hin diii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HindIII
    Description:
    HindIII 50 000 units
    Catalog Number:
    R0104L
    Price:
    244
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs hin diii
    HindIII
    HindIII 50 000 units
    https://www.bioz.com/result/hin diii/product/New England Biolabs
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    hin diii - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis"

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    Journal: eLife

    doi: 10.7554/eLife.19669

    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from spo11 strains with inserts at HIS4 (top) and at URA3 (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.015
    Figure Legend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from spo11 strains with inserts at HIS4 (top) and at URA3 (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.015

    Techniques Used:

    Spo11-initiated events at the two insert loci. ( A ) Spo11-catalyzed DSBs are more frequent at HIS4 that at URA3 . Left—Southern blots of Eco RI digests of DNA from vde∆ strains, probed with pBR322 sequences, showing Spo11-DSBs in the Parent 2 insert (see Figure 1 ) in resection/repair-deficient sae2∆ mutant strains. Right—location of DSBs and probe and DSB frequencies (average of 7 and 8 hr samples from a single experiment; error bars represent range). Spo11-DSBs in the Parent 1 inserts at HIS4 and URA3 were at different locations within the insert, but displayed similar ratios between the two loci (data not shown). ( B ) Southern blots of Hin dIII digests of DNA from vde∆ strains, to detect total Spo11-initiated crossovers. ( C ) Southern blots of Hin dIII-VDE double digests of the same samples, to determine the background contribution of Spo11-initiated COs in subsequent experiments measuring VDE-initiated COs, which will be VDE-resistant due to conversion of the VRS site to VRS103 . Probes were as shown in Figure 1 . ( D ) Quantification of data in panels B (total COs; filled circles) and C (VDE-resistant COs; open circles). Data are from a single experiment. DOI: http://dx.doi.org/10.7554/eLife.19669.004
    Figure Legend Snippet: Spo11-initiated events at the two insert loci. ( A ) Spo11-catalyzed DSBs are more frequent at HIS4 that at URA3 . Left—Southern blots of Eco RI digests of DNA from vde∆ strains, probed with pBR322 sequences, showing Spo11-DSBs in the Parent 2 insert (see Figure 1 ) in resection/repair-deficient sae2∆ mutant strains. Right—location of DSBs and probe and DSB frequencies (average of 7 and 8 hr samples from a single experiment; error bars represent range). Spo11-DSBs in the Parent 1 inserts at HIS4 and URA3 were at different locations within the insert, but displayed similar ratios between the two loci (data not shown). ( B ) Southern blots of Hin dIII digests of DNA from vde∆ strains, to detect total Spo11-initiated crossovers. ( C ) Southern blots of Hin dIII-VDE double digests of the same samples, to determine the background contribution of Spo11-initiated COs in subsequent experiments measuring VDE-initiated COs, which will be VDE-resistant due to conversion of the VRS site to VRS103 . Probes were as shown in Figure 1 . ( D ) Quantification of data in panels B (total COs; filled circles) and C (VDE-resistant COs; open circles). Data are from a single experiment. DOI: http://dx.doi.org/10.7554/eLife.19669.004

    Techniques Used: Mutagenesis

    70–80% of VDE-DSBs are repaired. ( A ) Fraction of inserts remaining, calculated using Hin dIII digests (see Figure 1 ). For the arg4-VRS103 insert, the ratio (Parent 2 + CO2)/ (0.5 x LC) was calculated at 9 hr, and was then normalized to the 0 hr value. For the arg4-VRS insert, a similar calculation was made: (Parent 1 + NCO + CO1)/(0.5 x LC) ( B ) Relative recovery of interhomolog recombination products, calculated using Hin dIII-VDE double digests (see Figure 1 ). The sum of CO (average of CO1 and CO2) and NCO frequencies was divided by the frequency of total DSBs, as calculated in Figure 2A . Data are the average of two independent experiments; error bars represent range. DOI: http://dx.doi.org/10.7554/eLife.19669.006
    Figure Legend Snippet: 70–80% of VDE-DSBs are repaired. ( A ) Fraction of inserts remaining, calculated using Hin dIII digests (see Figure 1 ). For the arg4-VRS103 insert, the ratio (Parent 2 + CO2)/ (0.5 x LC) was calculated at 9 hr, and was then normalized to the 0 hr value. For the arg4-VRS insert, a similar calculation was made: (Parent 1 + NCO + CO1)/(0.5 x LC) ( B ) Relative recovery of interhomolog recombination products, calculated using Hin dIII-VDE double digests (see Figure 1 ). The sum of CO (average of CO1 and CO2) and NCO frequencies was divided by the frequency of total DSBs, as calculated in Figure 2A . Data are the average of two independent experiments; error bars represent range. DOI: http://dx.doi.org/10.7554/eLife.19669.006

    Techniques Used: Liquid Chromatography

    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Probes and gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.009
    Figure Legend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Probes and gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.009

    Techniques Used:

    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. In the gel with Hin DIII digests of samples from a pch2∆ mm4-mn yen1∆ slx1∆ strain with inserts at URA3 , the 9 hr sample was originally loaded between the 4 and 5 hr samples; this image was cut and spliced as indicated by vertical lines for presentation purposes. DOI: http://dx.doi.org/10.7554/eLife.19669.012
    Figure Legend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. In the gel with Hin DIII digests of samples from a pch2∆ mm4-mn yen1∆ slx1∆ strain with inserts at URA3 , the 9 hr sample was originally loaded between the 4 and 5 hr samples; this image was cut and spliced as indicated by vertical lines for presentation purposes. DOI: http://dx.doi.org/10.7554/eLife.19669.012

    Techniques Used:

    2) Product Images from "The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans"

    Article Title: The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.2001164

    Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.
    Figure Legend Snippet: Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.

    Techniques Used: Activity Assay, Migration, Concentration Assay, Standard Deviation, Agarose Gel Electrophoresis

    Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.
    Figure Legend Snippet: Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.

    Techniques Used: Plasmid Preparation, Incubation, Marker, Negative Control, Migration, Isolation

    An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.
    Figure Legend Snippet: An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.

    Techniques Used: Incubation, Isolation, Agarose Gel Electrophoresis

    3) Product Images from "An Agrobacterium tumefaciens Strain with Gamma-Aminobutyric Acid Transaminase Activity Shows an Enhanced Genetic Transformation Ability in Plants"

    Article Title: An Agrobacterium tumefaciens Strain with Gamma-Aminobutyric Acid Transaminase Activity Shows an Enhanced Genetic Transformation Ability in Plants

