hindiii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HindIII
    Description:
    HindIII 50 000 units
    Catalog Number:
    R0104L
    Price:
    244
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs hindiii
    HindIII
    HindIII 50 000 units
    https://www.bioz.com/result/hindiii/product/New England Biolabs
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases"

    Article Title: Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-6-40

    Schematic representation of the prototype recombinant virus M24-BAC and the promoterless shuttle vector pFLS-ICP4 . ( a ) M24-BAC recombinant virus has the BAC sequences inserted into the UL39 (ICP6) gene of mutant HSV d120. (upper) d120 has a 4.1 kb deletion in both copies of the diploid ICP4 gene. (middle) The ICP6 gene coding the large subunit of viral ribonucleotide reductase is located in the 9.4 kb HindIII restriction fragment of the HSV genome. (lower) The BAC vector sequences were inserted into the d120 genome between the StuI and the XhoI sites of UL39 via homologous recombination using the recombination plasmid pBAC-ICP6EF. The mini F plasmid sequences contain four regulatory genes ( oriS , repE , parA , and parB ) essential for replication and copy number control of the plasmid [19]. H, HindIII; S, StuI; X, XhoI; Open boxes, HSV inverted repeats. The numbers in rectangles at the top of the figure show the lengths in kb of HindIII restriction fragments of d120. The numbers in parentheses show the lengths in kb of terminal restriction fragments. ( b ) Schematic map of the promoterless shuttle vector pFLS-ICP4. MCS is situated upstream of the HSV ICP4 coding sequence so that an exogenous promoter can be inserted to drive ICP4 expression.
    Figure Legend Snippet: Schematic representation of the prototype recombinant virus M24-BAC and the promoterless shuttle vector pFLS-ICP4 . ( a ) M24-BAC recombinant virus has the BAC sequences inserted into the UL39 (ICP6) gene of mutant HSV d120. (upper) d120 has a 4.1 kb deletion in both copies of the diploid ICP4 gene. (middle) The ICP6 gene coding the large subunit of viral ribonucleotide reductase is located in the 9.4 kb HindIII restriction fragment of the HSV genome. (lower) The BAC vector sequences were inserted into the d120 genome between the StuI and the XhoI sites of UL39 via homologous recombination using the recombination plasmid pBAC-ICP6EF. The mini F plasmid sequences contain four regulatory genes ( oriS , repE , parA , and parB ) essential for replication and copy number control of the plasmid [19]. H, HindIII; S, StuI; X, XhoI; Open boxes, HSV inverted repeats. The numbers in rectangles at the top of the figure show the lengths in kb of HindIII restriction fragments of d120. The numbers in parentheses show the lengths in kb of terminal restriction fragments. ( b ) Schematic map of the promoterless shuttle vector pFLS-ICP4. MCS is situated upstream of the HSV ICP4 coding sequence so that an exogenous promoter can be inserted to drive ICP4 expression.

    Techniques Used: Recombinant, BAC Assay, Plasmid Preparation, Mutagenesis, Homologous Recombination, Sequencing, Expressing

    Genomic structure of M24-BAC virus and pM24-BAC plasmid DNA . HindIII restriction analysis of M24-BAC virus DNA (left panel) and pM24-BAC plasmid DNA (right panel) is shown. Closed arrowhead: 9.4 kb HindIII fragment of d120 (containing ICP6 region), Open arrowheads: 15 kb and 2.2 kb HindIII fragments generated by insertion of the BAC sequences. A band present in M24-BAC digest just above the closed triangle is the submolar terminal restriction fragment (9.8 kb) derived from the short terminal repeat. This band is overlapped by the 9.4 kb restriction fragment of d120 and absent from pM24-BAC. The restriction pattern of pM24-BAC indicates that this clone contains both the U L and U S sequences of HSV genome in the forward orientation. Other bands present in the M24-BAC digest but not in pM24-BAC are submolar terminal fragments or L-S junction fragments derived from other isomeric forms of virus genome.
    Figure Legend Snippet: Genomic structure of M24-BAC virus and pM24-BAC plasmid DNA . HindIII restriction analysis of M24-BAC virus DNA (left panel) and pM24-BAC plasmid DNA (right panel) is shown. Closed arrowhead: 9.4 kb HindIII fragment of d120 (containing ICP6 region), Open arrowheads: 15 kb and 2.2 kb HindIII fragments generated by insertion of the BAC sequences. A band present in M24-BAC digest just above the closed triangle is the submolar terminal restriction fragment (9.8 kb) derived from the short terminal repeat. This band is overlapped by the 9.4 kb restriction fragment of d120 and absent from pM24-BAC. The restriction pattern of pM24-BAC indicates that this clone contains both the U L and U S sequences of HSV genome in the forward orientation. Other bands present in the M24-BAC digest but not in pM24-BAC are submolar terminal fragments or L-S junction fragments derived from other isomeric forms of virus genome.

    Techniques Used: BAC Assay, Plasmid Preparation, Generated, Derivative Assay

    Analysis of BAC clones after site-specific recombination . (a) HindIII restriction analysis of chloramphenicol/kanamycin double-resistant clones (pM24-BAC-CMV) after Cre-mediated integration between pM24-BAC and pFLS-CMV shuttle vector. Clones #3, 6, and 7 (marked with asterisks) show the expected restriction pattern. Clones #1, 2, 4, 5, and 8 contain an additional 7.8 kb fragment ( closed arrowhead ) and a greater amount of the 6.2 kb fragment ( open arrowhead ) which is consistent with the expected digestion pattern of pM24-BAC-CMV with doubly inserted shuttle vector [see Additional file 3 ]. Clone #10 also contains a greater amount of the 7.8 kb fragment, suggesting insertion of three or more copies of the shuttle vector. The remaining clone (#9) did not undergo recombination and shows a pattern identical to that of pM24-BAC. (b) HindIII restriction analysis of pM24-BAC-null clones obtained after Cre-mediated integration between pM24-BAC and pFLS-XICP4 shuttle vector. Clones #1, 2, 5, 9, 10 and 11 (marked with asterisks) show a restriction pattern consistent with singly integrated pM24-BAC-null. The other seven clones contain a partially deleted, incomplete HSV-BAC genome. The 8.2 kb HindIII fragment containing the BAC backbone ( arrow ) and the two neighboring fragments (20.1 and 2.2 kb; closed arrowheads ) are preserved in all clones, and the 8.6 kb fragment ( open arrowhead ) adjacent to the 2.2 kb fragment is preserved in all clones except clone #13. Other fragments are lost in the deletion clones and new fragments of varying lengths are observed, suggesting that these deletions occurred randomly at different locations. For the HindIII restriction map, see Fig 2a and Additional file 3 .
    Figure Legend Snippet: Analysis of BAC clones after site-specific recombination . (a) HindIII restriction analysis of chloramphenicol/kanamycin double-resistant clones (pM24-BAC-CMV) after Cre-mediated integration between pM24-BAC and pFLS-CMV shuttle vector. Clones #3, 6, and 7 (marked with asterisks) show the expected restriction pattern. Clones #1, 2, 4, 5, and 8 contain an additional 7.8 kb fragment ( closed arrowhead ) and a greater amount of the 6.2 kb fragment ( open arrowhead ) which is consistent with the expected digestion pattern of pM24-BAC-CMV with doubly inserted shuttle vector [see Additional file 3 ]. Clone #10 also contains a greater amount of the 7.8 kb fragment, suggesting insertion of three or more copies of the shuttle vector. The remaining clone (#9) did not undergo recombination and shows a pattern identical to that of pM24-BAC. (b) HindIII restriction analysis of pM24-BAC-null clones obtained after Cre-mediated integration between pM24-BAC and pFLS-XICP4 shuttle vector. Clones #1, 2, 5, 9, 10 and 11 (marked with asterisks) show a restriction pattern consistent with singly integrated pM24-BAC-null. The other seven clones contain a partially deleted, incomplete HSV-BAC genome. The 8.2 kb HindIII fragment containing the BAC backbone ( arrow ) and the two neighboring fragments (20.1 and 2.2 kb; closed arrowheads ) are preserved in all clones, and the 8.6 kb fragment ( open arrowhead ) adjacent to the 2.2 kb fragment is preserved in all clones except clone #13. Other fragments are lost in the deletion clones and new fragments of varying lengths are observed, suggesting that these deletions occurred randomly at different locations. For the HindIII restriction map, see Fig 2a and Additional file 3 .

    Techniques Used: BAC Assay, Clone Assay, Plasmid Preparation

    Analysis of genomic DNA from recombinant viruses generated using the Flip-Flop HSV-BAC system . DNA from two independent isolates was purified, digested with HindIII and electrophoresed on an agarose gel. The DNAs of parental viruses bM24-BAC and d120 illustrate the common fragments, while the asterisks denote fragments containing inserts derived from the shuttle vector. [see Additional file 3 ].
    Figure Legend Snippet: Analysis of genomic DNA from recombinant viruses generated using the Flip-Flop HSV-BAC system . DNA from two independent isolates was purified, digested with HindIII and electrophoresed on an agarose gel. The DNAs of parental viruses bM24-BAC and d120 illustrate the common fragments, while the asterisks denote fragments containing inserts derived from the shuttle vector. [see Additional file 3 ].

