Structured Review

Thermo Fisher hindiii
DNA fingerprint profiles of strains M6 and 7a1, and their variants. A . Pulse field gel electrophoresis (PFGE) following digestion with XbaI, SpeI and <t>HindIII.</t> B . repetitive-PCR profiling by REP-, BOX- and ERIC-PCR. Lines: L , ladder; 1 , M6; 2 , M6V1; 3 , M6V2; 4 , 7a1; 5 , 7a1V1; 6 , 7a1V2. Arrows indicate differences between some of the variants and their parental strain. Results are representative from at least two independent runs with similar results for each method.
Hindiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hindiii/product/Thermo Fisher
Average 99 stars, based on 72 article reviews
Price from $9.99 to $1999.99
hindiii - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli"

Article Title: Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli

Journal: PLoS ONE

doi: 10.1371/journal.pone.0073189

DNA fingerprint profiles of strains M6 and 7a1, and their variants. A . Pulse field gel electrophoresis (PFGE) following digestion with XbaI, SpeI and HindIII. B . repetitive-PCR profiling by REP-, BOX- and ERIC-PCR. Lines: L , ladder; 1 , M6; 2 , M6V1; 3 , M6V2; 4 , 7a1; 5 , 7a1V1; 6 , 7a1V2. Arrows indicate differences between some of the variants and their parental strain. Results are representative from at least two independent runs with similar results for each method.
Figure Legend Snippet: DNA fingerprint profiles of strains M6 and 7a1, and their variants. A . Pulse field gel electrophoresis (PFGE) following digestion with XbaI, SpeI and HindIII. B . repetitive-PCR profiling by REP-, BOX- and ERIC-PCR. Lines: L , ladder; 1 , M6; 2 , M6V1; 3 , M6V2; 4 , 7a1; 5 , 7a1V1; 6 , 7a1V2. Arrows indicate differences between some of the variants and their parental strain. Results are representative from at least two independent runs with similar results for each method.

Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction

2) Product Images from "Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)"

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

Journal: 3 Biotech

doi: 10.1007/s13205-018-1552-0

Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
Figure Legend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

Techniques Used: Southern Blot, Molecular Weight, Marker, Hybridization

3) Product Images from "RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance"

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance

Journal: Biotechnology Reports

doi: 10.1016/j.btre.2019.e00383

Southern hybridisation of total DNA from transgenic cassava cv.60444 transformed with SACMV AC1AC4 construct, digested with restriction enzymes EcoRI and HindIII, and hybridized with DNA probe specific to Hyg gene. Lane M: DIG-labelled molecular weight parker (ThermoFisher Scientific), lane 1-16: independent transgenic cassava lines. Purified binary vector pC1305.1-AC1/AC4 and wild-type untransformed cv.60444 were included as positive (+) and negative (-) controls respectively.
Figure Legend Snippet: Southern hybridisation of total DNA from transgenic cassava cv.60444 transformed with SACMV AC1AC4 construct, digested with restriction enzymes EcoRI and HindIII, and hybridized with DNA probe specific to Hyg gene. Lane M: DIG-labelled molecular weight parker (ThermoFisher Scientific), lane 1-16: independent transgenic cassava lines. Purified binary vector pC1305.1-AC1/AC4 and wild-type untransformed cv.60444 were included as positive (+) and negative (-) controls respectively.

Techniques Used: Hybridization, Transgenic Assay, Transformation Assay, Construct, Molecular Weight, Purification, Plasmid Preparation

4) Product Images from "An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿"

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿

Journal:

doi: 10.1128/CVI.00486-08

Expression and purification of rCM fusion protein. (A) Map of pPro2164 and the fusion gene encoding the predicted mature forms of CFP21 and MPT64, with a 45-bp linker, which was cloned into the BamHI and HindIII sites of pProExHTb, resulting in the recombinant
Figure Legend Snippet: Expression and purification of rCM fusion protein. (A) Map of pPro2164 and the fusion gene encoding the predicted mature forms of CFP21 and MPT64, with a 45-bp linker, which was cloned into the BamHI and HindIII sites of pProExHTb, resulting in the recombinant

Techniques Used: Expressing, Purification, Clone Assay, Recombinant

Related Articles

Clone Assay:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Amplification:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Agarose Gel Electrophoresis:

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: .. Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE. .. The DNA was then transferred to positively charged nylon Hybond-N + membrane (Amersham), pre-hybridised at 38 °C, and hybridised at 64 °C overnight with a DIG-labelled Hyg gene probe, which was labelled using the DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche).

Southern Blot:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Paragraph title: Southern blot analysis ... Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: Paragraph title: Southern blot hybridisation ... Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE.

Nucleic Acid Electrophoresis:

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: .. Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE. .. The DNA was then transferred to positively charged nylon Hybond-N + membrane (Amersham), pre-hybridised at 38 °C, and hybridised at 64 °C overnight with a DIG-labelled Hyg gene probe, which was labelled using the DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche).