    Journal: Scientific Reports

    doi: 10.1038/srep42649

    GABA transaminase activity was introduced into A. tumefaciens . ( A ) Amino acid sequence comparison of GABA transaminase from E. coli K12 (gabTSCA772438), P. syringae pv. tomato DC3000 (gabT1: gabT1-PSPTO0259, gabT2: gabT2-PSPTO0301), P. aeruginosa PAO1 (gabT-PA0266). “ClustalW2” ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ) and “Jalview” ( http://www.jalview.org ) were used for calculation of amino acid multiple sequence alignment and display the alignment result, respectively. The residues were coloured according to their physicochemical properties as follows; Aliphatic/Hydrophobic, Aromatic, Positive, Negative, Hydrophilic, Conformationally Special and Cystein. Arrowheads indicate 3 of the 12 invariant amino acid residues among 16 aminotransferases with highly homologous peptides. The red box indicates a conserved motif (Ser [or Thr]-X-X-Lys) in the pyridoxalphosphate-binding peptide of aspartate aminotransferase (AAT) and histidinol-phosphate transaminases. The blue box indicates near identity between the homologous peptides of the histidinol-phosphate transaminases from E. coli K12 and Saccharomyces cerevisiae . ( B ) Construction of a plasmid for the expression of GABA transaminase ( gabT ) in A. tumefaciens. Hin dIII and Xba I fragments (ca. 1.6 kb) containing the GABA transaminase gene from E. coli K12 were ligated into the Hin dIII and Xba I sites of the broad-host-range plasmid pBBR1MCS-5, resulting in pBBR gabT . The expression of the GABA transaminase gene gabT was under the control of the lac promoter. MCS: multiple cloning site. ( C ) Detection of GABA activity in A. tumefaciens . Glutamic acid accumulation in the reaction buffer was measured according to the method of Akihiro et al . 48 . The open and closed circles indicate A. tumefaciens GV2260 (pBBR gabT , pIG121-Hm) and A. tumefaciens GV2260 (pBBR1MCS-5, pIG121-Hm), respectively. Bars represent the standard deviation (n = 3).
    Figure Legend Snippet: GABA transaminase activity was introduced into A. tumefaciens . ( A ) Amino acid sequence comparison of GABA transaminase from E. coli K12 (gabTSCA772438), P. syringae pv. tomato DC3000 (gabT1: gabT1-PSPTO0259, gabT2: gabT2-PSPTO0301), P. aeruginosa PAO1 (gabT-PA0266). “ClustalW2” ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ) and “Jalview” ( http://www.jalview.org ) were used for calculation of amino acid multiple sequence alignment and display the alignment result, respectively. The residues were coloured according to their physicochemical properties as follows; Aliphatic/Hydrophobic, Aromatic, Positive, Negative, Hydrophilic, Conformationally Special and Cystein. Arrowheads indicate 3 of the 12 invariant amino acid residues among 16 aminotransferases with highly homologous peptides. The red box indicates a conserved motif (Ser [or Thr]-X-X-Lys) in the pyridoxalphosphate-binding peptide of aspartate aminotransferase (AAT) and histidinol-phosphate transaminases. The blue box indicates near identity between the homologous peptides of the histidinol-phosphate transaminases from E. coli K12 and Saccharomyces cerevisiae . ( B ) Construction of a plasmid for the expression of GABA transaminase ( gabT ) in A. tumefaciens. Hin dIII and Xba I fragments (ca. 1.6 kb) containing the GABA transaminase gene from E. coli K12 were ligated into the Hin dIII and Xba I sites of the broad-host-range plasmid pBBR1MCS-5, resulting in pBBR gabT . The expression of the GABA transaminase gene gabT was under the control of the lac promoter. MCS: multiple cloning site. ( C ) Detection of GABA activity in A. tumefaciens . Glutamic acid accumulation in the reaction buffer was measured according to the method of Akihiro et al . 48 . The open and closed circles indicate A. tumefaciens GV2260 (pBBR gabT , pIG121-Hm) and A. tumefaciens GV2260 (pBBR1MCS-5, pIG121-Hm), respectively. Bars represent the standard deviation (n = 3).

    Techniques Used: Activity Assay, Sequencing, Binding Assay, Plasmid Preparation, Expressing, Clone Assay, Standard Deviation

    4) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190526

    Design of Plant X-tender expression vectors. Vector pCAMBIA 1300 (A) or Gateway vectors (pK7WG, pH7WG or pB7WG) (B) were used as a backbone. (A) I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette was introduced into the MCS region of pCAMBIA1300 by overlap-based cloning methods after backbone digestion with Bam HI and Hin dIII to obtain pCAMBIA_ASX. (B) T35S–AttR2– ccd B–AttR1 cassette was released from the Gateway plasmid backbone by digestion with Xba I and Sac I and replaced with a I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette by overlap-based cloning methods to obtain pK7WG_ASX, pH7WG_ASX or pB7WG_ASX. MCS: multiple cloning site, A0/B0: homology regions, Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Spec: selection marker conferring spectinomycin resistance in E . coli and A . tumefaciens , Hyg: selection marker conferring hygromycin resistance in plants, R: selection marker conferring resistance in plants (kanamycin resistance in pK7WG, hygromycin resistance in pH7WG, herbicide glufosinate-ammonium resistance in pB7WG), LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, Hin dIII, I- Sce I, Bam HI, Xba I, Sac I: restriction enzyme recognition sites, AttR1/AttR2: Gateway cloning recombination sites, T35S: cauliflower mosaic virus CaMV 35S terminator, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method.
    Figure Legend Snippet: Design of Plant X-tender expression vectors. Vector pCAMBIA 1300 (A) or Gateway vectors (pK7WG, pH7WG or pB7WG) (B) were used as a backbone. (A) I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette was introduced into the MCS region of pCAMBIA1300 by overlap-based cloning methods after backbone digestion with Bam HI and Hin dIII to obtain pCAMBIA_ASX. (B) T35S–AttR2– ccd B–AttR1 cassette was released from the Gateway plasmid backbone by digestion with Xba I and Sac I and replaced with a I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette by overlap-based cloning methods to obtain pK7WG_ASX, pH7WG_ASX or pB7WG_ASX. MCS: multiple cloning site, A0/B0: homology regions, Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Spec: selection marker conferring spectinomycin resistance in E . coli and A . tumefaciens , Hyg: selection marker conferring hygromycin resistance in plants, R: selection marker conferring resistance in plants (kanamycin resistance in pK7WG, hygromycin resistance in pH7WG, herbicide glufosinate-ammonium resistance in pB7WG), LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, Hin dIII, I- Sce I, Bam HI, Xba I, Sac I: restriction enzyme recognition sites, AttR1/AttR2: Gateway cloning recombination sites, T35S: cauliflower mosaic virus CaMV 35S terminator, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Selection, Marker, Ligation

    5) Product Images from "An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR"

    Article Title: An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-3-61

    Extension of sequence from clone 143-2-1 in the 5' (A) and 3' (B) directions . First round TVL-PCR products (top) were generated from templates prepared using Hin dIII (H), Eco RI (E), or Bam HI (B) digestion of genomic DNA. First round products were used as templates to generate second round products (bottom). Boxes (bottom gels) indicate the locations of the second round TVL-PCR products that proved to be the desired products.
    Figure Legend Snippet: Extension of sequence from clone 143-2-1 in the 5' (A) and 3' (B) directions . First round TVL-PCR products (top) were generated from templates prepared using Hin dIII (H), Eco RI (E), or Bam HI (B) digestion of genomic DNA. First round products were used as templates to generate second round products (bottom). Boxes (bottom gels) indicate the locations of the second round TVL-PCR products that proved to be the desired products.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Generated

