Structured Review

Thermo Fisher hindiii
Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, <t>HinDIII</t> and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
Hindiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 476 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hindiii/product/Thermo Fisher
Average 99 stars, based on 476 article reviews
Price from $9.99 to $1999.99
hindiii - by Bioz Stars, 2020-05
99/100 stars

Images

1) Product Images from "Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)"

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

Journal: 3 Biotech

doi: 10.1007/s13205-018-1552-0

Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
Figure Legend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

Techniques Used: Southern Blot, Molecular Weight, Marker, Hybridization

2) Product Images from "Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli"

Article Title: Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli

Journal: PLoS ONE

doi: 10.1371/journal.pone.0073189

DNA fingerprint profiles of strains M6 and 7a1, and their variants. A . Pulse field gel electrophoresis (PFGE) following digestion with XbaI, SpeI and HindIII. B . repetitive-PCR profiling by REP-, BOX- and ERIC-PCR. Lines: L , ladder; 1 , M6; 2 , M6V1; 3 , M6V2; 4 , 7a1; 5 , 7a1V1; 6 , 7a1V2. Arrows indicate differences between some of the variants and their parental strain. Results are representative from at least two independent runs with similar results for each method.
Figure Legend Snippet: DNA fingerprint profiles of strains M6 and 7a1, and their variants. A . Pulse field gel electrophoresis (PFGE) following digestion with XbaI, SpeI and HindIII. B . repetitive-PCR profiling by REP-, BOX- and ERIC-PCR. Lines: L , ladder; 1 , M6; 2 , M6V1; 3 , M6V2; 4 , 7a1; 5 , 7a1V1; 6 , 7a1V2. Arrows indicate differences between some of the variants and their parental strain. Results are representative from at least two independent runs with similar results for each method.

Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Amplification:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Article Title: FMRP recruitment of β‐catenin to the translation pre‐initiation complex represses translation
Article Snippet: .. The amplified ORF was digested with HindIII and BamHI and ligated into the pcDNA3 vector (pcDNA3‐GBP) (Invitrogen). .. Lamin B1 ORF was PCR‐amplified with Fwd‐primer (ATGGATCCGCGACTGCGACCCCCGTGCCGCCGCGGATG) and Rev‐primer (ATCTCGAGTTACATAATTGCACAGCTTCTATTG) using a C2C12 cDNA library constructed by RT with oligo‐dT.

Ligation:

Article Title: Molecular and Cellular Interactions of Scavenger Receptor SR-F1 With Complement C1q Provide Insights Into Its Role in the Clearance of Apoptotic Cells
Article Snippet: .. The pCMV6-AC plasmid was generated from the pCMV6-AC-GFP plasmid (Origene, PS100010) by cleavage with HindIII and PmeI (to remove the GFP coding sequence) followed by blunting and ligation with Klenow fragment of polymerase I (Thermo Fisher). .. The sequences of both constructs were checked by DNA sequencing (GATC Biotech).

Polymerase Chain Reaction:

Article Title: Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na+/Ca2+ exchanger
Article Snippet: .. The exchanger is modeled to have 9 transmembrane (TM) segments and a large intracellular loop between TM5 and TM6 according to Philipson and Nicoll ( NCX1/1-220 Forward 5′-d[ AAGCTTGGATCC GATACAGAGGCAGAAACAGG]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGAATTC CCGCCTTGCTGCGACCCA AGC]-3′ HindIII and EcoRI NCX1/218-371 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTT TAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG GACTGCGTCATTTTCAAC C]-3′ HindIII and XhoI NCX1/371-508 Forward 5′-d[ AAGCTTGGATCC GTCAGTAAGGTCTTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CTCAAAAGTAAAGATGC]-3′ HindIII and XhoI NCX1/508-764 Forward 5′-d[ AAGCTTGGATCC GAGGAACCCGTGACTCAC G]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/218-764 Forward 5′-d[ AAGCTTGGATCC GCAAGGCGGCTTCTCTTTTAC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTCTCGAG CCAATATTCTGTAGGTGG] -3′ HindIII and XhoI NCX1/764-939 Forward 5′-d[ AAGCTTGGATCC TGGCTGGGCCTGCTTCAT TGTC]-3′ HindIII and BamHI Reverse 5′-d[ AAGCTTGTCGAC TTAGAAGCCTTTTATGTG GC]-3′ HindIII and SalI The newly amplified NCX1 PCR fragments were cloned in pCR2.1-TOPO (Invitrogen) according to the manufacturer’s protocol. .. DNA sequencing confirmed the sequence fidelity of fragments with the published cDNA sequence.