    Techniques Used: Recombinant, Generated, BAC Assay, Purification, Agarose Gel Electrophoresis, Derivative Assay, Plasmid Preparation

    2) Product Images from "Allele-specific control of replication timing and genome organization during development"

    Article Title: Allele-specific control of replication timing and genome organization during development

    Journal: Genome Research

    doi: 10.1101/gr.232561.117

    Genome-wide analysis of RT, enhancer-promoter interactions, gene expression, and chromatin accessibility in hybrid mouse ESCs. ( A ) Mouse ESC lines were derived from hybrid F1 blastocysts from crosses of distinct subspecies and strains. ( B ) Six distinct hybrid mESC lines harboring three different genomes (C57BL/6, 129/sv, and CAST/Ei), opposite parental configurations, and different genders were analyzed. V6.5, F121, and F123 hybrid cell lines were generated previously ( ; ). F121-6 and F121-9 are single-cell subclones of F121, and Cas129 was generated in this study from a reciprocal cross between castaneus / musculus mice. ( C – F ) Genome-wide analysis of RT ( C ), Hi-C and promoter capture Hi-C (PC-Hi-C) ( D ), total nuclear RNA-seq ( E ), and chromatin accessibility measured by A ssay for T ransposase A ccessible C hromatin (ATAC-seq) ( F ). ( G ) Representative genomic region on Chromosome 1 showing RT profiles of musculus (129/sv) and castaneus (CAST/Ei) alleles. Two replicates of the F121-9 cell line (two RT profiles of each genome) show the consistency in RT asynchrony. Allele-specific Hi-C matrices and compartments A and B (eigenvectors), RNA-seq, ATAC-seq, and enhancer-promoter interactions are shown. Allele-specific RT, total nuclear RNA-seq, and ATAC-seq were determined based on the SNPs shown in red. Allele-specific Hi-C and PC-Hi-C interactions were obtained using only HindIII fragments containing SNPs that distinguish each genome (HindIII track). Capture probes for PC-Hi-C are shown above promoter-enhancer interactions. Hi-C data were obtained from .
    Figure Legend Snippet: Genome-wide analysis of RT, enhancer-promoter interactions, gene expression, and chromatin accessibility in hybrid mouse ESCs. ( A ) Mouse ESC lines were derived from hybrid F1 blastocysts from crosses of distinct subspecies and strains. ( B ) Six distinct hybrid mESC lines harboring three different genomes (C57BL/6, 129/sv, and CAST/Ei), opposite parental configurations, and different genders were analyzed. V6.5, F121, and F123 hybrid cell lines were generated previously ( ; ). F121-6 and F121-9 are single-cell subclones of F121, and Cas129 was generated in this study from a reciprocal cross between castaneus / musculus mice. ( C – F ) Genome-wide analysis of RT ( C ), Hi-C and promoter capture Hi-C (PC-Hi-C) ( D ), total nuclear RNA-seq ( E ), and chromatin accessibility measured by A ssay for T ransposase A ccessible C hromatin (ATAC-seq) ( F ). ( G ) Representative genomic region on Chromosome 1 showing RT profiles of musculus (129/sv) and castaneus (CAST/Ei) alleles. Two replicates of the F121-9 cell line (two RT profiles of each genome) show the consistency in RT asynchrony. Allele-specific Hi-C matrices and compartments A and B (eigenvectors), RNA-seq, ATAC-seq, and enhancer-promoter interactions are shown. Allele-specific RT, total nuclear RNA-seq, and ATAC-seq were determined based on the SNPs shown in red. Allele-specific Hi-C and PC-Hi-C interactions were obtained using only HindIII fragments containing SNPs that distinguish each genome (HindIII track). Capture probes for PC-Hi-C are shown above promoter-enhancer interactions. Hi-C data were obtained from .

    Techniques Used: Genome Wide, Expressing, Derivative Assay, Generated, Mouse Assay, Hi-C, RNA Sequencing Assay

    3) Product Images from "Enhancer Complexes Located Downstream of Both Human Immunoglobulin C? Genes "

    Article Title: Enhancer Complexes Located Downstream of Both Human Immunoglobulin C? Genes

    Journal: The Journal of Experimental Medicine

    doi:

    Mapping of DNase I hypersensitive sites in the regions 3′ of the human Cα genes. ( A ) DNase I hypersensitive sites lie downstream from the human Cα genes in the HS Sultan plasmacytoma. DNA samples prepared from DNase I–digested nuclei isolated from K562 promyeloid and HS Sultan myeloma cells were digested with BglII, electrophoresed, blotted, and hybridized with probe a (αm, Fig.1). No DNase I hypersensitive sites are seen in the K562 samples. In contrast, at least seven DNase I hypersensitive sites are observed in samples from HS Sultan plasmacytoma cells. The size of each DNase I–generated band corresponds to its distance from the BglII sites located ∼1 kb 5′ of each α membrane exon ( αm ). This mapping strategy does not distinguish between sites in the α1 versus α2 loci; sites are labeled according to their subsequent assignment (see B and C , and sequence analyses). Due to their large size, bands resulting from DNase I cutting at the α1 and α2 HS4 sites are not resolved in this analysis. ( B ) HS4 sites are accessible to nuclease in both α1 and α2 loci. HS Sultan nuclei were digested with DNase I or SspI restriction enzyme (both the α1 and α2 HS4 sequences contain an SspI site). Purified DNA was digested with EcoRI and hybridized with probe b′, yielding two closely spaced DNase I HS bands, whose sizes correspond to the expected distance between the HS4 enhancers and the downstream EcoRI sites. Furthermore, there are two similarly positioned bands in the samples from SspI-digested nuclei, indicating that both the α1 and α2 HS4 sites are accessible to SspI. ( C ) Assignment of DNase I hypersensitive sites to the 3′ Cα2 region. HS Sultan DNA samples were digested with HindIII and hybridized with probe g (α2 HS12, Fig. 1 ). Because DNAse I–generated bands from the α1 region which hybridize to this probe are expected to be larger than the 12-kb α2 HindIII fragment, all bands
    Figure Legend Snippet: Mapping of DNase I hypersensitive sites in the regions 3′ of the human Cα genes. ( A ) DNase I hypersensitive sites lie downstream from the human Cα genes in the HS Sultan plasmacytoma. DNA samples prepared from DNase I–digested nuclei isolated from K562 promyeloid and HS Sultan myeloma cells were digested with BglII, electrophoresed, blotted, and hybridized with probe a (αm, Fig.1). No DNase I hypersensitive sites are seen in the K562 samples. In contrast, at least seven DNase I hypersensitive sites are observed in samples from HS Sultan plasmacytoma cells. The size of each DNase I–generated band corresponds to its distance from the BglII sites located ∼1 kb 5′ of each α membrane exon ( αm ). This mapping strategy does not distinguish between sites in the α1 versus α2 loci; sites are labeled according to their subsequent assignment (see B and C , and sequence analyses). Due to their large size, bands resulting from DNase I cutting at the α1 and α2 HS4 sites are not resolved in this analysis. ( B ) HS4 sites are accessible to nuclease in both α1 and α2 loci. HS Sultan nuclei were digested with DNase I or SspI restriction enzyme (both the α1 and α2 HS4 sequences contain an SspI site). Purified DNA was digested with EcoRI and hybridized with probe b′, yielding two closely spaced DNase I HS bands, whose sizes correspond to the expected distance between the HS4 enhancers and the downstream EcoRI sites. Furthermore, there are two similarly positioned bands in the samples from SspI-digested nuclei, indicating that both the α1 and α2 HS4 sites are accessible to SspI. ( C ) Assignment of DNase I hypersensitive sites to the 3′ Cα2 region. HS Sultan DNA samples were digested with HindIII and hybridized with probe g (α2 HS12, Fig. 1 ). Because DNAse I–generated bands from the α1 region which hybridize to this probe are expected to be larger than the 12-kb α2 HindIII fragment, all bands

    Techniques Used: Isolation, Generated, Labeling, Sequencing, Purification

    4) Product Images from "Significance of the Bacteriophage Treatment Schedule in Reducing Salmonella Colonization of Poultry"

    Article Title: Significance of the Bacteriophage Treatment Schedule in Reducing Salmonella Colonization of Poultry

    Journal:

    doi: 10.1128/AEM.01257-12

    DNA restriction patterns of the bacteriophages UAB_Phi20 (lanes 3 to 5), UAB_Phi87 (lanes 6 to 8), and UAB_Phi78 (lanes 9 to 11) with the restriction enzymes EcoRI (lanes 3, 6, and 9), EcoRV (lanes 4, 7, and 10), and HindIII (lanes 5, 8, and 11). Lanes
    Figure Legend Snippet: DNA restriction patterns of the bacteriophages UAB_Phi20 (lanes 3 to 5), UAB_Phi87 (lanes 6 to 8), and UAB_Phi78 (lanes 9 to 11) with the restriction enzymes EcoRI (lanes 3, 6, and 9), EcoRV (lanes 4, 7, and 10), and HindIII (lanes 5, 8, and 11). Lanes

    Techniques Used:

    5) Product Images from "Ultra-deep pyrosequencing analysis of the hepatitis B virus preCore region and main catalytic motif of the viral polymerase in the same viral genome"

    Article Title: Ultra-deep pyrosequencing analysis of the hepatitis B virus preCore region and main catalytic motif of the viral polymerase in the same viral genome

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr451

    ( a ) Schematic representation of the intramolecular ligation technique to obtain the preCore and YMDD Pol motif close to each other. ( 1 ) The circle in a continuous line represents the complete HBV genome (3200 bp). The semicircles in discontinuous lines represent the first (first PCR, 2700 bp) and the nested (2194 bp for genotype A2 sequences and 2155 bp for genotype D sequences) PCR products. ( 2 ) The product obtained after intramolecular ligation and primers used to sequence the circular molecule ( Table 2 ) are indicated in the figure. ( b ) Agarose gel obtained after intramolecular digestion. Two markers (M-I and M-II) were loaded in the gel; band lengths are shown at the left side of the image. Two samples (S1 and S2) were loaded and four bands were detected; band lengths are indicated at the right side of the image. A band with an apparent size of 1700 bp was the circular molecule, with the preCore and YMDD Pol motif close to each other. Band B was the nested PCR product without ligation, and band D were dimers of nested PCR products without ligation. Band C corresponded to the ligated dimers. B , C and D bands were not used, because the main interest was to analyze regions from the same genome. ( c ) Sequence of the circular construct including the preCore region, YMDD polymerase motif (in box), and HindIII sequence. PreCore (1, 2, 14, 15, 28 and 29) and Core ( 1 ) codons analyzed in the text are also enclosed in boxes.
    Figure Legend Snippet: ( a ) Schematic representation of the intramolecular ligation technique to obtain the preCore and YMDD Pol motif close to each other. ( 1 ) The circle in a continuous line represents the complete HBV genome (3200 bp). The semicircles in discontinuous lines represent the first (first PCR, 2700 bp) and the nested (2194 bp for genotype A2 sequences and 2155 bp for genotype D sequences) PCR products. ( 2 ) The product obtained after intramolecular ligation and primers used to sequence the circular molecule ( Table 2 ) are indicated in the figure. ( b ) Agarose gel obtained after intramolecular digestion. Two markers (M-I and M-II) were loaded in the gel; band lengths are shown at the left side of the image. Two samples (S1 and S2) were loaded and four bands were detected; band lengths are indicated at the right side of the image. A band with an apparent size of 1700 bp was the circular molecule, with the preCore and YMDD Pol motif close to each other. Band B was the nested PCR product without ligation, and band D were dimers of nested PCR products without ligation. Band C corresponded to the ligated dimers. B , C and D bands were not used, because the main interest was to analyze regions from the same genome. ( c ) Sequence of the circular construct including the preCore region, YMDD polymerase motif (in box), and HindIII sequence. PreCore (1, 2, 14, 15, 28 and 29) and Core ( 1 ) codons analyzed in the text are also enclosed in boxes.