    6) Product Images from "Atypical 16S rRNA Gene Copies in Ochrobactrum intermedium Strains Reveal a Large Genomic Rearrangement by Recombination between rrn Copies"

    Article Title: Atypical 16S rRNA Gene Copies in Ochrobactrum intermedium Strains Reveal a Large Genomic Rearrangement by Recombination between rrn Copies

    Journal:

    doi: 10.1128/JB.185.9.2901-2909.2003

    PFGE migration of undigested and I- Ceu I-digested genomic DNAs of O. intermedium strains ADV1 and ADV3. (A) Migration of high-molecular-weight fragments. Lanes 1 and 2, undigested DNA from strain ADV1 (lane 1) and strain ADV3 (lane 2); lanes 3 and 4, I- Ceu I-digested DNA from strain ADV1 (lane 3) and strain ADV3 (lane 4); Lanes Sc and Sp , Saccharomyces cerevisiae ( Sc ) and Schizosaccharomyces pombe ( Sp ) chromosomes (Bio-Rad) as molecular size markers. (B) Migration of low-molecular-weight I- Ceu I fragments. Lane 1, strain ADV1; lane 2, strain ADV3. Chromosomes and I- Ceu I digestion patterns of O. intermedium strains ADV2 and ADV4 to -7 are identical to patterns for strains ADV1 and ADV3, respectively (data not shown). A mixture of λ digested by Hin dIII, the λ concatemer, and Saccharomyces cerevisiae chromosomes was used as the molecular size marker (lane λ/ Sc ); the bands useful for the measure were, from the bottom, 27, 50, 100, 150, 200, 225, 250, and 285 kb.
    Figure Legend Snippet: PFGE migration of undigested and I- Ceu I-digested genomic DNAs of O. intermedium strains ADV1 and ADV3. (A) Migration of high-molecular-weight fragments. Lanes 1 and 2, undigested DNA from strain ADV1 (lane 1) and strain ADV3 (lane 2); lanes 3 and 4, I- Ceu I-digested DNA from strain ADV1 (lane 3) and strain ADV3 (lane 4); Lanes Sc and Sp , Saccharomyces cerevisiae ( Sc ) and Schizosaccharomyces pombe ( Sp ) chromosomes (Bio-Rad) as molecular size markers. (B) Migration of low-molecular-weight I- Ceu I fragments. Lane 1, strain ADV1; lane 2, strain ADV3. Chromosomes and I- Ceu I digestion patterns of O. intermedium strains ADV2 and ADV4 to -7 are identical to patterns for strains ADV1 and ADV3, respectively (data not shown). A mixture of λ digested by Hin dIII, the λ concatemer, and Saccharomyces cerevisiae chromosomes was used as the molecular size marker (lane λ/ Sc ); the bands useful for the measure were, from the bottom, 27, 50, 100, 150, 200, 225, 250, and 285 kb.

    Techniques Used: Migration, Molecular Weight, Marker

    Copy numbers of 16S rDNA (A) and 46-bp insertion (B) in the genome of O. intermedium. Shown are Southern blots of Hin dIII-digested genomic DNA from strains PR17/sat (lane 1), ADV1 (lane 2), ADV3 (lane 3), and ADV9 (lane 4) and reference strain LMG 3301T (lane 5) hybridized with the 16S rDNA probe (A) and the 46-bp insertion probe (B). Strain ADV2 showed a hybridization profile identical to that of strain ADV1; strains ADV4 to -7 showed hybridization profiles identical to that of strain ADV3; strains ADV10, ADV11, ADV14, and ADV24 showed hybridization profiles identical to the strain LMG 3301T profile (data not shown). Sizes of hybridizing fragments were calculated by using λ digested by Hin dIII as a molecular marker.
    Figure Legend Snippet: Copy numbers of 16S rDNA (A) and 46-bp insertion (B) in the genome of O. intermedium. Shown are Southern blots of Hin dIII-digested genomic DNA from strains PR17/sat (lane 1), ADV1 (lane 2), ADV3 (lane 3), and ADV9 (lane 4) and reference strain LMG 3301T (lane 5) hybridized with the 16S rDNA probe (A) and the 46-bp insertion probe (B). Strain ADV2 showed a hybridization profile identical to that of strain ADV1; strains ADV4 to -7 showed hybridization profiles identical to that of strain ADV3; strains ADV10, ADV11, ADV14, and ADV24 showed hybridization profiles identical to the strain LMG 3301T profile (data not shown). Sizes of hybridizing fragments were calculated by using λ digested by Hin dIII as a molecular marker.

    Techniques Used: Hybridization, Marker

    7) Product Images from "Design and Study of Efflux Function of EGFP Fused MexAB-OprM Membrane Transporter in Pseudomonas aeruginosa Using Fluorescence Spectroscopy"

    Article Title: Design and Study of Efflux Function of EGFP Fused MexAB-OprM Membrane Transporter in Pseudomonas aeruginosa Using Fluorescence Spectroscopy

    Journal: The Analyst

    doi: 10.1039/c4an00108g

    Characterization of egfp-mexB fusion gene using agarose gel electrophoresis: (A): (L1) DNA markers/ladders in base pair (bp); (L2) The egfp-mexB fusion gene amplified using both egfp P1 and mexB P2 as primers ; (L3) The ds- mexB gene amplified using the genomic DNA of P. aeruginosa as a template, and mexB P1 and P2 as primers ; (L4) The ds- egfp gene amplified using the plasmid (pEGFP) as a template and egfp P1 and P2 as primers. Arrows point to the PCR products of 750, 3100 and 3880 bp, which agree well with the number of base pairs of egfp, mexB and egfp-mexB fusion gene. The sequence of egfp-mexB is characterized using DNA sequencer and shown in . (B): (L1) DNA markers/ladders in bp; (L2) The pMMB67EH-EGFP-MexB vector digested by a pair of restriction enzymes, Sal I/ Hin dIII. Arrows point to the digested vector plasmids at 8800 bp and egfp-mexB fusion gene at 3880 bp.
    Figure Legend Snippet: Characterization of egfp-mexB fusion gene using agarose gel electrophoresis: (A): (L1) DNA markers/ladders in base pair (bp); (L2) The egfp-mexB fusion gene amplified using both egfp P1 and mexB P2 as primers ; (L3) The ds- mexB gene amplified using the genomic DNA of P. aeruginosa as a template, and mexB P1 and P2 as primers ; (L4) The ds- egfp gene amplified using the plasmid (pEGFP) as a template and egfp P1 and P2 as primers. Arrows point to the PCR products of 750, 3100 and 3880 bp, which agree well with the number of base pairs of egfp, mexB and egfp-mexB fusion gene. The sequence of egfp-mexB is characterized using DNA sequencer and shown in . (B): (L1) DNA markers/ladders in bp; (L2) The pMMB67EH-EGFP-MexB vector digested by a pair of restriction enzymes, Sal I/ Hin dIII. Arrows point to the digested vector plasmids at 8800 bp and egfp-mexB fusion gene at 3880 bp.

