) or absence of NE (lane 2) for 1 h at 30 °C under the conditions of in vitro RNA splicing; lane 3, spliced mRNA; lane 4, NE.

    Journal: Chemical Science

    Article Title: RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336aClick here for additional data file.

    doi: 10.1039/c7sc01336a

    Figure Lengend Snippet: Comparison of the padlock probe-based isothermal amplification assay with the RT-PCR assay for detection of the two-step RNA splicing products. The major difference is that the amplified assay can be used for simultaneous detection of the intermediate and final products, while RT-PCR could not detect the intermediate products. (a) Fluorescence responses of the isothermal amplified assay under different conditions: in vitro splicing assays were conducted in the presence of NE (red curve) or absence of NE (black curve). The splicing products were analysed by the padlock probe-based isothermal amplified assay. (b) Gel electrophoresis of the RT-PCR products for in vitro RNA splicing: 40 pM CDC pre-mRNA was incubated in the presence of NE (lane 1) or absence of NE (lane 2) for 1 h at 30 °C under the conditions of in vitro RNA splicing; lane 3, spliced mRNA; lane 4, NE.

    Article Snippet: Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB).

    Techniques: Amplification, Reverse Transcription Polymerase Chain Reaction, Fluorescence, In Vitro, Nucleic Acid Electrophoresis, Incubation

    The amplified assay for quantification of the two-step RNA splicing products. (a and c) Fluorescence emission spectra in the presence of different concentrations of free 5′-exon and spliced mRNA (from top to bottom: 20 pM, 10 pM, 5 pM, 1 pM, 100 fM, and control). (b) Linear relationship between the fluorescence intensities at 660 nm and concentrations of free 5′-exon in (a). (d) Linear relationship between the fluorescence intensities at 520 nm and concentrations of spliced mRNA in (c). Error bars are based on triplicate experiments. The concentrations of padlock probe, Bst polymerase and Nb.Mva1269I were 10 nM, 5 U and 10 U, respectively.

    Journal: Chemical Science

    Article Title: RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336aClick here for additional data file.

    doi: 10.1039/c7sc01336a

    Figure Lengend Snippet: The amplified assay for quantification of the two-step RNA splicing products. (a and c) Fluorescence emission spectra in the presence of different concentrations of free 5′-exon and spliced mRNA (from top to bottom: 20 pM, 10 pM, 5 pM, 1 pM, 100 fM, and control). (b) Linear relationship between the fluorescence intensities at 660 nm and concentrations of free 5′-exon in (a). (d) Linear relationship between the fluorescence intensities at 520 nm and concentrations of spliced mRNA in (c). Error bars are based on triplicate experiments. The concentrations of padlock probe, Bst polymerase and Nb.Mva1269I were 10 nM, 5 U and 10 U, respectively.

    Article Snippet: Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB).

    Techniques: Amplification, Fluorescence

    Effect of ASO binding sites on first- and second-step RNA splicing efficiency. (a) Diagrammatic representation of ASO targeting sequences (5′-ASO, Mid1-ASO, Mid2-ASO, BP-ASO and 3′-ASO). Numbering starts from the first position of intron 14. The 5′ss and 3′ss are indicated by vertical arrows. The branchpoint is indicated in red. (b) Fluorescence intensity of free 5′-exon and spliced mRNA produced in the splicing reaction by adding different ASOs. (c) Schematic diagram of the splicing block caused by ASOs binding different sites.

    Journal: Chemical Science

    Article Title: RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336aClick here for additional data file.

    doi: 10.1039/c7sc01336a

    Figure Lengend Snippet: Effect of ASO binding sites on first- and second-step RNA splicing efficiency. (a) Diagrammatic representation of ASO targeting sequences (5′-ASO, Mid1-ASO, Mid2-ASO, BP-ASO and 3′-ASO). Numbering starts from the first position of intron 14. The 5′ss and 3′ss are indicated by vertical arrows. The branchpoint is indicated in red. (b) Fluorescence intensity of free 5′-exon and spliced mRNA produced in the splicing reaction by adding different ASOs. (c) Schematic diagram of the splicing block caused by ASOs binding different sites.

    Article Snippet: Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB).