    Techniques Used: Ligation, Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis, Nested PCR, Construct

    6) Product Images from "Sequence Analysis and Organization of the Neodiprion abietis Nucleopolyhedrovirus Genome"

    Article Title: Sequence Analysis and Organization of the Neodiprion abietis Nucleopolyhedrovirus Genome

    Journal:

    doi: 10.1128/JVI.00187-06

    Linear sequence map and HindIII physical map of the circular NeabNPV genome. The transcriptional direction of each ORF is represented by an arrow labeled with the ORF number. Known baculovirus predicted homologues are presented below the ORF numbers.
    Figure Legend Snippet: Linear sequence map and HindIII physical map of the circular NeabNPV genome. The transcriptional direction of each ORF is represented by an arrow labeled with the ORF number. Known baculovirus predicted homologues are presented below the ORF numbers.

    Techniques Used: Sequencing, Labeling

    7) Product Images from "Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli"

    Article Title: Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0119221

    Homologous recombination between vector and insert generated by restriction endonucleases. (A) The pNatMX was cleaved with the PvuII endonuclease generating the natMX fragment of 1469 bp. The pUC19 was prepared by digestion with the EcoRI and HindIII restriction enzymes, resulting in a 2639 bp linear plasmid. Homologous recombination between the natMX and pUC19 fragments generated the pUC19Nat plasmid. (B) Agarose gel electrophoresis after gel purification of the fragments natMX and pUC19. (C) The counting of colonies after transformation of the vector alone and co-transformation of the pUC19 plus the fragment natMX. (D) Colony PCR screening confirmed 100% positive cloning events. Abbreviations are as described in Fig. 2 .
    Figure Legend Snippet: Homologous recombination between vector and insert generated by restriction endonucleases. (A) The pNatMX was cleaved with the PvuII endonuclease generating the natMX fragment of 1469 bp. The pUC19 was prepared by digestion with the EcoRI and HindIII restriction enzymes, resulting in a 2639 bp linear plasmid. Homologous recombination between the natMX and pUC19 fragments generated the pUC19Nat plasmid. (B) Agarose gel electrophoresis after gel purification of the fragments natMX and pUC19. (C) The counting of colonies after transformation of the vector alone and co-transformation of the pUC19 plus the fragment natMX. (D) Colony PCR screening confirmed 100% positive cloning events. Abbreviations are as described in Fig. 2 .

    Techniques Used: Homologous Recombination, Plasmid Preparation, Generated, Agarose Gel Electrophoresis, Electrophoresis, Gel Purification, Transformation Assay, Polymerase Chain Reaction, Clone Assay

    8) Product Images from "Comparison of emm Typing and Ribotyping with Three Restriction Enzymes To Characterize Clinical Isolates of Streptococcus pyogenes"

    Article Title: Comparison of emm Typing and Ribotyping with Three Restriction Enzymes To Characterize Clinical Isolates of Streptococcus pyogenes

    Journal:

    doi: 10.1128/JCM.43.1.150-155.2005

    Dendrogram of ribogroups P, C1, W, X, Z, I, C, T, O, J, G, A, N, E, B, V, and D are shown as representative groups. VCA shows the EcoRI pattern, and VCB and SEC-01 show PstI and HindIII patterns, respectively. The dendrogram is a composite of all three
    Figure Legend Snippet: Dendrogram of ribogroups P, C1, W, X, Z, I, C, T, O, J, G, A, N, E, B, V, and D are shown as representative groups. VCA shows the EcoRI pattern, and VCB and SEC-01 show PstI and HindIII patterns, respectively. The dendrogram is a composite of all three

    Techniques Used: Size-exclusion Chromatography

    Examples of riboprint patterns. Comparison of EcoRI, PstI, and HindIII riboprint patterns for common ribogroups is shown.
    Figure Legend Snippet: Examples of riboprint patterns. Comparison of EcoRI, PstI, and HindIII riboprint patterns for common ribogroups is shown.

    Techniques Used:

    9) Product Images from "Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses"

    Article Title: Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0123113

    Enzymatic digestion of the pA27L plasmid. The A27L and A2L OPT gene was enzymatically digested with HindIII and NotI. Lane 1, 1kb DNA ladder; Lane 2, 100bp DNA ladder; Lane 3, pVax1 uncut; Lane 4 pVax1 cut; Lane 5, pA27L uncut; Lane 6, pA27L cut; Lane 7, pA27LOPT uncut; Lane 8, pA27LOPT cut. The expected band of 434bp corresponding to the A27L gene is highlighted with an arrow.
    Figure Legend Snippet: Enzymatic digestion of the pA27L plasmid. The A27L and A2L OPT gene was enzymatically digested with HindIII and NotI. Lane 1, 1kb DNA ladder; Lane 2, 100bp DNA ladder; Lane 3, pVax1 uncut; Lane 4 pVax1 cut; Lane 5, pA27L uncut; Lane 6, pA27L cut; Lane 7, pA27LOPT uncut; Lane 8, pA27LOPT cut. The expected band of 434bp corresponding to the A27L gene is highlighted with an arrow.

    Techniques Used: Plasmid Preparation

    10) Product Images from "Ikaros controls isotype selection during immunoglobulin class switch recombination"

    Article Title: Ikaros controls isotype selection during immunoglobulin class switch recombination

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20082311

    Ikaros does not regulate interactions between HS1,2 and C H gene promoters. CD43 − WT and Ik L/L B cells were analyzed by 3C, either (A) before or after 36 h with (B) LPS, (C) LPS + IFN-γ, or (D) LPS + IL-4. CD4 + T cells stimulated for 36 h with PMA served as a negative control. The y axis represents the relative cross-linking frequency between a HindIII fragment covering HS1,2 and the rest of the locus. Points represent means plus SD of two independent experiments. Significance was determined by a two-tailed t test assuming unequal variance (***, P
    Figure Legend Snippet: Ikaros does not regulate interactions between HS1,2 and C H gene promoters. CD43 − WT and Ik L/L B cells were analyzed by 3C, either (A) before or after 36 h with (B) LPS, (C) LPS + IFN-γ, or (D) LPS + IL-4. CD4 + T cells stimulated for 36 h with PMA served as a negative control. The y axis represents the relative cross-linking frequency between a HindIII fragment covering HS1,2 and the rest of the locus. Points represent means plus SD of two independent experiments. Significance was determined by a two-tailed t test assuming unequal variance (***, P

    Techniques Used: Negative Control, Two Tailed Test

    11) Product Images from "Quantitative analysis of genomic element interactions by molecular colony technique"

    Article Title: Quantitative analysis of genomic element interactions by molecular colony technique

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt1322

    Detection of the interaction between elements that neighbor each other in the chromosomal DNA. ( A ) Map of the analyzed region showing the positions of primers (arrows) and molecular beacon probes, the HindIII restriction site, element HS5 (black bar) and the first exon of the minor β-globin gene (red bar). ( B–D ) Diagrams showing a mean number of colonies per gel and error bars ( n = 6) in experiments with cross-linked and sonicated (7-s pulse) embryonic liver cells either not treated (B) or digested with restriction endonuclease HindIII (C) and further subjected to the cross-link reversal and DNA isolation procedure (D). In each case, an equivalent of ∼20 genomes was loaded per gel. Shown at the top-right corner of the diagram in (B) is one of the six gels run in the experiment. The percentage of binary colonies was calculated relative to the mean total number of individual colonies of each type. The raw data are presented in Supplementary Table S5 . For other details see legend to Figure 3 .
    Figure Legend Snippet: Detection of the interaction between elements that neighbor each other in the chromosomal DNA. ( A ) Map of the analyzed region showing the positions of primers (arrows) and molecular beacon probes, the HindIII restriction site, element HS5 (black bar) and the first exon of the minor β-globin gene (red bar). ( B–D ) Diagrams showing a mean number of colonies per gel and error bars ( n = 6) in experiments with cross-linked and sonicated (7-s pulse) embryonic liver cells either not treated (B) or digested with restriction endonuclease HindIII (C) and further subjected to the cross-link reversal and DNA isolation procedure (D). In each case, an equivalent of ∼20 genomes was loaded per gel. Shown at the top-right corner of the diagram in (B) is one of the six gels run in the experiment. The percentage of binary colonies was calculated relative to the mean total number of individual colonies of each type. The raw data are presented in Supplementary Table S5 . For other details see legend to Figure 3 .