    Techniques Used: Agarose Gel Electrophoresis, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Sequencing

    8) Product Images from "A nematode effector protein similar to annexins in host plants"

    Article Title: A nematode effector protein similar to annexins in host plants

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erp293

    Genomic DNA of Heterodera schachtii and H. glycines digested with Bam HI (B) and Hin dIII (H) was hybridized on blots with a 162 bp Hg4F01 DIG-labelled cDNA probe and revealed two potential 4F01 annexin-like family members in each cyst nematode species. M, molecular weight marker shown in Kb.
    Figure Legend Snippet: Genomic DNA of Heterodera schachtii and H. glycines digested with Bam HI (B) and Hin dIII (H) was hybridized on blots with a 162 bp Hg4F01 DIG-labelled cDNA probe and revealed two potential 4F01 annexin-like family members in each cyst nematode species. M, molecular weight marker shown in Kb.

    Techniques Used: Molecular Weight, Marker

    9) Product Images from "Genetic Characteristics of Borrelia coriaceae Isolates from the Soft Tick Ornithodoros coriaceus (Acari: Argasidae)"

    Article Title: Genetic Characteristics of Borrelia coriaceae Isolates from the Soft Tick Ornithodoros coriaceus (Acari: Argasidae)

    Journal:

    doi:

    Southern hybridization of Apa I (a)-, Bam HI (b)-, and Hin dIII (c)-digested DNAs of Borrelia isolates with digoxigenin-labeled Co53 DNA as a probe. Lanes: 1, CA434; 2, CA435; 3, Co53; 4, B. parkeri ; 5, CA4. Southern hybridization and detection of DNA which hybridized to the probe were done as recommended by Boehringer Mannheim for the digoxigenin DNA labeling and detection kit.
    Figure Legend Snippet: Southern hybridization of Apa I (a)-, Bam HI (b)-, and Hin dIII (c)-digested DNAs of Borrelia isolates with digoxigenin-labeled Co53 DNA as a probe. Lanes: 1, CA434; 2, CA435; 3, Co53; 4, B. parkeri ; 5, CA4. Southern hybridization and detection of DNA which hybridized to the probe were done as recommended by Boehringer Mannheim for the digoxigenin DNA labeling and detection kit.

    Techniques Used: Hybridization, Labeling, DNA Labeling

    10) Product Images from "Modulation of RNase E Activity by Alternative RNA Binding Sites"

    Article Title: Modulation of RNase E Activity by Alternative RNA Binding Sites

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0090610

    Effects of Y25A and Q36R on the catalytic activity of RNase E in vivo and in vitro . (A) Plasmid copy number of pNRNE4, pNRNE4-Q36R and pNRNE4-Y25A in KSL2000. Plasmids were purified from KSL2000 cells harboring pNRNE4, pNRNE4-Q36R or pNRNE4-Y25A and were digested with Hin dIII, which has a unique cleavage site in all of the plasmids tested. Plasmid copy number was calculated relative to the concurrent presence of the pSC101 derivative (pBAD-RNE), which replicates independently of Rne, by measuring the molar ratio of the ColE1-type plasmid to the pBAD-RNE plasmid. (B) Growth characteristics of KSL2003 cells expressing wild-type N-Rne or the Q36R or Y25A mutant proteins. Growth of KSL2003 cells harboring pLAC-RNE2, pLAC-RNE2-Q36R, or pLAC-RNE2-Y25A was measured individually on LB-agar plates containing 1.0 to 1000 µM IPTG. Numbers on the top indicate the number of bacterial cells in each spot. (C) Plasmid copy number of pET28a in KSL2003. Plasmids were purified from KSL2003, KSL2003-Q36R or KSL2003-Y25A cells harboring pET28a and digested with Hin dIII, which has a unique cleavage site in all the plasmids tested. Plasmid copy number was calculated relative to the concurrent presence of the pSC101 derivative (pLAC-RNE2, pLAC-RNE2-Q36R or pLAC-RNE2-Y25A) by measuring the molar ratio of the ColE1-type plasmid to the pSC101-derived plasmid. (D) Expression profiles of Rne and mutant proteins in KSL2003. The membrane probed with an anti-Rne polyclonal antibody was stripped and reprobed with an anti-S1 polyclonal antibody to provide an internal standard. The relative abundance of protein was quantified by setting the amount of wild-type Rne to 1. KSL2003 cells were grown in LB medium containing 10 µM IPTG. (E) In vitro cleavage of p-BR13 by wild-type N-Rne, Q36R and Y25A mutant proteins. Two pmol of 5′ end-labeled p-BR13 was incubated with 1 pmol of purified wild-type N-Rne or Q36R or Y25A mutant protein in 20 µl of cleavage buffer at 37°C. Samples were removed at each indicated time point and mixed with an equal volume of loading buffer. Samples were denatured at 65°C for 5 min and loaded onto 15% polyacrylamide gel containing 8 M urea. The radioactivity in each band was quantified using a phosphorimager and OptiQuant software.
    Figure Legend Snippet: Effects of Y25A and Q36R on the catalytic activity of RNase E in vivo and in vitro . (A) Plasmid copy number of pNRNE4, pNRNE4-Q36R and pNRNE4-Y25A in KSL2000. Plasmids were purified from KSL2000 cells harboring pNRNE4, pNRNE4-Q36R or pNRNE4-Y25A and were digested with Hin dIII, which has a unique cleavage site in all of the plasmids tested. Plasmid copy number was calculated relative to the concurrent presence of the pSC101 derivative (pBAD-RNE), which replicates independently of Rne, by measuring the molar ratio of the ColE1-type plasmid to the pBAD-RNE plasmid. (B) Growth characteristics of KSL2003 cells expressing wild-type N-Rne or the Q36R or Y25A mutant proteins. Growth of KSL2003 cells harboring pLAC-RNE2, pLAC-RNE2-Q36R, or pLAC-RNE2-Y25A was measured individually on LB-agar plates containing 1.0 to 1000 µM IPTG. Numbers on the top indicate the number of bacterial cells in each spot. (C) Plasmid copy number of pET28a in KSL2003. Plasmids were purified from KSL2003, KSL2003-Q36R or KSL2003-Y25A cells harboring pET28a and digested with Hin dIII, which has a unique cleavage site in all the plasmids tested. Plasmid copy number was calculated relative to the concurrent presence of the pSC101 derivative (pLAC-RNE2, pLAC-RNE2-Q36R or pLAC-RNE2-Y25A) by measuring the molar ratio of the ColE1-type plasmid to the pSC101-derived plasmid. (D) Expression profiles of Rne and mutant proteins in KSL2003. The membrane probed with an anti-Rne polyclonal antibody was stripped and reprobed with an anti-S1 polyclonal antibody to provide an internal standard. The relative abundance of protein was quantified by setting the amount of wild-type Rne to 1. KSL2003 cells were grown in LB medium containing 10 µM IPTG. (E) In vitro cleavage of p-BR13 by wild-type N-Rne, Q36R and Y25A mutant proteins. Two pmol of 5′ end-labeled p-BR13 was incubated with 1 pmol of purified wild-type N-Rne or Q36R or Y25A mutant protein in 20 µl of cleavage buffer at 37°C. Samples were removed at each indicated time point and mixed with an equal volume of loading buffer. Samples were denatured at 65°C for 5 min and loaded onto 15% polyacrylamide gel containing 8 M urea. The radioactivity in each band was quantified using a phosphorimager and OptiQuant software.