    Techniques: Allele-specific Oligonucleotide, Binding Assay, Fluorescence, Produced, Blocking Assay

    The specificity of the amplified assay for the detection of different RNA splicing products: (a) free 5′-exon and (b) spliced mRNA. Padlock probes 1 and 2 were incubated with 20 pM free 5′-exon, CDC pre-mRNA and spliced mRNA, respectively.

    Journal: Chemical Science

    Article Title: RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336aClick here for additional data file.

    doi: 10.1039/c7sc01336a

    Figure Lengend Snippet: The specificity of the amplified assay for the detection of different RNA splicing products: (a) free 5′-exon and (b) spliced mRNA. Padlock probes 1 and 2 were incubated with 20 pM free 5′-exon, CDC pre-mRNA and spliced mRNA, respectively.

    Article Snippet: Chicken δ-crystallin (CDC) mRNA was transcribed in vitro by a HiScribeTM T7 Quick High Yield RNA Synthesis Kit (purchased from NEB).

    Techniques: Amplification, Incubation

    Long ssRNA changes the mechanical property of dsDNA. ( A ) Representative single force extension curves of λ dsDNA in the presence or absence of long ssRNA 6L (DNA:RNA mol ratio = 1:1000); ( B ) a zoom-in curve of (A). The dashed brackets indicate the low force region (0.3–0.7 pN). The grey lines indicate the linear trend lines at this region, by which the slopes in Figures 3 and 4 are calculated.

    Journal: Nucleic Acids Research

    Article Title: Single molecule identification of homology-dependent interactions between long ssRNA and dsDNA

    doi: 10.1093/nar/gkw758

    Figure Lengend Snippet: Long ssRNA changes the mechanical property of dsDNA. ( A ) Representative single force extension curves of λ dsDNA in the presence or absence of long ssRNA 6L (DNA:RNA mol ratio = 1:1000); ( B ) a zoom-in curve of (A). The dashed brackets indicate the low force region (0.3–0.7 pN). The grey lines indicate the linear trend lines at this region, by which the slopes in Figures 3 and 4 are calculated.

    Article Snippet: Other RNAs (Figure ) were transcribed in vitro using T7 Quick High Yield RNA Synthesis Kit (NEB) and DNA templates prepared by amplification with Crimson LongAmp® Taq DNA polymerase (NEB).

    Techniques:

    Schematic diagram of the experimental design. ( A ) Schematic representation of the assay for measuring the extension of dsDNA due to the binding of RNA. ( B ) Sequences to which analyzed RNAs are homologous. 6L = 6,396-nt low G+C content RNA and 6H = 6,107-nt high G+C content RNA; positions shown relative to full length λ DNA template (black line). 1K = a 1025-nt subsegment of 6L. 416, 130 and 40 are subsegments of 1K. Gray lines denote ssRNAs. A predicted nucleic acid triple helices target site in the 40nt RNA is bold and underlined within the total sequence.

    Journal: Nucleic Acids Research

    Article Title: Single molecule identification of homology-dependent interactions between long ssRNA and dsDNA

    doi: 10.1093/nar/gkw758

    Figure Lengend Snippet: Schematic diagram of the experimental design. ( A ) Schematic representation of the assay for measuring the extension of dsDNA due to the binding of RNA. ( B ) Sequences to which analyzed RNAs are homologous. 6L = 6,396-nt low G+C content RNA and 6H = 6,107-nt high G+C content RNA; positions shown relative to full length λ DNA template (black line). 1K = a 1025-nt subsegment of 6L. 416, 130 and 40 are subsegments of 1K. Gray lines denote ssRNAs. A predicted nucleic acid triple helices target site in the 40nt RNA is bold and underlined within the total sequence.

    Article Snippet: Other RNAs (Figure ) were transcribed in vitro using T7 Quick High Yield RNA Synthesis Kit (NEB) and DNA templates prepared by amplification with Crimson LongAmp® Taq DNA polymerase (NEB).

