high quality taq polymerases qiagen taq dna polymerase  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Taq DNA Polymerase
    Qiagen Taq DNA Polymerase 250U 5U L 10 min at 97C 60 min at 94C Half life 2 to 4 kb min at 72C Extension Rate Genomic DNA and cDNA Sample PCR Amplification Exonuclease Enzyme Activity Minimal Optimization Ideal for Standard and Specialized PCR Applications Includes Taq DNA Polymerase 10x PCR Buffer 10x CoralLoad PCR Buffer 5x Q Solution 25mM MgCl2
    Catalog Number:
    Buy from Supplier

    Structured Review

    Qiagen high quality taq polymerases qiagen taq dna polymerase
    Qiagen Taq DNA Polymerase 250U 5U L 10 min at 97C 60 min at 94C Half life 2 to 4 kb min at 72C Extension Rate Genomic DNA and cDNA Sample PCR Amplification Exonuclease Enzyme Activity Minimal Optimization Ideal for Standard and Specialized PCR Applications Includes Taq DNA Polymerase 10x PCR Buffer 10x CoralLoad PCR Buffer 5x Q Solution 25mM MgCl2
    https://www.bioz.com/result/high quality taq polymerases qiagen taq dna polymerase/product/Qiagen
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high quality taq polymerases qiagen taq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars

    Related Products / Commonly Used Together

    hotstar hifidelity dna polymerase


    Related Articles

    Clone Assay:

    Article Title: RNA Stability Regulates Human T Cell Leukemia Virus Type 1 Gene Expression in Chronically-Infected CD4 T Cells
    Article Snippet: The human ASL promoter (−310 to +59) was amplified by polymerase chain reaction performed on genomic DNA purified from Jurkat T cells using Taq DNA polymerase (Qiagen,) and the following primer pair: cacctcgagcgggcctgatgtcatagcctctacc (forward) and gtcaagcttctccgcctggccgcacg (reverse). .. The NcoI/BamHI fragment encoding the Tax gene, 3′LTR and SV40 polyadenylation site from pHTLV-tat1 ( ) was cloned in pLTR-Luc replacing the Luc gene, to create pLTR-Tax.

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: DNA cloning and other manipulations were carried out according to the methods outlined by Sambrook et al. ( ). .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced. .. Full-length ospB and the ospF truncations were cloned into pGEX6P-1 using the BamHI and XhoI restriction sites, except for the C-terminal OspF construct where a SalI site was used at the 3′ end because of the XhoI site present in the C-terminal ospF sequence.


    Article Title: RNA Stability Regulates Human T Cell Leukemia Virus Type 1 Gene Expression in Chronically-Infected CD4 T Cells
    Article Snippet: .. The human ASL promoter (−310 to +59) was amplified by polymerase chain reaction performed on genomic DNA purified from Jurkat T cells using Taq DNA polymerase (Qiagen,) and the following primer pair: cacctcgagcgggcctgatgtcatagcctctacc (forward) and gtcaagcttctccgcctggccgcacg (reverse). .. The amplified product was ligated into the XhoI and HindIII sites of pGL3-Basic (Promega) to create pASL-Luc.

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Co-feeding Transmission and Its Contribution to the Perpetuation of the Lyme Disease Spirochete Borrelia afzelii
    Article Snippet: Aliquots of DNA suspensions (2 μL) were diluted to 50 μL by using 200 μm of each deoxynucleoside triphosphate, 1.5 mM MgCl2, 0.5 U Taq polymerase (Qiagen) as well as 15 pmol of the outer primer pair and PCR buffer supplied with the Taq polymerase. .. After the first amplification with the outer set of primers, 2 μL of the amplification product was transferred to a fresh tube containing 48 μL of the reaction mixture described above, except that 2.5 mM MgCl2 and 20 pmol of the inner primer pair: ( ) 16S2A–AGTCAAACGGGATGTAGCAATAC and 16S2B – GGTATTCTTTCTGATATCAACAG (positions 66–720) were used.

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: Chromosomal DNA from the S. pyogenes strain A82 was prepared with Genomic-tip 100/G columns (Qiagen) according to the manufacturer's instructions and used as a template for PCR amplification of the grab gene. .. 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer.

    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: .. Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany). .. PCR was carried out with a Perkin-Elmer thermal cycler (model 2400) and consisted of 1 cycle of 93°C for 5 min; 35 cycles of 20 s at 93°C, 60 s at 50°C, and 20 s at 72°C; and a final extension for 6 min at 72°C.

    Article Title: Transient In Vivo ?-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate
    Article Snippet: .. The primer sequences for the inner reaction were as follows: forward primer 5′-CAGCAGACCTCTGATCTCTT-3′ and reverse primer 5′-AGCCTTGACTCCACTCAGTT-3′; and the cycle conditions were 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1 min for 36 cycles amplified with Taq DNA polymerase (Qiagen). ..

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: .. All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced. ..

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: Paragraph title: PCR amplification and sequencing of pkdhfr and pfdhfr ... The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’].