    Techniques Used: Sonication, DNA Extraction

    Molecular colonies produced by in-gel PCR amplification of test fragments from the murine β-globin locus. ( A ) Map of the murine β-globin locus showing β-globin genes (red arrows), olfactory receptor genes (OR, blue arrows) and the DNase I hypersensitive sites (HS, black vertical lines). The position of the test amplicons (named as in the text) is shown with black boxes below the map. The scale is in kilobases and according to the mouse genome contig (GenBank entry NT_039433.7). ( B–D ) Detection of DNA colonies using molecular beacons labeled with fluorophores FAM, Cy3 and Cy5, (B) gel containing ∼15 copies each of the sequences separately cloned in plasmids, (C) gel containing ∼15 copies of a plasmid carrying all three of the sequences, (D) gel containing ∼15 copies each of the separately cloned sequences plus ∼15 copies of a plasmid carrying all three of the sequences. ( E ) The color scheme used for the presentation of the gel images. The images obtained on detection of the FAM, Cy3, and Cy5 fluorescence have been artificially colored blue, green and red, respectively; if the signals overlap, the three colors produce a white color, whereas pairwise combinations produce yellow, cyan and magenta. ( F ) Merged images of two gels containing ∼15 copies of a haploid set of the murine genomic DNA digested at the HindIII or MboI sites as indicated. ( G ) Merged images of two gels containing formaldehyde–cross-linked fragments distributed in a gel either directly (cross-linked DNA) or after a standard cross-link reversal and DNA isolation procedure (de–cross-linked DNA). Each gel contained ∼15 copies of the haploid murine genome. ( H ) Histogram showing the results of three independent experiments carried out as in (G) in which six gels with samples of each of the two types were analyzed. The copy number of fragments detected in the experiments with de–cross-linked DNA was taken equal to 100%. Eror bars represent the standard deviation.
    Figure Legend Snippet: Molecular colonies produced by in-gel PCR amplification of test fragments from the murine β-globin locus. ( A ) Map of the murine β-globin locus showing β-globin genes (red arrows), olfactory receptor genes (OR, blue arrows) and the DNase I hypersensitive sites (HS, black vertical lines). The position of the test amplicons (named as in the text) is shown with black boxes below the map. The scale is in kilobases and according to the mouse genome contig (GenBank entry NT_039433.7). ( B–D ) Detection of DNA colonies using molecular beacons labeled with fluorophores FAM, Cy3 and Cy5, (B) gel containing ∼15 copies each of the sequences separately cloned in plasmids, (C) gel containing ∼15 copies of a plasmid carrying all three of the sequences, (D) gel containing ∼15 copies each of the separately cloned sequences plus ∼15 copies of a plasmid carrying all three of the sequences. ( E ) The color scheme used for the presentation of the gel images. The images obtained on detection of the FAM, Cy3, and Cy5 fluorescence have been artificially colored blue, green and red, respectively; if the signals overlap, the three colors produce a white color, whereas pairwise combinations produce yellow, cyan and magenta. ( F ) Merged images of two gels containing ∼15 copies of a haploid set of the murine genomic DNA digested at the HindIII or MboI sites as indicated. ( G ) Merged images of two gels containing formaldehyde–cross-linked fragments distributed in a gel either directly (cross-linked DNA) or after a standard cross-link reversal and DNA isolation procedure (de–cross-linked DNA). Each gel contained ∼15 copies of the haploid murine genome. ( H ) Histogram showing the results of three independent experiments carried out as in (G) in which six gels with samples of each of the two types were analyzed. The copy number of fragments detected in the experiments with de–cross-linked DNA was taken equal to 100%. Eror bars represent the standard deviation.

    Techniques Used: Produced, Polymerase Chain Reaction, Amplification, Labeling, Clone Assay, Plasmid Preparation, Fluorescence, DNA Extraction, Standard Deviation

    12) Product Images from "Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains"

    Article Title: Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004829

    BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).
    Figure Legend Snippet: BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).

    Techniques Used: Polymerase Chain Reaction

    13) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.
    Figure Legend Snippet: Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.

    Techniques Used: Inhibition

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.
    Figure Legend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Techniques Used: Generated, Incubation

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    14) Product Images from "Determining DNA Supercoiling Enthalpy by Isothermal Titration Calorimetry"

    Article Title: Determining DNA Supercoiling Enthalpy by Isothermal Titration Calorimetry

    Journal:

    doi: 10.1016/j.biochi.2012.08.002

    (A) The plasmid map of pXXZ6. Restriction enzyme recognition sites of BamHI, HindIII, and Nt.BbvCI are shown. For supercoiled pXXZ6 used in this study, the supercoiling density was determined to be −0.061. (B) DNA intercalator ethidium bromide
    Figure Legend Snippet: (A) The plasmid map of pXXZ6. Restriction enzyme recognition sites of BamHI, HindIII, and Nt.BbvCI are shown. For supercoiled pXXZ6 used in this study, the supercoiling density was determined to be −0.061. (B) DNA intercalator ethidium bromide

    Techniques Used: Plasmid Preparation

    15) Product Images from "Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ"

    Article Title: Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-3331-9

    Generation of floxed mice by the enhanced PITCh system. a Targeting strategy for the generation of flox Col12a1 mice by the enhanced PITCh system. Purple highlights indicate microhomologies between endogenous Col12a1 locus and PITCh-donor. Blue characters indicate CRISPR target sequences. Red characters indicate protospacer adjacent motif (PAM) sequences. Yellow lightnings indicate DSB sites. b Schematic diagram of pronuclear injection of Cas9 protein, Col12a1 -left, -right, and gRNA-s1 crRNAs, tracrRNA, PITCh-donor, and Exo1 mRNA. The red, purple, and blue boxes indicate the insert, Col12a1 microhomologies, and gRNA-s1 target sequences, respectively. c PCR screenings of newborns. d PCR-RFLP (restriction fragment length polymorphism) screenings of floxed newborn mice. e Summary of flox Col12a1 mouse production by the enhanced PITCh system. f Sequences of boundaries between Col12a1 and LoxPs. Blue, green, and red characters indicate microhomologies, HindIII sites, and LoxPs, respectively. g in vitro Cre-recombination assay. Cloned PCR products of flox alleles from three flox Col12a1 mice and genomic PCR of wildtype were incubated with or without Cre-recombinase. LF: left forward primer, RR: right reverse primer, MH: microhomology, M: molecular marker, and WT: wildtype
    Figure Legend Snippet: Generation of floxed mice by the enhanced PITCh system. a Targeting strategy for the generation of flox Col12a1 mice by the enhanced PITCh system. Purple highlights indicate microhomologies between endogenous Col12a1 locus and PITCh-donor. Blue characters indicate CRISPR target sequences. Red characters indicate protospacer adjacent motif (PAM) sequences. Yellow lightnings indicate DSB sites. b Schematic diagram of pronuclear injection of Cas9 protein, Col12a1 -left, -right, and gRNA-s1 crRNAs, tracrRNA, PITCh-donor, and Exo1 mRNA. The red, purple, and blue boxes indicate the insert, Col12a1 microhomologies, and gRNA-s1 target sequences, respectively. c PCR screenings of newborns. d PCR-RFLP (restriction fragment length polymorphism) screenings of floxed newborn mice. e Summary of flox Col12a1 mouse production by the enhanced PITCh system. f Sequences of boundaries between Col12a1 and LoxPs. Blue, green, and red characters indicate microhomologies, HindIII sites, and LoxPs, respectively. g in vitro Cre-recombination assay. Cloned PCR products of flox alleles from three flox Col12a1 mice and genomic PCR of wildtype were incubated with or without Cre-recombinase. LF: left forward primer, RR: right reverse primer, MH: microhomology, M: molecular marker, and WT: wildtype

    Techniques Used: Mouse Assay, CRISPR, Injection, Polymerase Chain Reaction, In Vitro, Recombination Assay, Clone Assay, Incubation, Marker

    16) Product Images from "Analyses of germline variants associated with ovarian cancer survival identify functional candidates at the 1q22 and 19p12 outcome loci"

    Article Title: Analyses of germline variants associated with ovarian cancer survival identify functional candidates at the 1q22 and 19p12 outcome loci

    Journal: Oncotarget

    doi: 10.18632/oncotarget.18501

    Two regions containing candidate all chemo PFS candidate variants interact with the ZNF100 promoter in ovarian cancer cell lines at the 19p12 outcome locus The figure shows 3C analyses of interactions between HindIII fragments and the ZNF100 promoter region (highlighted in pink) in COV362 and OVCAR8 cells. For each cell line, interaction frequencies were normalised to those of the fragment proximal to the promoter. Interaction frequencies from three independent biological replicates are shown (error bars represent standard error of the mean). The original variant associated with any chemotherapy PFS, rs3795247, is shown with correlated candidate outcome variants ( r 2 > 0.4) in black. Roadmap Consortium chromatin state segmentation for normal ovarian tissue using a Hidden Markov Model (Chrom HMM) is shown (red = active transcription start sites, dark green = weak transcription, green = strong transcription, green/yellow = genic enhancers, yellow = enhancers, aquamarine = ZNF gene repeats and turquoise = heterochromatin). H3K4Me1 modification in normal ovarian tissue is also indicated. Putative Regulatory Elements (PREs), and their coincident candidate variants, cloned into reporter gene constructs are highlighted in blue.
    Figure Legend Snippet: Two regions containing candidate all chemo PFS candidate variants interact with the ZNF100 promoter in ovarian cancer cell lines at the 19p12 outcome locus The figure shows 3C analyses of interactions between HindIII fragments and the ZNF100 promoter region (highlighted in pink) in COV362 and OVCAR8 cells. For each cell line, interaction frequencies were normalised to those of the fragment proximal to the promoter. Interaction frequencies from three independent biological replicates are shown (error bars represent standard error of the mean). The original variant associated with any chemotherapy PFS, rs3795247, is shown with correlated candidate outcome variants ( r 2 > 0.4) in black. Roadmap Consortium chromatin state segmentation for normal ovarian tissue using a Hidden Markov Model (Chrom HMM) is shown (red = active transcription start sites, dark green = weak transcription, green = strong transcription, green/yellow = genic enhancers, yellow = enhancers, aquamarine = ZNF gene repeats and turquoise = heterochromatin). H3K4Me1 modification in normal ovarian tissue is also indicated. Putative Regulatory Elements (PREs), and their coincident candidate variants, cloned into reporter gene constructs are highlighted in blue.