Lambda DNA Preparation:

Article Title: Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli
Article Snippet: The restriction mixture of HindIII was prepared with 15 µl of 10Xbuffer Tango, 1.5 µl of buffer R (Fermentas), 2 µl of HindIII (10 U/µl; Fermentas) and 121.5 µl of sDDW. .. Concatemeric lambda DNA (NEB) was used as a marker.

Labeling:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Sequencing:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: In the schematic, linker sequences containing restriction enzyme recognition sites are underlined and their identities indicated following each sequence. .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol.

Transgenic Assay:

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: 2.2.3 Southern blot hybridisation In order to determine the number of transgene integration events in the 14 transgenic lines, Southern blot hybridisation was carried out using DIG-High Prime DNA Labelling and Detection Starter Kit II (ThermoFisher Scientific) according to the manufacturer's instructions. .. Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE.

Incubation:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The nylon membrane blocked with DIG Easy Hyb was subsequently hybridized with DIG labeled STS probe in a hybridization chamber and incubated at 65 °C for 15 h. This was followed by repeated washing of the hybridized nylon membrane with 0.1× SSC buffer (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate.

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE. .. Any unbound probe was washed from the membrane by sequential washing with buffers 2xSDS, 0.1% SDS twice, and 0.1xSDS, 0.1% SDS buffer twice (incubated at 40 °C).

Polymerase Chain Reaction:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Construct:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: Paragraph title: GST fusion expression constructs ... The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol.

Expressing:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: Paragraph title: GST fusion expression constructs ... The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol.

DNA Labeling:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Marker:

Article Title: Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli
Article Snippet: The restriction mixture of HindIII was prepared with 15 µl of 10Xbuffer Tango, 1.5 µl of buffer R (Fermentas), 2 µl of HindIII (10 U/µl; Fermentas) and 121.5 µl of sDDW. .. Concatemeric lambda DNA (NEB) was used as a marker.

Transformation Assay:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. After transformation of DH5α E. coli, clones with cDNA inserts in the appropriate orientation were selected by restriction endonuclease mapping.

Hybridization:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The nylon membrane blocked with DIG Easy Hyb was subsequently hybridized with DIG labeled STS probe in a hybridization chamber and incubated at 65 °C for 15 h. This was followed by repeated washing of the hybridized nylon membrane with 0.1× SSC buffer (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate.

Article Title: RNA silencing of South African cassava mosaic virus in transgenic cassava expressing AC1/AC4 hp- RNA induces tolerance
Article Snippet: Paragraph title: Southern blot hybridisation ... Twenty micrograms of DNA from each line was digested overnight with HindIII (15053–15059) which cuts once in the cassette, and EcoRI, restriction enzymes (ThermoFisher Scientific) and separated using gel electrophoresis, in a 1% agarose gel in 1X TAE.

Pulsed-Field Gel:

Article Title: Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli
Article Snippet: Paragraph title: Pulsed-field gel electrophoresis (PFGE) ... The restriction mixture of HindIII was prepared with 15 µl of 10Xbuffer Tango, 1.5 µl of buffer R (Fermentas), 2 µl of HindIII (10 U/µl; Fermentas) and 121.5 µl of sDDW.

DNA Sequencing:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher hindiii
    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and <t>HindIII,</t> enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII
    Hindiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii/product/Thermo Fisher
    Average 90 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher fastdigest hindiii
    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and <t>HindIII,</t> enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII
    Fastdigest Hindiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest hindiii/product/Thermo Fisher
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    fastdigest hindiii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    5 A ↓A G C T T 3 3 T T C G A ↑A 5 Invitrogen Anza 16 HindIII is a restriction enzyme that cuts DNA at this recognition
      Buy from Supplier

    Image Search Results


    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Journal: Iranian Journal of Parasitology

    Article Title: Allelic Variations of Plasmodium vivax Apical Membrane Antigen-1 (Pv AMA-1) in Malarious Areas of Southeastern Iran Using PCR-RFLP Technique

    doi:

    Figure Lengend Snippet: Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Article Snippet: RFLP In order to determine the presence of different alleles of Pv AMA-1 gene in the region, PCR–RFLP technique was done to digest the gene using three restriction enzymes EcoR-1, Pvu-II and Hind3 (Thermo cat No #ER0271, #ER0631 and ferments cat No #ER0501 respectively) according to the manufacturer’s recommendations.

    Techniques: Polymerase Chain Reaction, Marker

    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Journal: Iranian Journal of Parasitology

    Article Title: Allelic Variations of Plasmodium vivax Apical Membrane Antigen-1 (Pv AMA-1) in Malarious Areas of Southeastern Iran Using PCR-RFLP Technique

    doi:

    Figure Lengend Snippet: Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Article Snippet: In order to determine the presence of different alleles of Pv AMA-1 gene in the region, PCR–RFLP technique was done to digest the gene using three restriction enzymes EcoR-1, Pvu-II and Hind3 (Thermo cat No #ER0271, #ER0631 and ferments cat No #ER0501 respectively) according to the manufacturer’s recommendations.

    Techniques: Polymerase Chain Reaction, Marker