    Techniques Used: Activity Assay, In Vivo, In Vitro, Plasmid Preparation, Purification, Expressing, Mutagenesis, Derivative Assay, Labeling, Incubation, Radioactivity, Software

    11) Product Images from "Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137"

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137

    Journal: BioMed Research International

    doi: 10.1155/2014/845806

    Insert size distribution of randomly selected BAC clones including 453 clones constructed with Hin dIII (open bars) and 573 clones constructed with Bam HI (solid bars).
    Figure Legend Snippet: Insert size distribution of randomly selected BAC clones including 453 clones constructed with Hin dIII (open bars) and 573 clones constructed with Bam HI (solid bars).

    Techniques Used: BAC Assay, Clone Assay, Construct

    Partial digestion of DNA in half plugs. Lanes 1–8 contain DNA samples digested with restriction enzyme at the increasingly higher concentrations. (a) Partial digestions of half DNA plugs with serial dilutions of Hin dIII at 37°C for 30 min. (b) Partial digestions of half DNA plugs with serial dilutions of Bam HI at 37°C for 30 min. Plug pieces were separated on 1% agarose gel in 0.5x TBE and run in the CHEF DR-III System (Bio-Rad) at 6 V/cm, 1–50 s switch time, linear ramp, 120° angle at 14°C for 18 h. M: the λ PFG marker.
    Figure Legend Snippet: Partial digestion of DNA in half plugs. Lanes 1–8 contain DNA samples digested with restriction enzyme at the increasingly higher concentrations. (a) Partial digestions of half DNA plugs with serial dilutions of Hin dIII at 37°C for 30 min. (b) Partial digestions of half DNA plugs with serial dilutions of Bam HI at 37°C for 30 min. Plug pieces were separated on 1% agarose gel in 0.5x TBE and run in the CHEF DR-III System (Bio-Rad) at 6 V/cm, 1–50 s switch time, linear ramp, 120° angle at 14°C for 18 h. M: the λ PFG marker.

    Techniques Used: Agarose Gel Electrophoresis, Marker

    12) Product Images from "Atypical 16S rRNA Gene Copies in Ochrobactrum intermedium Strains Reveal a Large Genomic Rearrangement by Recombination between rrn Copies"

    Article Title: Atypical 16S rRNA Gene Copies in Ochrobactrum intermedium Strains Reveal a Large Genomic Rearrangement by Recombination between rrn Copies

    Journal:

    doi: 10.1128/JB.185.9.2901-2909.2003

    PFGE migration of undigested and I- Ceu I-digested genomic DNAs of O. intermedium strains ADV1 and ADV3. (A) Migration of high-molecular-weight fragments. Lanes 1 and 2, undigested DNA from strain ADV1 (lane 1) and strain ADV3 (lane 2); lanes 3 and 4, I- Ceu I-digested DNA from strain ADV1 (lane 3) and strain ADV3 (lane 4); Lanes Sc and Sp , Saccharomyces cerevisiae ( Sc ) and Schizosaccharomyces pombe ( Sp ) chromosomes (Bio-Rad) as molecular size markers. (B) Migration of low-molecular-weight I- Ceu I fragments. Lane 1, strain ADV1; lane 2, strain ADV3. Chromosomes and I- Ceu I digestion patterns of O. intermedium strains ADV2 and ADV4 to -7 are identical to patterns for strains ADV1 and ADV3, respectively (data not shown). A mixture of λ digested by Hin dIII, the λ concatemer, and Saccharomyces cerevisiae chromosomes was used as the molecular size marker (lane λ/ Sc ); the bands useful for the measure were, from the bottom, 27, 50, 100, 150, 200, 225, 250, and 285 kb.
    Figure Legend Snippet: PFGE migration of undigested and I- Ceu I-digested genomic DNAs of O. intermedium strains ADV1 and ADV3. (A) Migration of high-molecular-weight fragments. Lanes 1 and 2, undigested DNA from strain ADV1 (lane 1) and strain ADV3 (lane 2); lanes 3 and 4, I- Ceu I-digested DNA from strain ADV1 (lane 3) and strain ADV3 (lane 4); Lanes Sc and Sp , Saccharomyces cerevisiae ( Sc ) and Schizosaccharomyces pombe ( Sp ) chromosomes (Bio-Rad) as molecular size markers. (B) Migration of low-molecular-weight I- Ceu I fragments. Lane 1, strain ADV1; lane 2, strain ADV3. Chromosomes and I- Ceu I digestion patterns of O. intermedium strains ADV2 and ADV4 to -7 are identical to patterns for strains ADV1 and ADV3, respectively (data not shown). A mixture of λ digested by Hin dIII, the λ concatemer, and Saccharomyces cerevisiae chromosomes was used as the molecular size marker (lane λ/ Sc ); the bands useful for the measure were, from the bottom, 27, 50, 100, 150, 200, 225, 250, and 285 kb.

    Techniques Used: Migration, Molecular Weight, Marker

    13) Product Images from "The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans"

    Article Title: The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.2001164

    Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.
    Figure Legend Snippet: Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.

    Techniques Used: Activity Assay, Migration, Concentration Assay, Standard Deviation, Agarose Gel Electrophoresis

    Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.
    Figure Legend Snippet: Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.

    Techniques Used: Plasmid Preparation, Incubation, Marker, Negative Control, Migration, Isolation

    An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.
    Figure Legend Snippet: An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.

    Techniques Used: Incubation, Isolation, Agarose Gel Electrophoresis

    14) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190526

    Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
    Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

    Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Liquid Chromatography, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

    15) Product Images from "Genetic Characteristics of Borrelia coriaceae Isolates from the Soft Tick Ornithodoros coriaceus (Acari: Argasidae)"

    Article Title: Genetic Characteristics of Borrelia coriaceae Isolates from the Soft Tick Ornithodoros coriaceus (Acari: Argasidae)

    Journal:

    doi:

    Southern hybridization of Apa I (a)-, Bam HI (b)-, and Hin dIII (c)-digested DNAs of Borrelia isolates with digoxigenin-labeled Co53 DNA as a probe. Lanes: 1, CA434; 2, CA435; 3, Co53; 4, B. parkeri ; 5, CA4. Southern hybridization and detection of DNA which hybridized to the probe were done as recommended by Boehringer Mannheim for the digoxigenin DNA labeling and detection kit.
    Figure Legend Snippet: Southern hybridization of Apa I (a)-, Bam HI (b)-, and Hin dIII (c)-digested DNAs of Borrelia isolates with digoxigenin-labeled Co53 DNA as a probe. Lanes: 1, CA434; 2, CA435; 3, Co53; 4, B. parkeri ; 5, CA4. Southern hybridization and detection of DNA which hybridized to the probe were done as recommended by Boehringer Mannheim for the digoxigenin DNA labeling and detection kit.