    Techniques Used: Variant Assay, Modification, Clone Assay, Construct

    17) Product Images from "Checkpoint-Dependent Regulation of Origin Firing and Replication Fork Movement in Response to DNA Damage in Fission Yeast"

    Article Title: Checkpoint-Dependent Regulation of Origin Firing and Replication Fork Movement in Response to DNA Damage in Fission Yeast

    Journal:

    doi: 10.1128/MCB.01319-08

    2D gel analyses of the terminal HindIII fragments at the telomeres of chromosomes 1 and 2 in untreated and MMS-treated cells. In each panel, the ratio of RIs to the 1N spot(s) is shown (in units of 10−3 ) in the upper left corner. (A) Wild-type cells prolonged their replication of telomeres upon MMS treatment, and the RIs from these regions persisted at later time points. (B and C) Replication of telomeres in cds1 Δ (B) and cdc25OP (C) cells was not confined to 60 to 90 min even in the absence of MMS. Upon MMS treatment, the cds1 Δ strain (B) showed a further decay of replication synchrony. These telomeric restriction fragments in the cdc25OP strain (C) replicated asynchronously in the absence as well as the presence of MMS.
    Figure Legend Snippet: 2D gel analyses of the terminal HindIII fragments at the telomeres of chromosomes 1 and 2 in untreated and MMS-treated cells. In each panel, the ratio of RIs to the 1N spot(s) is shown (in units of 10−3 ) in the upper left corner. (A) Wild-type cells prolonged their replication of telomeres upon MMS treatment, and the RIs from these regions persisted at later time points. (B and C) Replication of telomeres in cds1 Δ (B) and cdc25OP (C) cells was not confined to 60 to 90 min even in the absence of MMS. Upon MMS treatment, the cds1 Δ strain (B) showed a further decay of replication synchrony. These telomeric restriction fragments in the cdc25OP strain (C) replicated asynchronously in the absence as well as the presence of MMS.

    Techniques Used: Two-Dimensional Gel Electrophoresis

    18) Product Images from "Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses"

    Article Title: Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0123113

    Enzymatic digestion of the pA27L plasmid. The A27L and A2L OPT gene was enzymatically digested with HindIII and NotI. Lane 1, 1kb DNA ladder; Lane 2, 100bp DNA ladder; Lane 3, pVax1 uncut; Lane 4 pVax1 cut; Lane 5, pA27L uncut; Lane 6, pA27L cut; Lane 7, pA27LOPT uncut; Lane 8, pA27LOPT cut. The expected band of 434bp corresponding to the A27L gene is highlighted with an arrow.
    Figure Legend Snippet: Enzymatic digestion of the pA27L plasmid. The A27L and A2L OPT gene was enzymatically digested with HindIII and NotI. Lane 1, 1kb DNA ladder; Lane 2, 100bp DNA ladder; Lane 3, pVax1 uncut; Lane 4 pVax1 cut; Lane 5, pA27L uncut; Lane 6, pA27L cut; Lane 7, pA27LOPT uncut; Lane 8, pA27LOPT cut. The expected band of 434bp corresponding to the A27L gene is highlighted with an arrow.

    Techniques Used: Plasmid Preparation

    19) Product Images from "The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance"

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance

    Journal: Molecular Microbiology

    doi: 10.1111/mmi.13121

    Phage DNA replication assay. The R 20291 OFF and R 20291 OFF strain carrying the p OS 200 plasmid enabling overexpression of the type II CwpV were each infected with ϕ CD 38‐2 at a MOI of 1. Samples of the infected cultures were collected at different time points post‐infection, and whole bacterial genomic DNA was extracted. DNA was digested with HindIII and analysed by agarose gel and ethidium bromide staining (upper panel). Southern blot hybridization using a D ig‐labeled whole phage DNA probe was then performed to detect phage DNA replication (lower panel). A non‐infected ( NI ) control was run in parallel, along with a positive control consisting in the purified ϕ CD 38‐2 DNA .
    Figure Legend Snippet: Phage DNA replication assay. The R 20291 OFF and R 20291 OFF strain carrying the p OS 200 plasmid enabling overexpression of the type II CwpV were each infected with ϕ CD 38‐2 at a MOI of 1. Samples of the infected cultures were collected at different time points post‐infection, and whole bacterial genomic DNA was extracted. DNA was digested with HindIII and analysed by agarose gel and ethidium bromide staining (upper panel). Southern blot hybridization using a D ig‐labeled whole phage DNA probe was then performed to detect phage DNA replication (lower panel). A non‐infected ( NI ) control was run in parallel, along with a positive control consisting in the purified ϕ CD 38‐2 DNA .

    Techniques Used: Plasmid Preparation, Over Expression, Infection, Agarose Gel Electrophoresis, Staining, Southern Blot, Hybridization, Labeling, Positive Control, Purification

    20) Product Images from "Purification of Host Cell Enzymes Involved in Adeno-Associated Virus DNA Replication"

    Article Title: Purification of Host Cell Enzymes Involved in Adeno-Associated Virus DNA Replication

    Journal:

    doi: 10.1128/JVI.02651-06

    P-Cell separation of replication proteins from Ad-infected cells. (A) Western blots of fractions I, IIA, IIB, and IIC with Pol δ, Pol ɛ, Pol α, Ad DBP, RFC, RPA, and PCNA antibodies. (B) Reconstitution of AAV DNA replication in vitro using fractionated Ad-infected-cell extracts. Standard replication reaction mixtures (30 μl) contained either crude Ad-infected-cell extract (C; 200 μg) or P-Cell fractions (I, 160 μg; IIA, 36 μg; IIC′, 30 μg; IID, 9 μg) and Rep78 (3.4 μg), as indicated. Reaction mixtures were incubated for 2 h at 37°C, processed, and analyzed as described in Materials and Methods. The DNA products from each reaction were digested with DpnI and analyzed on 0.8% Tris-borate-EDTA (TBE)-agarose. md and dd indicate monomer duplex and dimer duplex DNA species, respectively, which are resistant to DpnI digestion. DNA products sensitive to DpnI digestion are denoted by the black line. (C) Optimization of AAV DNA replication with RFC and P-Cell fractions I and IIA. Standard replication reaction mixtures (15 μl) contained either crude Ad-infected-cell extract (C; 100 μg) or P-Cell fraction I (80 μg), RFC (0.5 μg), Rep78 (1.7 μg), and various amounts of fraction IIA (IIA total protein concentration, 6 mg/ml), as indicated. Reaction mixtures were incubated for 2 h at 37°C, processed, and analyzed as described in Materials and Methods. Half of each reaction mixture was subjected to DpnI digestion and analyzed on 0.8% TBE-agarose; the remaining half was used to quantify [32 P]dAMP incorporation using a DE-81 filter binding assay (expressed as pmol of dAMP incorporated per 15 μl reaction mixture). The migration pattern and fragment size of radiolabeled HindIII-digested lambda DNA are indicated on the left.
    Figure Legend Snippet: P-Cell separation of replication proteins from Ad-infected cells. (A) Western blots of fractions I, IIA, IIB, and IIC with Pol δ, Pol ɛ, Pol α, Ad DBP, RFC, RPA, and PCNA antibodies. (B) Reconstitution of AAV DNA replication in vitro using fractionated Ad-infected-cell extracts. Standard replication reaction mixtures (30 μl) contained either crude Ad-infected-cell extract (C; 200 μg) or P-Cell fractions (I, 160 μg; IIA, 36 μg; IIC′, 30 μg; IID, 9 μg) and Rep78 (3.4 μg), as indicated. Reaction mixtures were incubated for 2 h at 37°C, processed, and analyzed as described in Materials and Methods. The DNA products from each reaction were digested with DpnI and analyzed on 0.8% Tris-borate-EDTA (TBE)-agarose. md and dd indicate monomer duplex and dimer duplex DNA species, respectively, which are resistant to DpnI digestion. DNA products sensitive to DpnI digestion are denoted by the black line. (C) Optimization of AAV DNA replication with RFC and P-Cell fractions I and IIA. Standard replication reaction mixtures (15 μl) contained either crude Ad-infected-cell extract (C; 100 μg) or P-Cell fraction I (80 μg), RFC (0.5 μg), Rep78 (1.7 μg), and various amounts of fraction IIA (IIA total protein concentration, 6 mg/ml), as indicated. Reaction mixtures were incubated for 2 h at 37°C, processed, and analyzed as described in Materials and Methods. Half of each reaction mixture was subjected to DpnI digestion and analyzed on 0.8% TBE-agarose; the remaining half was used to quantify [32 P]dAMP incorporation using a DE-81 filter binding assay (expressed as pmol of dAMP incorporated per 15 μl reaction mixture). The migration pattern and fragment size of radiolabeled HindIII-digested lambda DNA are indicated on the left.

    Techniques Used: Infection, Western Blot, Recombinase Polymerase Amplification, In Vitro, Incubation, Protein Concentration, Filter-binding Assay, Migration, Lambda DNA Preparation

    Related Articles

    Transduction:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Clone Assay:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Amplification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Stable Transfection:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Synthesized:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Autoradiography:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    TA Cloning:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Construct:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: Paragraph title: APE1 Plasmid Constructs ... The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ.

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Real-time Polymerase Chain Reaction:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Incubation:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Luciferase:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Activity Assay:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: Paragraph title: Enzyme activity assays ... The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Expressing:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: To create the fluorescently-tagged APE1 variant expression systems, the APE1 cDNA was PCR amplified from the respective pET11a plasmid constructs above using the following primers: Forward, 5′-CCCCAAGCTTTAATGCCGAAGCGTGG-3′ and Reverse, 5′-CGGGATCCTCACAGTGCTAGGTATAGG-3′ . .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Modification:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: Paragraph title: Construction of the modified EZ-Tn5 transposon vector and transposome preparation ... The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Transformation Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The digested EZ-Tn5 -carrying pMOD-2 plasmid and the erm gene PCR product were ligated overnight at 4°C with T4 DNA ligase (New England Biolab).

    Hybridization:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Countercurrent Chromatography:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Transfection:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: Paragraph title: Plasmids and Gene Transfection ... The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Southern Blot:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Ligation:

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Generated:

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. Genospecies’ designation of the isolates was performed by analyzing the resulting genospecies-specific PCR-RFLP patterns according to Michel et al. .

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    DNA Labeling:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Sequencing:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using NcoI and EcoRI, the 35S promoter of the pCAMBIA1304λ vector was replaced by 3.6 kb of the DAYSLEEPER promoter, resulting in pSDM4328.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Sequencing revealed that the genes encoding several EsaR* variants had multiple mutations ( ). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Binding Assay:

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    DNA Extraction:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Marker:

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Mutagenesis:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Paragraph title: Site-directed mutagenesis ... Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis.