Generated:

Article Title: Molecular and Cellular Interactions of Scavenger Receptor SR-F1 With Complement C1q Provide Insights Into Its Role in the Clearance of Apoptotic Cells
Article Snippet: .. The pCMV6-AC plasmid was generated from the pCMV6-AC-GFP plasmid (Origene, PS100010) by cleavage with HindIII and PmeI (to remove the GFP coding sequence) followed by blunting and ligation with Klenow fragment of polymerase I (Thermo Fisher). .. The sequences of both constructs were checked by DNA sequencing (GATC Biotech).

Sequencing:

Article Title: Molecular and Cellular Interactions of Scavenger Receptor SR-F1 With Complement C1q Provide Insights Into Its Role in the Clearance of Apoptotic Cells
Article Snippet: .. The pCMV6-AC plasmid was generated from the pCMV6-AC-GFP plasmid (Origene, PS100010) by cleavage with HindIII and PmeI (to remove the GFP coding sequence) followed by blunting and ligation with Klenow fragment of polymerase I (Thermo Fisher). .. The sequences of both constructs were checked by DNA sequencing (GATC Biotech).

Plasmid Preparation:

Article Title: FMRP recruitment of β‐catenin to the translation pre‐initiation complex represses translation
Article Snippet: .. The amplified ORF was digested with HindIII and BamHI and ligated into the pcDNA3 vector (pcDNA3‐GBP) (Invitrogen). .. Lamin B1 ORF was PCR‐amplified with Fwd‐primer (ATGGATCCGCGACTGCGACCCCCGTGCCGCCGCGGATG) and Rev‐primer (ATCTCGAGTTACATAATTGCACAGCTTCTATTG) using a C2C12 cDNA library constructed by RT with oligo‐dT.

Article Title: Molecular and Cellular Interactions of Scavenger Receptor SR-F1 With Complement C1q Provide Insights Into Its Role in the Clearance of Apoptotic Cells
Article Snippet: .. The pCMV6-AC plasmid was generated from the pCMV6-AC-GFP plasmid (Origene, PS100010) by cleavage with HindIII and PmeI (to remove the GFP coding sequence) followed by blunting and ligation with Klenow fragment of polymerase I (Thermo Fisher). .. The sequences of both constructs were checked by DNA sequencing (GATC Biotech).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher hindiii
    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and <t>HindIII,</t> enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII
    Hindiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 476 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii/product/Thermo Fisher
    Average 99 stars, based on 476 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Journal: Iranian Journal of Parasitology

    Article Title: Allelic Variations of Plasmodium vivax Apical Membrane Antigen-1 (Pv AMA-1) in Malarious Areas of Southeastern Iran Using PCR-RFLP Technique

    doi:

    Figure Lengend Snippet: Electrophoretic product of PvAMA-1 gene treated with EcoR I, PvuII, and HindIII, enzymes using RFLP-PCR technique including Columns 1,2 3 treated with EcoRI. Column 4 main bound of Pv AMA-1. Column 5 size marker with 1000bp. Columns 6, 7 and 8 treated with PvuII. Columns 9 10 treated with HindIII

    Article Snippet: RFLP In order to determine the presence of different alleles of Pv AMA-1 gene in the region, PCR–RFLP technique was done to digest the gene using three restriction enzymes EcoR-1, Pvu-II and Hind3 (Thermo cat No #ER0271, #ER0631 and ferments cat No #ER0501 respectively) according to the manufacturer’s recommendations.

    Techniques: Polymerase Chain Reaction, Marker