    Techniques Used: Hybridization, Labeling, DNA Labeling

    16) Product Images from "Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137"

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137

    Journal: BioMed Research International

    doi: 10.1155/2014/845806

    Partial digestion of DNA in half plugs. Lanes 1–8 contain DNA samples digested with restriction enzyme at the increasingly higher concentrations. (a) Partial digestions of half DNA plugs with serial dilutions of Hin dIII at 37°C for 30 min. (b) Partial digestions of half DNA plugs with serial dilutions of Bam HI at 37°C for 30 min. Plug pieces were separated on 1% agarose gel in 0.5x TBE and run in the CHEF DR-III System (Bio-Rad) at 6 V/cm, 1–50 s switch time, linear ramp, 120° angle at 14°C for 18 h. M: the λ PFG marker.
    Figure Legend Snippet: Partial digestion of DNA in half plugs. Lanes 1–8 contain DNA samples digested with restriction enzyme at the increasingly higher concentrations. (a) Partial digestions of half DNA plugs with serial dilutions of Hin dIII at 37°C for 30 min. (b) Partial digestions of half DNA plugs with serial dilutions of Bam HI at 37°C for 30 min. Plug pieces were separated on 1% agarose gel in 0.5x TBE and run in the CHEF DR-III System (Bio-Rad) at 6 V/cm, 1–50 s switch time, linear ramp, 120° angle at 14°C for 18 h. M: the λ PFG marker.

    Techniques Used: Agarose Gel Electrophoresis, Marker

    17) Product Images from "Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella"

    Article Title: Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2016.00545

    Determination of genome ends of UAB_Phi20 phage after digestion with EcoRI enzyme . Genome of bacteriophage P22 digested with Eco RI was used as control. Arrows indicate the 4007-bp fragment containing the pac sequence. Lambda DNA digested with Hin dIII (M1) or Bst EII (M2) were used as molecular markers. Sizes (bp) are indicated on both sides of the image.
    Figure Legend Snippet: Determination of genome ends of UAB_Phi20 phage after digestion with EcoRI enzyme . Genome of bacteriophage P22 digested with Eco RI was used as control. Arrows indicate the 4007-bp fragment containing the pac sequence. Lambda DNA digested with Hin dIII (M1) or Bst EII (M2) were used as molecular markers. Sizes (bp) are indicated on both sides of the image.

    Techniques Used: Sequencing, Lambda DNA Preparation

    Time-limited digestion with Bal 31 exonuclease of UAB_Phi78 and UAB_Phi87 DNA followed by digestion with Hin dIII and Spe I, respectively . Arrows indicate the sequentially degraded DNA bands of 2200 and 2080 bp for UAB_Phi78 (A) and of 4322 and 2819 bp for UAB_Phi87 (B) . M: marker lanes containing a mixture of λ DNA digested with Bst EII and φX174 digested with Hin fI (M1), λ-DNA-digested Hin dIII (M2), and λ-DNA-digested Bst EII (M3). Sizes (bp) are indicated on the left side of the images.
    Figure Legend Snippet: Time-limited digestion with Bal 31 exonuclease of UAB_Phi78 and UAB_Phi87 DNA followed by digestion with Hin dIII and Spe I, respectively . Arrows indicate the sequentially degraded DNA bands of 2200 and 2080 bp for UAB_Phi78 (A) and of 4322 and 2819 bp for UAB_Phi87 (B) . M: marker lanes containing a mixture of λ DNA digested with Bst EII and φX174 digested with Hin fI (M1), λ-DNA-digested Hin dIII (M2), and λ-DNA-digested Bst EII (M3). Sizes (bp) are indicated on the left side of the images.

    Techniques Used: Marker

    Related Articles

    Transduction:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Clone Assay:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Amplification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Stable Transfection:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Synthesized:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Autoradiography:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    TA Cloning:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Construct:

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: Paragraph title: APE1 Plasmid Constructs ... The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ.

    Real-time Polymerase Chain Reaction:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Incubation:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Luciferase:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Activity Assay:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: Paragraph title: Enzyme activity assays ... The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Expressing:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: To create the fluorescently-tagged APE1 variant expression systems, the APE1 cDNA was PCR amplified from the respective pET11a plasmid constructs above using the following primers: Forward, 5′-CCCCAAGCTTTAATGCCGAAGCGTGG-3′ and Reverse, 5′-CGGGATCCTCACAGTGCTAGGTATAGG-3′ . .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Modification:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: Paragraph title: Construction of the modified EZ-Tn5 transposon vector and transposome preparation ... The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Transformation Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The digested EZ-Tn5 -carrying pMOD-2 plasmid and the erm gene PCR product were ligated overnight at 4°C with T4 DNA ligase (New England Biolab).

    Hybridization:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Countercurrent Chromatography:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Transfection:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: Paragraph title: Plasmids and Gene Transfection ... The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Southern Blot:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Ligation:

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Generated:

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. Genospecies’ designation of the isolates was performed by analyzing the resulting genospecies-specific PCR-RFLP patterns according to Michel et al. .

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    DNA Labeling:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Sequencing:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Sequencing revealed that the genes encoding several EsaR* variants had multiple mutations ( ). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Binding Assay:

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    DNA Extraction:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Mutagenesis:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Paragraph title: Site-directed mutagenesis ... Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Isolation:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Subcloning:

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: Paragraph title: MCL1 promoter sub-cloning ... Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    Labeling:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Hot Start PCR:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: A discrete chromatin loop in the murine Tcra-Tcrd locus shapes the TCRδ and TCRα repertoires
    Article Snippet: Hind III (NEB) was used to digest chromatin. .. 3C products were quantified by Taqman-based quantitative real-time PCR as described .

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. The digested PCR fragments were then analyzed by electrophoresis on a 2% agarose gel and visualized with ethidium bromide.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    shRNA:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Purification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The reaction mix was overlaid with an ampliwax bead and subjected to 80°C heating for five minutes, 24°C for one minute and cooled down to 4°C for two minutes. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Plasmid Preparation:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Recombinant:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Agarose Gel Electrophoresis:

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    In Vitro:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Paragraph title: Production of FLAG-tagged LANA and in vitro caspase cleavage of FLAG-LANA ... The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Concentration Assay:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    CTG Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    BAC Assay:

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Marker:

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Gel Extraction:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Variant Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The VP2 PCR product incorporated a recognition site for tobacco etch virus (TEV) protease between the MBP and VP2.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs hin diii
    Southern blots of Hin <t>dIII</t> and Hin dIII-VDE digests of <t>DNA</t> from spo11 strains with inserts at HIS4 (top) and at URA3 (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.015
    Hin Diii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hin diii/product/New England Biolabs
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    hin diii - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from spo11 strains with inserts at HIS4 (top) and at URA3 (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.015

    Journal: eLife

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    doi: 10.7554/eLife.19669

    Figure Lengend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from spo11 strains with inserts at HIS4 (top) and at URA3 (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.015

    Article Snippet: Recombination products were detected on Southern blots containing genomic DNA digested with Hin dIII and VDE (P I-Sce I, New England Biolabs), using specific buffer for P I-Sce I.