    Isolation:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Subcloning:

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: Paragraph title: MCL1 promoter sub-cloning ... Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    Labeling:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Hot Start PCR:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. The digested PCR fragments were then analyzed by electrophoresis on a 2% agarose gel and visualized with ethidium bromide.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Article Title: A discrete chromatin loop in the murine Tcra-Tcrd locus shapes the TCRδ and TCRα repertoires
    Article Snippet: Hind III (NEB) was used to digest chromatin. .. 3C products were quantified by Taqman-based quantitative real-time PCR as described .

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    Gel Extraction:

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Purification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The reaction mix was overlaid with an ampliwax bead and subjected to 80°C heating for five minutes, 24°C for one minute and cooled down to 4°C for two minutes. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Plasmid Preparation:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    shRNA:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Agarose Gel Electrophoresis:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    In Vitro:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Paragraph title: Production of FLAG-tagged LANA and in vitro caspase cleavage of FLAG-LANA ... The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Concentration Assay:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    BAC Assay:

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    CTG Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Recombinant:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Variant Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The VP2 PCR product incorporated a recognition site for tobacco etch virus (TEV) protease between the MBP and VP2.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs hindiii
    Schematic representation of the prototype recombinant virus M24-BAC and the promoterless shuttle vector pFLS-ICP4 . ( a ) M24-BAC recombinant virus has the BAC sequences inserted into the UL39 (ICP6) gene of mutant HSV d120. (upper) d120 has a 4.1 kb deletion in both copies of the diploid ICP4 gene. (middle) The ICP6 gene coding the large subunit of viral ribonucleotide reductase is located in the 9.4 kb <t>HindIII</t> restriction fragment of the HSV genome. (lower) The BAC vector sequences were inserted into the d120 genome between the StuI and the XhoI sites of UL39 via homologous recombination using the recombination plasmid pBAC-ICP6EF. The mini F plasmid sequences contain four regulatory genes ( oriS , repE , parA , and parB ) essential for replication and copy number control of the plasmid [19]. H, HindIII; S, StuI; X, XhoI; Open boxes, HSV inverted repeats. The numbers in rectangles at the top of the figure show the lengths in kb of HindIII restriction fragments of d120. The numbers in parentheses show the lengths in kb of terminal restriction fragments. ( b ) Schematic map of the promoterless shuttle vector pFLS-ICP4. MCS is situated upstream of the HSV ICP4 coding sequence so that an exogenous promoter can be inserted to drive ICP4 expression.
    Hindiii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii/product/New England Biolabs
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    76
    New England Biolabs single cutter restriction enzyme hindiii
    BLM helicase stimulates the generation of uni-RIs. (A and D) 1D AGE analysis of the overall replication efficiency of the HPV11 WT genome (A) or VE genome (D) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and normalized to cell count. The number of cells per sample is indicated. Samples were digested with the single-cutter endonuclease <t>HindIII</t> and the methylation-sensitive restriction enzyme DpnI. The results are representative of 2 experiments. (B and E) 2D N/N AGE analysis of RIs generated from the HPV11 WT genome (B) or VE genome (E) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter endonuclease FspI and the methylation-sensitive restriction enzyme DpnI. The results are representative of 3 experiments. Experiments were normalized to the number of transfected cells. White arrows mark uni-RIs, black arrows mark theta-RIs, and thin black arrows mark late theta-RIs. (C and F) Scatter graph depicting the ratio of signals representing uni-RIs and theta-RIs. Scatter graph data represent quantitated Southern blot signals from 3 separate experiments for each data set; areas used for quantitation are marked with boxes in panels B and E. Each dot represents a separate experiment. Statistical significance was determined using an unpaired Student's t test, and error bars represent the standard deviations. P = 0.0100, t = 4.605 (C); P = 0.6102, t = 0.5522 (F).
    Single Cutter Restriction Enzyme Hindiii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single cutter restriction enzyme hindiii/product/New England Biolabs
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    single cutter restriction enzyme hindiii - by Bioz Stars, 2019-10
    76/100 stars
      Buy from Supplier

    Image Search Results


    Schematic representation of the prototype recombinant virus M24-BAC and the promoterless shuttle vector pFLS-ICP4 . ( a ) M24-BAC recombinant virus has the BAC sequences inserted into the UL39 (ICP6) gene of mutant HSV d120. (upper) d120 has a 4.1 kb deletion in both copies of the diploid ICP4 gene. (middle) The ICP6 gene coding the large subunit of viral ribonucleotide reductase is located in the 9.4 kb HindIII restriction fragment of the HSV genome. (lower) The BAC vector sequences were inserted into the d120 genome between the StuI and the XhoI sites of UL39 via homologous recombination using the recombination plasmid pBAC-ICP6EF. The mini F plasmid sequences contain four regulatory genes ( oriS , repE , parA , and parB ) essential for replication and copy number control of the plasmid [19]. H, HindIII; S, StuI; X, XhoI; Open boxes, HSV inverted repeats. The numbers in rectangles at the top of the figure show the lengths in kb of HindIII restriction fragments of d120. The numbers in parentheses show the lengths in kb of terminal restriction fragments. ( b ) Schematic map of the promoterless shuttle vector pFLS-ICP4. MCS is situated upstream of the HSV ICP4 coding sequence so that an exogenous promoter can be inserted to drive ICP4 expression.

    Journal: BMC Biotechnology

    Article Title: Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases

    doi: 10.1186/1472-6750-6-40

    Figure Lengend Snippet: Schematic representation of the prototype recombinant virus M24-BAC and the promoterless shuttle vector pFLS-ICP4 . ( a ) M24-BAC recombinant virus has the BAC sequences inserted into the UL39 (ICP6) gene of mutant HSV d120. (upper) d120 has a 4.1 kb deletion in both copies of the diploid ICP4 gene. (middle) The ICP6 gene coding the large subunit of viral ribonucleotide reductase is located in the 9.4 kb HindIII restriction fragment of the HSV genome. (lower) The BAC vector sequences were inserted into the d120 genome between the StuI and the XhoI sites of UL39 via homologous recombination using the recombination plasmid pBAC-ICP6EF. The mini F plasmid sequences contain four regulatory genes ( oriS , repE , parA , and parB ) essential for replication and copy number control of the plasmid [19]. H, HindIII; S, StuI; X, XhoI; Open boxes, HSV inverted repeats. The numbers in rectangles at the top of the figure show the lengths in kb of HindIII restriction fragments of d120. The numbers in parentheses show the lengths in kb of terminal restriction fragments. ( b ) Schematic map of the promoterless shuttle vector pFLS-ICP4. MCS is situated upstream of the HSV ICP4 coding sequence so that an exogenous promoter can be inserted to drive ICP4 expression.

    Article Snippet: To generate a stuffer sequence, the 4.0-kb AgeI-digest fragment of bacteriophage lambda DNA (nucleotide position 6562 – 10550) was obtained by digesting a HindIII digest of lambda DNA (New England Biolab, Beverly, MA).

    Techniques: Recombinant, BAC Assay, Plasmid Preparation, Mutagenesis, Homologous Recombination, Sequencing, Expressing

    Genomic structure of M24-BAC virus and pM24-BAC plasmid DNA . HindIII restriction analysis of M24-BAC virus DNA (left panel) and pM24-BAC plasmid DNA (right panel) is shown. Closed arrowhead: 9.4 kb HindIII fragment of d120 (containing ICP6 region), Open arrowheads: 15 kb and 2.2 kb HindIII fragments generated by insertion of the BAC sequences. A band present in M24-BAC digest just above the closed triangle is the submolar terminal restriction fragment (9.8 kb) derived from the short terminal repeat. This band is overlapped by the 9.4 kb restriction fragment of d120 and absent from pM24-BAC. The restriction pattern of pM24-BAC indicates that this clone contains both the U L and U S sequences of HSV genome in the forward orientation. Other bands present in the M24-BAC digest but not in pM24-BAC are submolar terminal fragments or L-S junction fragments derived from other isomeric forms of virus genome.

    Journal: BMC Biotechnology

    Article Title: Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases

    doi: 10.1186/1472-6750-6-40

    Figure Lengend Snippet: Genomic structure of M24-BAC virus and pM24-BAC plasmid DNA . HindIII restriction analysis of M24-BAC virus DNA (left panel) and pM24-BAC plasmid DNA (right panel) is shown. Closed arrowhead: 9.4 kb HindIII fragment of d120 (containing ICP6 region), Open arrowheads: 15 kb and 2.2 kb HindIII fragments generated by insertion of the BAC sequences. A band present in M24-BAC digest just above the closed triangle is the submolar terminal restriction fragment (9.8 kb) derived from the short terminal repeat. This band is overlapped by the 9.4 kb restriction fragment of d120 and absent from pM24-BAC. The restriction pattern of pM24-BAC indicates that this clone contains both the U L and U S sequences of HSV genome in the forward orientation. Other bands present in the M24-BAC digest but not in pM24-BAC are submolar terminal fragments or L-S junction fragments derived from other isomeric forms of virus genome.

    Article Snippet: To generate a stuffer sequence, the 4.0-kb AgeI-digest fragment of bacteriophage lambda DNA (nucleotide position 6562 – 10550) was obtained by digesting a HindIII digest of lambda DNA (New England Biolab, Beverly, MA).