    Techniques: Binding Assay, Sequencing

    The effect of long ssRNA on dsDNA extension at low force (e.g. Figure 2B ) is dependent on concentration, homology, and length. Box-and-whisker plots (see Materials and Methods) show the slopes of the low force–extension curves (Figure 2B ) of the indicated samples. ( A ) DNA:RNA molar ratio was varied from 1:1 to 1:10 5 . Statistical analysis (asterisks) compared 1:1 versus all other ratios. ( B ) The effects of non-homologous ssRNA controls. Fluc is a 1766-nt control transcript provided in the T7 Quick High Yield RNA Synthesis Kit, showing 43% identity with the 37 441–39 524 region of the genome of λ dsDNA. Y-RNA is the total RNA of S. cerevisiae strain. For 6KM13, bacteriophage M13mp18 circular ssDNA ∼7200 nt was amplified as the template for in vitro transcription. The resulting ssRNA is 6001 nt and presents 44% identity with the genome of λ dsDNA (region 22 893–31 255). 6L and 6H are ∼6k nt species homologous to adjacent regions of λ dsDNA (Figure 1B ). DNA:RNA molar ratio = 1:1000 in all samples; statistical analysis was performed for the ratio of λ dsDNA alone versus all other ratios. ( C ) The effects of various lengths of ssRNA (described in Figure 1B ), DNA:RNA molar ratio = 1:1000. (a, b, c) n = 10, * P

    Journal: Nucleic Acids Research

    Article Title: Single molecule identification of homology-dependent interactions between long ssRNA and dsDNA

    doi: 10.1093/nar/gkw758

    Figure Lengend Snippet: The effect of long ssRNA on dsDNA extension at low force (e.g. Figure 2B ) is dependent on concentration, homology, and length. Box-and-whisker plots (see Materials and Methods) show the slopes of the low force–extension curves (Figure 2B ) of the indicated samples. ( A ) DNA:RNA molar ratio was varied from 1:1 to 1:10 5 . Statistical analysis (asterisks) compared 1:1 versus all other ratios. ( B ) The effects of non-homologous ssRNA controls. Fluc is a 1766-nt control transcript provided in the T7 Quick High Yield RNA Synthesis Kit, showing 43% identity with the 37 441–39 524 region of the genome of λ dsDNA. Y-RNA is the total RNA of S. cerevisiae strain. For 6KM13, bacteriophage M13mp18 circular ssDNA ∼7200 nt was amplified as the template for in vitro transcription. The resulting ssRNA is 6001 nt and presents 44% identity with the genome of λ dsDNA (region 22 893–31 255). 6L and 6H are ∼6k nt species homologous to adjacent regions of λ dsDNA (Figure 1B ). DNA:RNA molar ratio = 1:1000 in all samples; statistical analysis was performed for the ratio of λ dsDNA alone versus all other ratios. ( C ) The effects of various lengths of ssRNA (described in Figure 1B ), DNA:RNA molar ratio = 1:1000. (a, b, c) n = 10, * P

    Article Snippet: Other RNAs (Figure ) were transcribed in vitro using T7 Quick High Yield RNA Synthesis Kit (NEB) and DNA templates prepared by amplification with Crimson LongAmp® Taq DNA polymerase (NEB).

    Techniques: Concentration Assay, Whisker Assay, Amplification, In Vitro

    Overstretching (o/s) abolishes the effect of long ssRNA. ( A ) Representative force extension curves in the presence or absence of ssRNA 6L (DNA:RNA mol ratio = 1:1000). One bead/dsDNA ensemble was initially followed and extended till about 10 pN (black solid curve). Subsequently a small tip was placed on the stack of magnets to achieve forces till about 70 pN (Materials and Methods; text). This bead/dsDNA exhibited a sudden change in extension that corresponds to the overstretching transition (not shown). The magnet was then slowly moved away from the glass surface to allow the molecule to recoil, and the tip was removed from the stack of magnets. Finally a second curve was measured with the stack of magnets up to a force of about 10 pN (gray curve). A typical force–extension curve for λ dsDNA in the absence of RNA is shown for comparison (dashed curve). The dashed bracket indicates the low force region (0.3–0.7 pN). ( B ) The box-and-whisker plot (Materials and Methods) displays the slope changes at low force region (0.3–0.7 pN) before or after overstretching (o/s). The statistical analysis was performed for λ dsDNA before overstretching versus all other samples. n = 10, *** P