    Techniques:

    Spo11-initiated events at the two insert loci. ( A ) Spo11-catalyzed DSBs are more frequent at HIS4 that at URA3 . Left—Southern blots of Eco RI digests of DNA from vde∆ strains, probed with pBR322 sequences, showing Spo11-DSBs in the Parent 2 insert (see Figure 1 ) in resection/repair-deficient sae2∆ mutant strains. Right—location of DSBs and probe and DSB frequencies (average of 7 and 8 hr samples from a single experiment; error bars represent range). Spo11-DSBs in the Parent 1 inserts at HIS4 and URA3 were at different locations within the insert, but displayed similar ratios between the two loci (data not shown). ( B ) Southern blots of Hin dIII digests of DNA from vde∆ strains, to detect total Spo11-initiated crossovers. ( C ) Southern blots of Hin dIII-VDE double digests of the same samples, to determine the background contribution of Spo11-initiated COs in subsequent experiments measuring VDE-initiated COs, which will be VDE-resistant due to conversion of the VRS site to VRS103 . Probes were as shown in Figure 1 . ( D ) Quantification of data in panels B (total COs; filled circles) and C (VDE-resistant COs; open circles). Data are from a single experiment. DOI: http://dx.doi.org/10.7554/eLife.19669.004

    Journal: eLife

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    doi: 10.7554/eLife.19669

    Figure Lengend Snippet: Spo11-initiated events at the two insert loci. ( A ) Spo11-catalyzed DSBs are more frequent at HIS4 that at URA3 . Left—Southern blots of Eco RI digests of DNA from vde∆ strains, probed with pBR322 sequences, showing Spo11-DSBs in the Parent 2 insert (see Figure 1 ) in resection/repair-deficient sae2∆ mutant strains. Right—location of DSBs and probe and DSB frequencies (average of 7 and 8 hr samples from a single experiment; error bars represent range). Spo11-DSBs in the Parent 1 inserts at HIS4 and URA3 were at different locations within the insert, but displayed similar ratios between the two loci (data not shown). ( B ) Southern blots of Hin dIII digests of DNA from vde∆ strains, to detect total Spo11-initiated crossovers. ( C ) Southern blots of Hin dIII-VDE double digests of the same samples, to determine the background contribution of Spo11-initiated COs in subsequent experiments measuring VDE-initiated COs, which will be VDE-resistant due to conversion of the VRS site to VRS103 . Probes were as shown in Figure 1 . ( D ) Quantification of data in panels B (total COs; filled circles) and C (VDE-resistant COs; open circles). Data are from a single experiment. DOI: http://dx.doi.org/10.7554/eLife.19669.004

    Article Snippet: Recombination products were detected on Southern blots containing genomic DNA digested with Hin dIII and VDE (P I-Sce I, New England Biolabs), using specific buffer for P I-Sce I.

    Techniques: Mutagenesis

    70–80% of VDE-DSBs are repaired. ( A ) Fraction of inserts remaining, calculated using Hin dIII digests (see Figure 1 ). For the arg4-VRS103 insert, the ratio (Parent 2 + CO2)/ (0.5 x LC) was calculated at 9 hr, and was then normalized to the 0 hr value. For the arg4-VRS insert, a similar calculation was made: (Parent 1 + NCO + CO1)/(0.5 x LC) ( B ) Relative recovery of interhomolog recombination products, calculated using Hin dIII-VDE double digests (see Figure 1 ). The sum of CO (average of CO1 and CO2) and NCO frequencies was divided by the frequency of total DSBs, as calculated in Figure 2A . Data are the average of two independent experiments; error bars represent range. DOI: http://dx.doi.org/10.7554/eLife.19669.006

    Journal: eLife

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    doi: 10.7554/eLife.19669

    Figure Lengend Snippet: 70–80% of VDE-DSBs are repaired. ( A ) Fraction of inserts remaining, calculated using Hin dIII digests (see Figure 1 ). For the arg4-VRS103 insert, the ratio (Parent 2 + CO2)/ (0.5 x LC) was calculated at 9 hr, and was then normalized to the 0 hr value. For the arg4-VRS insert, a similar calculation was made: (Parent 1 + NCO + CO1)/(0.5 x LC) ( B ) Relative recovery of interhomolog recombination products, calculated using Hin dIII-VDE double digests (see Figure 1 ). The sum of CO (average of CO1 and CO2) and NCO frequencies was divided by the frequency of total DSBs, as calculated in Figure 2A . Data are the average of two independent experiments; error bars represent range. DOI: http://dx.doi.org/10.7554/eLife.19669.006

    Article Snippet: Recombination products were detected on Southern blots containing genomic DNA digested with Hin dIII and VDE (P I-Sce I, New England Biolabs), using specific buffer for P I-Sce I.

    Techniques: Liquid Chromatography

    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Probes and gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.009

    Journal: eLife

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    doi: 10.7554/eLife.19669

    Figure Lengend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Probes and gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. DOI: http://dx.doi.org/10.7554/eLife.19669.009

    Article Snippet: Recombination products were detected on Southern blots containing genomic DNA digested with Hin dIII and VDE (P I-Sce I, New England Biolabs), using specific buffer for P I-Sce I.

    Techniques:

    Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. In the gel with Hin DIII digests of samples from a pch2∆ mm4-mn yen1∆ slx1∆ strain with inserts at URA3 , the 9 hr sample was originally loaded between the 4 and 5 hr samples; this image was cut and spliced as indicated by vertical lines for presentation purposes. DOI: http://dx.doi.org/10.7554/eLife.19669.012

    Journal: eLife

    Article Title: Local chromosome context is a major determinant of crossover pathway biochemistry during budding yeast meiosis

    doi: 10.7554/eLife.19669

    Figure Lengend Snippet: Southern blots of Hin dIII and Hin dIII-VDE digests of DNA from HIS4 insert-containing strains (top) and from URA3 insert-contaning strains (bottom). Gel labels are as in Figure 1 ; JM—joint molecule recombination intermediates. In the gel with Hin DIII digests of samples from a pch2∆ mm4-mn yen1∆ slx1∆ strain with inserts at URA3 , the 9 hr sample was originally loaded between the 4 and 5 hr samples; this image was cut and spliced as indicated by vertical lines for presentation purposes. DOI: http://dx.doi.org/10.7554/eLife.19669.012

    Article Snippet: Recombination products were detected on Southern blots containing genomic DNA digested with Hin dIII and VDE (P I-Sce I, New England Biolabs), using specific buffer for P I-Sce I.

    Techniques:

    Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.

    Journal: PLoS Biology

    Article Title: The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    doi: 10.1371/journal.pbio.2001164

    Figure Lengend Snippet: Mlh1-Mlh3’s endonuclease activity requires a continuous substrate and increases as substrate size increases. (A) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on circular pUC18 (linearized prior to gel loading) (2.7 kb; black), Hin dIII linearized pUC18 (red), and Hin dIII linearized pUC18 with streptavidin (SA) bound to ends (blue). Migration of linearized substrate (l) is indicated. (B) Average of two separate experiments: fraction nicked defined as fraction of substrate lost plotted against yeast Mlh1-Mlh3 concentration; error bars represent the standard deviation between three experiments. (C) Top: native agarose gel electrophoresis analysis of yeast Mlh1-Mlh3 (150 nM) endonuclease activity on circular substrate ranging from 2.7 kb to 12 kb. The concentration of nucleotide in each reaction is 15 μM. (D) Quantification of nicking in lanes 4, 7, 10, and 13 in C averaged from three separate experiments. Error bars indicate standard deviation. (E) Denaturing agarose analysis of yeast Mlh1-Mlh3 nicking on 12-kb circular DNA (black) and Hin dIII linearized 12 kb substrate (red). (F) Average of three separate experiments; error bars represent standard deviation. All nicking reactions were carried out for 60 min.