    Techniques: BAC Assay, Plasmid Preparation, Generated, Derivative Assay

    Analysis of BAC clones after site-specific recombination . (a) HindIII restriction analysis of chloramphenicol/kanamycin double-resistant clones (pM24-BAC-CMV) after Cre-mediated integration between pM24-BAC and pFLS-CMV shuttle vector. Clones #3, 6, and 7 (marked with asterisks) show the expected restriction pattern. Clones #1, 2, 4, 5, and 8 contain an additional 7.8 kb fragment ( closed arrowhead ) and a greater amount of the 6.2 kb fragment ( open arrowhead ) which is consistent with the expected digestion pattern of pM24-BAC-CMV with doubly inserted shuttle vector [see Additional file 3 ]. Clone #10 also contains a greater amount of the 7.8 kb fragment, suggesting insertion of three or more copies of the shuttle vector. The remaining clone (#9) did not undergo recombination and shows a pattern identical to that of pM24-BAC. (b) HindIII restriction analysis of pM24-BAC-null clones obtained after Cre-mediated integration between pM24-BAC and pFLS-XICP4 shuttle vector. Clones #1, 2, 5, 9, 10 and 11 (marked with asterisks) show a restriction pattern consistent with singly integrated pM24-BAC-null. The other seven clones contain a partially deleted, incomplete HSV-BAC genome. The 8.2 kb HindIII fragment containing the BAC backbone ( arrow ) and the two neighboring fragments (20.1 and 2.2 kb; closed arrowheads ) are preserved in all clones, and the 8.6 kb fragment ( open arrowhead ) adjacent to the 2.2 kb fragment is preserved in all clones except clone #13. Other fragments are lost in the deletion clones and new fragments of varying lengths are observed, suggesting that these deletions occurred randomly at different locations. For the HindIII restriction map, see Fig 2a and Additional file 3 .

    Journal: BMC Biotechnology

    Article Title: Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases

    doi: 10.1186/1472-6750-6-40

    Figure Lengend Snippet: Analysis of BAC clones after site-specific recombination . (a) HindIII restriction analysis of chloramphenicol/kanamycin double-resistant clones (pM24-BAC-CMV) after Cre-mediated integration between pM24-BAC and pFLS-CMV shuttle vector. Clones #3, 6, and 7 (marked with asterisks) show the expected restriction pattern. Clones #1, 2, 4, 5, and 8 contain an additional 7.8 kb fragment ( closed arrowhead ) and a greater amount of the 6.2 kb fragment ( open arrowhead ) which is consistent with the expected digestion pattern of pM24-BAC-CMV with doubly inserted shuttle vector [see Additional file 3 ]. Clone #10 also contains a greater amount of the 7.8 kb fragment, suggesting insertion of three or more copies of the shuttle vector. The remaining clone (#9) did not undergo recombination and shows a pattern identical to that of pM24-BAC. (b) HindIII restriction analysis of pM24-BAC-null clones obtained after Cre-mediated integration between pM24-BAC and pFLS-XICP4 shuttle vector. Clones #1, 2, 5, 9, 10 and 11 (marked with asterisks) show a restriction pattern consistent with singly integrated pM24-BAC-null. The other seven clones contain a partially deleted, incomplete HSV-BAC genome. The 8.2 kb HindIII fragment containing the BAC backbone ( arrow ) and the two neighboring fragments (20.1 and 2.2 kb; closed arrowheads ) are preserved in all clones, and the 8.6 kb fragment ( open arrowhead ) adjacent to the 2.2 kb fragment is preserved in all clones except clone #13. Other fragments are lost in the deletion clones and new fragments of varying lengths are observed, suggesting that these deletions occurred randomly at different locations. For the HindIII restriction map, see Fig 2a and Additional file 3 .

    Article Snippet: To generate a stuffer sequence, the 4.0-kb AgeI-digest fragment of bacteriophage lambda DNA (nucleotide position 6562 – 10550) was obtained by digesting a HindIII digest of lambda DNA (New England Biolab, Beverly, MA).

    Techniques: BAC Assay, Clone Assay, Plasmid Preparation

    Analysis of genomic DNA from recombinant viruses generated using the Flip-Flop HSV-BAC system . DNA from two independent isolates was purified, digested with HindIII and electrophoresed on an agarose gel. The DNAs of parental viruses bM24-BAC and d120 illustrate the common fragments, while the asterisks denote fragments containing inserts derived from the shuttle vector. [see Additional file 3 ].

    Journal: BMC Biotechnology

    Article Title: Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases

    doi: 10.1186/1472-6750-6-40

    Figure Lengend Snippet: Analysis of genomic DNA from recombinant viruses generated using the Flip-Flop HSV-BAC system . DNA from two independent isolates was purified, digested with HindIII and electrophoresed on an agarose gel. The DNAs of parental viruses bM24-BAC and d120 illustrate the common fragments, while the asterisks denote fragments containing inserts derived from the shuttle vector. [see Additional file 3 ].

    Article Snippet: To generate a stuffer sequence, the 4.0-kb AgeI-digest fragment of bacteriophage lambda DNA (nucleotide position 6562 – 10550) was obtained by digesting a HindIII digest of lambda DNA (New England Biolab, Beverly, MA).

    Techniques: Recombinant, Generated, BAC Assay, Purification, Agarose Gel Electrophoresis, Derivative Assay, Plasmid Preparation

    Detection of the interaction between elements that neighbor each other in the chromosomal DNA. ( A ) Map of the analyzed region showing the positions of primers (arrows) and molecular beacon probes, the HindIII restriction site, element HS5 (black bar) and the first exon of the minor β-globin gene (red bar). ( B–D ) Diagrams showing a mean number of colonies per gel and error bars ( n = 6) in experiments with cross-linked and sonicated (7-s pulse) embryonic liver cells either not treated (B) or digested with restriction endonuclease HindIII (C) and further subjected to the cross-link reversal and DNA isolation procedure (D). In each case, an equivalent of ∼20 genomes was loaded per gel. Shown at the top-right corner of the diagram in (B) is one of the six gels run in the experiment. The percentage of binary colonies was calculated relative to the mean total number of individual colonies of each type. The raw data are presented in Supplementary Table S5 . For other details see legend to Figure 3 .

    Journal: Nucleic Acids Research

    Article Title: Quantitative analysis of genomic element interactions by molecular colony technique

    doi: 10.1093/nar/gkt1322

    Figure Lengend Snippet: Detection of the interaction between elements that neighbor each other in the chromosomal DNA. ( A ) Map of the analyzed region showing the positions of primers (arrows) and molecular beacon probes, the HindIII restriction site, element HS5 (black bar) and the first exon of the minor β-globin gene (red bar). ( B–D ) Diagrams showing a mean number of colonies per gel and error bars ( n = 6) in experiments with cross-linked and sonicated (7-s pulse) embryonic liver cells either not treated (B) or digested with restriction endonuclease HindIII (C) and further subjected to the cross-link reversal and DNA isolation procedure (D). In each case, an equivalent of ∼20 genomes was loaded per gel. Shown at the top-right corner of the diagram in (B) is one of the six gels run in the experiment. The percentage of binary colonies was calculated relative to the mean total number of individual colonies of each type. The raw data are presented in Supplementary Table S5 . For other details see legend to Figure 3 .

    Article Snippet: The DNA was digested by overnight incubation with 100 U of HindIII (New England Biolabs) at 37°C with shaking.

    Techniques: Sonication, DNA Extraction

    Molecular colonies produced by in-gel PCR amplification of test fragments from the murine β-globin locus. ( A ) Map of the murine β-globin locus showing β-globin genes (red arrows), olfactory receptor genes (OR, blue arrows) and the DNase I hypersensitive sites (HS, black vertical lines). The position of the test amplicons (named as in the text) is shown with black boxes below the map. The scale is in kilobases and according to the mouse genome contig (GenBank entry NT_039433.7). ( B–D ) Detection of DNA colonies using molecular beacons labeled with fluorophores FAM, Cy3 and Cy5, (B) gel containing ∼15 copies each of the sequences separately cloned in plasmids, (C) gel containing ∼15 copies of a plasmid carrying all three of the sequences, (D) gel containing ∼15 copies each of the separately cloned sequences plus ∼15 copies of a plasmid carrying all three of the sequences. ( E ) The color scheme used for the presentation of the gel images. The images obtained on detection of the FAM, Cy3, and Cy5 fluorescence have been artificially colored blue, green and red, respectively; if the signals overlap, the three colors produce a white color, whereas pairwise combinations produce yellow, cyan and magenta. ( F ) Merged images of two gels containing ∼15 copies of a haploid set of the murine genomic DNA digested at the HindIII or MboI sites as indicated. ( G ) Merged images of two gels containing formaldehyde–cross-linked fragments distributed in a gel either directly (cross-linked DNA) or after a standard cross-link reversal and DNA isolation procedure (de–cross-linked DNA). Each gel contained ∼15 copies of the haploid murine genome. ( H ) Histogram showing the results of three independent experiments carried out as in (G) in which six gels with samples of each of the two types were analyzed. The copy number of fragments detected in the experiments with de–cross-linked DNA was taken equal to 100%. Eror bars represent the standard deviation.

    Journal: Nucleic Acids Research

    Article Title: Quantitative analysis of genomic element interactions by molecular colony technique

    doi: 10.1093/nar/gkt1322

    Figure Lengend Snippet: Molecular colonies produced by in-gel PCR amplification of test fragments from the murine β-globin locus. ( A ) Map of the murine β-globin locus showing β-globin genes (red arrows), olfactory receptor genes (OR, blue arrows) and the DNase I hypersensitive sites (HS, black vertical lines). The position of the test amplicons (named as in the text) is shown with black boxes below the map. The scale is in kilobases and according to the mouse genome contig (GenBank entry NT_039433.7). ( B–D ) Detection of DNA colonies using molecular beacons labeled with fluorophores FAM, Cy3 and Cy5, (B) gel containing ∼15 copies each of the sequences separately cloned in plasmids, (C) gel containing ∼15 copies of a plasmid carrying all three of the sequences, (D) gel containing ∼15 copies each of the separately cloned sequences plus ∼15 copies of a plasmid carrying all three of the sequences. ( E ) The color scheme used for the presentation of the gel images. The images obtained on detection of the FAM, Cy3, and Cy5 fluorescence have been artificially colored blue, green and red, respectively; if the signals overlap, the three colors produce a white color, whereas pairwise combinations produce yellow, cyan and magenta. ( F ) Merged images of two gels containing ∼15 copies of a haploid set of the murine genomic DNA digested at the HindIII or MboI sites as indicated. ( G ) Merged images of two gels containing formaldehyde–cross-linked fragments distributed in a gel either directly (cross-linked DNA) or after a standard cross-link reversal and DNA isolation procedure (de–cross-linked DNA). Each gel contained ∼15 copies of the haploid murine genome. ( H ) Histogram showing the results of three independent experiments carried out as in (G) in which six gels with samples of each of the two types were analyzed. The copy number of fragments detected in the experiments with de–cross-linked DNA was taken equal to 100%. Eror bars represent the standard deviation.