    Journal: Nucleic Acids Research

    Article Title: Single molecule identification of homology-dependent interactions between long ssRNA and dsDNA

    doi: 10.1093/nar/gkw758

    Figure Lengend Snippet: Overstretching (o/s) abolishes the effect of long ssRNA. ( A ) Representative force extension curves in the presence or absence of ssRNA 6L (DNA:RNA mol ratio = 1:1000). One bead/dsDNA ensemble was initially followed and extended till about 10 pN (black solid curve). Subsequently a small tip was placed on the stack of magnets to achieve forces till about 70 pN (Materials and Methods; text). This bead/dsDNA exhibited a sudden change in extension that corresponds to the overstretching transition (not shown). The magnet was then slowly moved away from the glass surface to allow the molecule to recoil, and the tip was removed from the stack of magnets. Finally a second curve was measured with the stack of magnets up to a force of about 10 pN (gray curve). A typical force–extension curve for λ dsDNA in the absence of RNA is shown for comparison (dashed curve). The dashed bracket indicates the low force region (0.3–0.7 pN). ( B ) The box-and-whisker plot (Materials and Methods) displays the slope changes at low force region (0.3–0.7 pN) before or after overstretching (o/s). The statistical analysis was performed for λ dsDNA before overstretching versus all other samples. n = 10, *** P

    Article Snippet: Other RNAs (Figure ) were transcribed in vitro using T7 Quick High Yield RNA Synthesis Kit (NEB) and DNA templates prepared by amplification with Crimson LongAmp® Taq DNA polymerase (NEB).

    Techniques: Whisker Assay

    Messenger RNA with a 5’-poly(A) leader is more efficiently translated than mRNA without a 5’-poly(A) leader in VACV-infected cells. (A) HeLa cells were transfected with plasmids expressing eGFP from a T7 promoter and containing an A-tract or a Kozak sequence between the ATG and the T7 promoter. Cells were infected with vT7LacOi 24 h post transfection and different concentrations of IPTG were added to the media as indicated. At 24 hpi, Western blotting tracked eGFP and GAPDH (loading control) expression levels; and eGFP intensity was normalized to GAPDH, shown below. (B) Levels of eGFP mRNA levels for (A) were measured by qRT-PCR, and normalized to 18S rRNA. (C) HeLa cells were infected with recombinant VACV vT7LacOi_Kozak-GFP or vT7LacOi_A12-GFP. Indicated concentrations of IPTG were added to the culture media. At 24 hpi Western blotting tracked eGFP and GAPDH (normalization and loading control) expression, shown below. (D) Levels of eGFP mRNA expression of (C) were measured by qRT-PCR, and normalized to 18S rRNA. (E) HeLa cells were infected with vT7LacOi_A12-GFP or vT7LacOi_Kozak-GFP. Total and ribosome/polysome-bound RNAs were isolated at 15 hpi. The GFP and F17 mRNAs were measured by qRT-PCR and normalized to 18S rRNA. The ratios of ribosome/polysome-bound mRNA to total mRNA were calculated for GFP and F17, respectively. The ratios from vT7LacOi_A12-GFP-infected cells were normalized to one. **indicates a P value

    Journal: PLoS Pathogens

    Article Title: The 5'-poly(A) leader of poxvirus mRNA confers a translational advantage that can be achieved in cells with impaired cap-dependent translation

    doi: 10.1371/journal.ppat.1006602

    Figure Lengend Snippet: Messenger RNA with a 5’-poly(A) leader is more efficiently translated than mRNA without a 5’-poly(A) leader in VACV-infected cells. (A) HeLa cells were transfected with plasmids expressing eGFP from a T7 promoter and containing an A-tract or a Kozak sequence between the ATG and the T7 promoter. Cells were infected with vT7LacOi 24 h post transfection and different concentrations of IPTG were added to the media as indicated. At 24 hpi, Western blotting tracked eGFP and GAPDH (loading control) expression levels; and eGFP intensity was normalized to GAPDH, shown below. (B) Levels of eGFP mRNA levels for (A) were measured by qRT-PCR, and normalized to 18S rRNA. (C) HeLa cells were infected with recombinant VACV vT7LacOi_Kozak-GFP or vT7LacOi_A12-GFP. Indicated concentrations of IPTG were added to the culture media. At 24 hpi Western blotting tracked eGFP and GAPDH (normalization and loading control) expression, shown below. (D) Levels of eGFP mRNA expression of (C) were measured by qRT-PCR, and normalized to 18S rRNA. (E) HeLa cells were infected with vT7LacOi_A12-GFP or vT7LacOi_Kozak-GFP. Total and ribosome/polysome-bound RNAs were isolated at 15 hpi. The GFP and F17 mRNAs were measured by qRT-PCR and normalized to 18S rRNA. The ratios of ribosome/polysome-bound mRNA to total mRNA were calculated for GFP and F17, respectively. The ratios from vT7LacOi_A12-GFP-infected cells were normalized to one. **indicates a P value

    Article Snippet: The synthesized DNA was used as template to generate RNA using a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs).