    Article Snippet: The 2.7, 7 kb, and 12 kb linear DNA substrates were generated by digesting pUC18, pEAE399, or pEAE99 with Hin dIII (NEB) according to the manufacturer’s instructions.

    Techniques: Activity Assay, Migration, Concentration Assay, Standard Deviation, Agarose Gel Electrophoresis

    Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.

    Journal: PLoS Biology

    Article Title: The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    doi: 10.1371/journal.pbio.2001164

    Figure Lengend Snippet: Mlh1-Mlh3 can make DSBs on large DNA substrates. (A) Mlh1-Mlh3 makes exclusively linear product from a closed circular substrate approximately 12 kb in size. Experiments were performed identical to the manner described in Fig 2C using the indicated sized plasmids. Red asterisk indicates location where nicked 12 kb plasmid migrates. (B) 15 μM total nucleotide 12 kb circular substrate was incubated with 300 nM Mlh1-Mlh3 for the indicated period of time. Plasmid linearized with Hin dIII was used as a marker for linear product in the lane 8 of the left panel. 12 kb plasmid treated with DNaseI is used as a marker for closed circular, linear, and nicked species in lane 1. Lane 9 is a negative control reaction in which Mlh1-Mlh3 was omitted to indicate migration of closed circular substrate. The plot indicates quantification of the representative gel shown. (C) Experiment is identical to that conducted in B, except 15 μM total nucleotide 2.7 kb circular substrate was used. The plot indicates quantification of the representative gel shown. (D) Native gel analysis of material in Fig 2E lanes 7–11. (E). DSBs made by Mlh1-Mlh3 can be religated. 12 kb linear product from Mlh1-Mlh3 endonuclease assay (“Mlh1-Mlh3 linear pdt”) was gel isolated and incubated with T4 polymerase where indicated with a + (lanes 12–13) followed by T4 DNA ligase where indicated with a + (lanes 11, 13). As controls, 12 kb closed circular plasmid was linearized with either Sca I or Hin dIII and religated (lanes 4–7) or linearized with Hin dIII and blunted with T4 polymerase followed by a religation step (lanes 8–9). Gel-isolated 12 kb closed circular DNA and Sca I-linearized DNA were ran in lanes 2–3 as migration markers.

    Article Snippet: The 2.7, 7 kb, and 12 kb linear DNA substrates were generated by digesting pUC18, pEAE399, or pEAE99 with Hin dIII (NEB) according to the manufacturer’s instructions.

    Techniques: Plasmid Preparation, Incubation, Marker, Negative Control, Migration, Isolation

    An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.

    Journal: PLoS Biology

    Article Title: The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    doi: 10.1371/journal.pbio.2001164

    Figure Lengend Snippet: An activated Mlh1-Mlh3-DNA complex can nick DNA in trans. 0.7 nM 7.2 kb closed circular M13mp18 phagemid and 1.8 nM 2.7 kb linear pUC18 substrate were incubated with 300 nM Mlh1-Mlh3 under standard endonuclease assay conditions either in isolation or within the same reaction as indicated. (A) Reaction products were run on an alkaline agarose gel. The 7.2 kb substrate was linearized with Hin dIII prior to loading in the alkaline agarose gel. The material in lane 4 and 5 was mixed and run as a control in lane 11 to demonstrate the readout for a negative result. The fraction of DNA nicked was measured by determining the band density in either the 7.2 kb linear band or the 2.7 kb linear band by subtracting the density in a region immediately above the band as background and comparing it to the band densities in the negative controls. (B) Prior to linearization with Hin dIII, 10 μL of each reaction was removed and run on a native agarose gel.

    Article Snippet: The 2.7, 7 kb, and 12 kb linear DNA substrates were generated by digesting pUC18, pEAE399, or pEAE99 with Hin dIII (NEB) according to the manufacturer’s instructions.

    Techniques: Incubation, Isolation, Agarose Gel Electrophoresis

    Determination of genome ends of UAB_Phi20 phage after digestion with EcoRI enzyme . Genome of bacteriophage P22 digested with Eco RI was used as control. Arrows indicate the 4007-bp fragment containing the pac sequence. Lambda DNA digested with Hin dIII (M1) or Bst EII (M2) were used as molecular markers. Sizes (bp) are indicated on both sides of the image.

    Journal: Frontiers in Microbiology

    Article Title: Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella

    doi: 10.3389/fmicb.2016.00545

    Figure Lengend Snippet: Determination of genome ends of UAB_Phi20 phage after digestion with EcoRI enzyme . Genome of bacteriophage P22 digested with Eco RI was used as control. Arrows indicate the 4007-bp fragment containing the pac sequence. Lambda DNA digested with Hin dIII (M1) or Bst EII (M2) were used as molecular markers. Sizes (bp) are indicated on both sides of the image.

    Article Snippet: Purified DNA (1 μg) was digested with Hin dIII (UAB_Phi78) and Spe I (UAB_Phi87) restriction enzymes (New England Biolabs, Hitchin, UK) and analyzed by agarose gel electrophoresis (1%).

    Techniques: Sequencing, Lambda DNA Preparation

    Time-limited digestion with Bal 31 exonuclease of UAB_Phi78 and UAB_Phi87 DNA followed by digestion with Hin dIII and Spe I, respectively . Arrows indicate the sequentially degraded DNA bands of 2200 and 2080 bp for UAB_Phi78 (A) and of 4322 and 2819 bp for UAB_Phi87 (B) . M: marker lanes containing a mixture of λ DNA digested with Bst EII and φX174 digested with Hin fI (M1), λ-DNA-digested Hin dIII (M2), and λ-DNA-digested Bst EII (M3). Sizes (bp) are indicated on the left side of the images.

    Journal: Frontiers in Microbiology

    Article Title: Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella

    doi: 10.3389/fmicb.2016.00545

    Figure Lengend Snippet: Time-limited digestion with Bal 31 exonuclease of UAB_Phi78 and UAB_Phi87 DNA followed by digestion with Hin dIII and Spe I, respectively . Arrows indicate the sequentially degraded DNA bands of 2200 and 2080 bp for UAB_Phi78 (A) and of 4322 and 2819 bp for UAB_Phi87 (B) . M: marker lanes containing a mixture of λ DNA digested with Bst EII and φX174 digested with Hin fI (M1), λ-DNA-digested Hin dIII (M2), and λ-DNA-digested Bst EII (M3). Sizes (bp) are indicated on the left side of the images.

    Article Snippet: Purified DNA (1 μg) was digested with Hin dIII (UAB_Phi78) and Spe I (UAB_Phi87) restriction enzymes (New England Biolabs, Hitchin, UK) and analyzed by agarose gel electrophoresis (1%).

    Techniques: Marker