    Article Snippet: The DNA was digested by overnight incubation with 100 U of HindIII (New England Biolabs) at 37°C with shaking.

    Techniques: Produced, Polymerase Chain Reaction, Amplification, Labeling, Clone Assay, Plasmid Preparation, Fluorescence, DNA Extraction, Standard Deviation

    Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.

    Journal: Nucleic Acids Research

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    doi: 10.1093/nar/gkw1097

    Figure Lengend Snippet: Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.

    Article Snippet: A total of 400 ng of linear dsDNA was treated with 1 μl of EcoRI (NEB, R0101S), BamHI (NEB, R0136S), SalI (NEB, R0138S) and HindIII (NEB, R0104S), respectively, at 37°C overnight to verify the presence of their recognition sites within the short 742 bp sequence.

    Techniques: Inhibition

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Journal: Nucleic Acids Research

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    doi: 10.1093/nar/gkw1097

    Figure Lengend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Article Snippet: A total of 400 ng of linear dsDNA was treated with 1 μl of EcoRI (NEB, R0101S), BamHI (NEB, R0136S), SalI (NEB, R0138S) and HindIII (NEB, R0104S), respectively, at 37°C overnight to verify the presence of their recognition sites within the short 742 bp sequence.

    Techniques: Generated, Incubation

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Journal: Nucleic Acids Research

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    doi: 10.1093/nar/gkw1097

    Figure Lengend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Article Snippet: A total of 400 ng of linear dsDNA was treated with 1 μl of EcoRI (NEB, R0101S), BamHI (NEB, R0136S), SalI (NEB, R0138S) and HindIII (NEB, R0104S), respectively, at 37°C overnight to verify the presence of their recognition sites within the short 742 bp sequence.

    Techniques: Microscopy

    BLM helicase stimulates the generation of uni-RIs. (A and D) 1D AGE analysis of the overall replication efficiency of the HPV11 WT genome (A) or VE genome (D) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and normalized to cell count. The number of cells per sample is indicated. Samples were digested with the single-cutter endonuclease HindIII and the methylation-sensitive restriction enzyme DpnI. The results are representative of 2 experiments. (B and E) 2D N/N AGE analysis of RIs generated from the HPV11 WT genome (B) or VE genome (E) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter endonuclease FspI and the methylation-sensitive restriction enzyme DpnI. The results are representative of 3 experiments. Experiments were normalized to the number of transfected cells. White arrows mark uni-RIs, black arrows mark theta-RIs, and thin black arrows mark late theta-RIs. (C and F) Scatter graph depicting the ratio of signals representing uni-RIs and theta-RIs. Scatter graph data represent quantitated Southern blot signals from 3 separate experiments for each data set; areas used for quantitation are marked with boxes in panels B and E. Each dot represents a separate experiment. Statistical significance was determined using an unpaired Student's t test, and error bars represent the standard deviations. P = 0.0100, t = 4.605 (C); P = 0.6102, t = 0.5522 (F).

    Journal: mBio

    Article Title: Interaction of the Human Papillomavirus E1 Helicase with UAF1-USP1 Promotes Unidirectional Theta Replication of Viral Genomes

    doi: 10.1128/mBio.00152-19

    Figure Lengend Snippet: BLM helicase stimulates the generation of uni-RIs. (A and D) 1D AGE analysis of the overall replication efficiency of the HPV11 WT genome (A) or VE genome (D) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and normalized to cell count. The number of cells per sample is indicated. Samples were digested with the single-cutter endonuclease HindIII and the methylation-sensitive restriction enzyme DpnI. The results are representative of 2 experiments. (B and E) 2D N/N AGE analysis of RIs generated from the HPV11 WT genome (B) or VE genome (E) in the absence (control) or presence (+BLMwt) of wild-type BLM overexpression. Low-molecular-weight DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter endonuclease FspI and the methylation-sensitive restriction enzyme DpnI. The results are representative of 3 experiments. Experiments were normalized to the number of transfected cells. White arrows mark uni-RIs, black arrows mark theta-RIs, and thin black arrows mark late theta-RIs. (C and F) Scatter graph depicting the ratio of signals representing uni-RIs and theta-RIs. Scatter graph data represent quantitated Southern blot signals from 3 separate experiments for each data set; areas used for quantitation are marked with boxes in panels B and E. Each dot represents a separate experiment. Statistical significance was determined using an unpaired Student's t test, and error bars represent the standard deviations. P = 0.0100, t = 4.605 (C); P = 0.6102, t = 0.5522 (F).

    Article Snippet: DNA samples were digested with single-cutter restriction enzyme HindIII (New England Biolabs) and methylation-sensitive restriction enzyme DpnI (New England Biolabs) at 37°C for 2 h prior to analysis.

    Techniques: Over Expression, Molecular Weight, Transfection, Cell Counting, Methylation, Generated, Southern Blot, Quantitation Assay

    E1-UAF1-USP1 interaction is necessary for efficient replication of the HPV11 genome in U2OS cells. A Southern blot analysis of the transient replication of the HPV11 WT genome and of three UBS mut genomes was performed (top), and a bar graph representing the replication efficiencies of the UBS mut genomes relative to the replication efficiency of the WT genome is shown (bottom). Total cellular DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter restriction enzyme HindIII and the methylation-sensitive restriction enzyme DpnI. The bar graph data represent quantitated Southern blot signals from two independent experiments; error bars represent standard deviations. Statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test. (B and C) Southern blot analysis of the transient replication of HPV11 WT (B) or VE (C) genomes in the presence of increasing concentrations of ML323 (top); bar graph representing the effect of ML323 on the replication efficiency of the HPV11 WT (B) or VE (C) genome (bottom). ML323 (Millipore Sigma) or DMSO as a vehicle was added to the cell culture medium 24 h posttransfection. The DMSO concentration was constant for all ML323 dilutions and for the no-ML323 control. Total cellular DNA was extracted from HPV11-transfected U2OS cells 48 h posttransfection and linearized prior to analysis. Bar graphs represent quantitated Southern blot signals from four independent experiments; error bars represent standard deviations. Statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test.

    Journal: mBio

    Article Title: Interaction of the Human Papillomavirus E1 Helicase with UAF1-USP1 Promotes Unidirectional Theta Replication of Viral Genomes

    doi: 10.1128/mBio.00152-19

    Figure Lengend Snippet: E1-UAF1-USP1 interaction is necessary for efficient replication of the HPV11 genome in U2OS cells. A Southern blot analysis of the transient replication of the HPV11 WT genome and of three UBS mut genomes was performed (top), and a bar graph representing the replication efficiencies of the UBS mut genomes relative to the replication efficiency of the WT genome is shown (bottom). Total cellular DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter restriction enzyme HindIII and the methylation-sensitive restriction enzyme DpnI. The bar graph data represent quantitated Southern blot signals from two independent experiments; error bars represent standard deviations. Statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test. (B and C) Southern blot analysis of the transient replication of HPV11 WT (B) or VE (C) genomes in the presence of increasing concentrations of ML323 (top); bar graph representing the effect of ML323 on the replication efficiency of the HPV11 WT (B) or VE (C) genome (bottom). ML323 (Millipore Sigma) or DMSO as a vehicle was added to the cell culture medium 24 h posttransfection. The DMSO concentration was constant for all ML323 dilutions and for the no-ML323 control. Total cellular DNA was extracted from HPV11-transfected U2OS cells 48 h posttransfection and linearized prior to analysis. Bar graphs represent quantitated Southern blot signals from four independent experiments; error bars represent standard deviations. Statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test.

    Article Snippet: DNA samples were digested with single-cutter restriction enzyme HindIII (New England Biolabs) and methylation-sensitive restriction enzyme DpnI (New England Biolabs) at 37°C for 2 h prior to analysis.

    Techniques: Southern Blot, Transfection, Methylation, Cell Culture, Concentration Assay

    Eliminating the expression of the E8^E2 repressor protein further decreases the replication efficiency of HPV11 genomes unable to bind UAF1. (A) Southern blot analysis of total DNA extracted from U2OS cells transfected with HPV11 WT, UBS mut , E8 mut , and E8 mut UBS mut genomes. Total cellular DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter restriction enzyme HindIII and the methylation-sensitive restriction enzyme DpnI. The results are representative of 2 experiments. (B) Bar graph representing the replication efficiencies of different HPV11 genomes relative to the replication efficiency of the WT genome. Data represent quantitated Southern blot signals from 2 separate experiments; statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test. Error bars represent the standard deviations.

    Journal: mBio

    Article Title: Interaction of the Human Papillomavirus E1 Helicase with UAF1-USP1 Promotes Unidirectional Theta Replication of Viral Genomes

    doi: 10.1128/mBio.00152-19

    Figure Lengend Snippet: Eliminating the expression of the E8^E2 repressor protein further decreases the replication efficiency of HPV11 genomes unable to bind UAF1. (A) Southern blot analysis of total DNA extracted from U2OS cells transfected with HPV11 WT, UBS mut , E8 mut , and E8 mut UBS mut genomes. Total cellular DNA was extracted from HPV11-transfected U2OS cells 72 h posttransfection and digested prior to analysis with the single-cutter restriction enzyme HindIII and the methylation-sensitive restriction enzyme DpnI. The results are representative of 2 experiments. (B) Bar graph representing the replication efficiencies of different HPV11 genomes relative to the replication efficiency of the WT genome. Data represent quantitated Southern blot signals from 2 separate experiments; statistical significance was determined using ordinary one-way ANOVA followed by Dunnett’s multiple-comparison test. Error bars represent the standard deviations.

    Article Snippet: DNA samples were digested with single-cutter restriction enzyme HindIII (New England Biolabs) and methylation-sensitive restriction enzyme DpnI (New England Biolabs) at 37°C for 2 h prior to analysis.

    Techniques: Expressing, Southern Blot, Transfection, Methylation