    Techniques: Infection, Transfection, Expressing, Sequencing, Western Blot, Quantitative RT-PCR, Recombinant, Isolation

    The 5’ poly(A) leader confers an mRNA translational advantage during the post-replicative stage of VACV replication. (A) Schematic of experimental approach. Messenger RNA was synthesized by a T7 promoter-based in vitro transcription system. The firefly luciferase (Fluc) reporter mRNA under a 5’-UTR to be tested was transfected into cells together with a renilla luciferase (Rluc) reporter mRNA under a 5’-UTR-containing Kozak sequence. Luciferase activities were measured at 5 h post transfection using a luminometer with a dual luciferase assay system. (B) Fluc mRNA with a 5’-poly(A) leader of 20 residues was transfected into uninfected or wild-type VACV-infected HeLa cells (12 hpi) together with an Rluc mRNA. Luciferase activities were measured at 5 h post transfection. The Rluc-normalized Fluc activity was normalized as 1 in uninfected HeLa cells. (C) The relative levels of Fluc mRNA from uninfected and VACV-infected HeLa cells were quantitated at 5 h post transfection by quantitative RT-PCR (qRT-PCR). The amount of mRNA in uninfected cells was normalized as 1. (D) Fluc mRNA with a 5’-poly(A) leader of 20 residues was transfected into uninfected, or A23-deleted recombinant VACV-infected HeLa cells (12 hpi) together with an Rluc mRNA. Luciferase activities were measured at 5 h post transfection. The Rluc-normalized Fluc activity was normalized as 1 in uninfected HeLa cells. Error bars represent standard deviation (SD) of at least three experiments. P-values were obtained using the Student’s t-test; **P value

    Journal: PLoS Pathogens

    Article Title: The 5'-poly(A) leader of poxvirus mRNA confers a translational advantage that can be achieved in cells with impaired cap-dependent translation

    doi: 10.1371/journal.ppat.1006602

    Figure Lengend Snippet: The 5’ poly(A) leader confers an mRNA translational advantage during the post-replicative stage of VACV replication. (A) Schematic of experimental approach. Messenger RNA was synthesized by a T7 promoter-based in vitro transcription system. The firefly luciferase (Fluc) reporter mRNA under a 5’-UTR to be tested was transfected into cells together with a renilla luciferase (Rluc) reporter mRNA under a 5’-UTR-containing Kozak sequence. Luciferase activities were measured at 5 h post transfection using a luminometer with a dual luciferase assay system. (B) Fluc mRNA with a 5’-poly(A) leader of 20 residues was transfected into uninfected or wild-type VACV-infected HeLa cells (12 hpi) together with an Rluc mRNA. Luciferase activities were measured at 5 h post transfection. The Rluc-normalized Fluc activity was normalized as 1 in uninfected HeLa cells. (C) The relative levels of Fluc mRNA from uninfected and VACV-infected HeLa cells were quantitated at 5 h post transfection by quantitative RT-PCR (qRT-PCR). The amount of mRNA in uninfected cells was normalized as 1. (D) Fluc mRNA with a 5’-poly(A) leader of 20 residues was transfected into uninfected, or A23-deleted recombinant VACV-infected HeLa cells (12 hpi) together with an Rluc mRNA. Luciferase activities were measured at 5 h post transfection. The Rluc-normalized Fluc activity was normalized as 1 in uninfected HeLa cells. Error bars represent standard deviation (SD) of at least three experiments. P-values were obtained using the Student’s t-test; **P value

    Article Snippet: The synthesized DNA was used as template to generate RNA using a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs).

    Techniques: Synthesized, In Vitro, Luciferase, Transfection, Sequencing, Infection, Activity Assay, Quantitative RT-PCR, Recombinant, Standard Deviation