    Article Title: Towards Quantitative mRNA Analysis in Paraffin-Embedded Tissues Using Real-Time Reverse Transcriptase-Polymerase Chain Reaction
    Article Snippet: Each RT-PCR reaction contained 0.1 μg of RNA in a 1× PCR buffer (Qiagen) supplemented with 1.25 mmol/L MgCl2 , 0.1 mmol/L of each deoxyribonucleoside triphosphate (dATP, dTTP, dGTP, dCTP), M1 and M2 primers (concentrations as shown in Table 1 ), 1 U Taq -polymerase (Qiagen), 50 U MULV reverse transcriptase (Applied Biosystems), and 20 U RNase inhibitor in a total volume of 40 μl. .. One step RT-PCR amplification was then performed in a Gene Amp PCR system 9700 thermocycler according to the following schedule: RT at 37°C for 60 minutes followed by denaturation at 94°C for 1 minute.

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Characterization of the Mycobiome of the Seagrass, Zostera marina, Reveals Putative Associations With Marine Chytrids
    Article Snippet: .. Using these primers, we performed PCR on DNA from two leaf epiphyte samples (sample IDs: 108A and 109A) using Taq DNA Polymerase (QIAGEN, Hilden, Germany) with the following conditions: 95°C for 5 min, 35 cycles at 94°C for 30 s, 52°C for 15 s, 72°C for 1 min, and a final extension at 72°C for 8 min ( ). .. PCR products were purified using the Nucleospin Gel and PCR kit (QIAGEN, Hilden, Germany).

    Article Title: RNA Stability Regulates Human T Cell Leukemia Virus Type 1 Gene Expression in Chronically-Infected CD4 T Cells
    Article Snippet: .. The human ASL promoter (−310 to +59) was amplified by polymerase chain reaction performed on genomic DNA purified from Jurkat T cells using Taq DNA polymerase (Qiagen,) and the following primer pair: cacctcgagcgggcctgatgtcatagcctctacc (forward) and gtcaagcttctccgcctggccgcacg (reverse). .. The amplified product was ligated into the XhoI and HindIII sites of pGL3-Basic (Promega) to create pASL-Luc.

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications. .. RT PCR was utilized to determine whether omcB and omcC were expressed during growth in the presence of two electron acceptors, fumarate and Fe(III) citrate.

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen). ..

    Article Title: Co-feeding Transmission and Its Contribution to the Perpetuation of the Lyme Disease Spirochete Borrelia afzelii
    Article Snippet: .. Aliquots of DNA suspensions (2 μL) were diluted to 50 μL by using 200 μm of each deoxynucleoside triphosphate, 1.5 mM MgCl2, 0.5 U Taq polymerase (Qiagen) as well as 15 pmol of the outer primer pair and PCR buffer supplied with the Taq polymerase. ..

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: Paragraph title: Recombinant DNA techniques and PCR ... 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer.

    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: .. Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany). .. PCR was carried out with a Perkin-Elmer thermal cycler (model 2400) and consisted of 1 cycle of 93°C for 5 min; 35 cycles of 20 s at 93°C, 60 s at 50°C, and 20 s at 72°C; and a final extension for 6 min at 72°C.

    Article Title: Evaluation of Combined General Primer-Mediated PCR Sequencing and Type-Specific PCR Strategies for Determination of Human Papillomavirus Genotypes in Cervical Cell Specimens ▿
    Article Snippet: .. The PCR conditions were adapted and optimized for the use of a different Taq DNA polymerase (QIAGEN) and for a different DNA thermocycler (iCycler from Bio-Rad). .. Indeed, as previously reported, adapting the rate of temperature changes in the thermocycler is essential for optimization of the sensitivity and also specificity of the general primer-mediated PCR ( , ).

    Article Title: Transient In Vivo ?-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate
    Article Snippet: The primer sequences for the TNS9.3 vector for the outer reaction were as follows: forward primer 5′-GGTGGACCATCCTCTAGGTA-3′ and reverse primer 5′-GGCCTTGAGCATCTGGATTC-3′; and the cycle conditions were 94°C for 0.5 min, 55°C for 0.5 min, and 72°C for 1 min for 12 cycles amplified with an Advantage 2 polymerase PCR kit (BD Biosciences). .. The primer sequences for the inner reaction were as follows: forward primer 5′-CAGCAGACCTCTGATCTCTT-3′ and reverse primer 5′-AGCCTTGACTCCACTCAGTT-3′; and the cycle conditions were 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1 min for 36 cycles amplified with Taq DNA polymerase (Qiagen).

    Article Title: Bufonid herpesvirus 1 (BfHV1) associated dermatitis and mortality in free ranging common toads (Bufo bufo) in Switzerland
    Article Snippet: Molecular diagnostics A PCR protocol was developed based on the nucleotide sequence of the DNA polymerase gene obtained by NGS (see above). .. More specifically, 40 pMol each of a forward (5′-CAAACTGAAGATACAGAAGGTTGGGG-3′) and a reverse (5′-GCGCGAGTGCTTTGTACGCAACC-3′) primer were added to a mix composed of 3 μl of 10X reaction buffer, 0.4 μl of a 10 mM dNTPs mix, 5 units of Taq DNA polymerase (Qiagen, Hombrechtikon, CH) and deionized-distilled water to a final volume of 30 μl.

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: .. All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced. ..

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: .. The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’]. .. The primary PCR was run using 2.5 μL DNA; 5 μL primary PCR was used in the nested PCR reaction.

    Article Title: Towards Quantitative mRNA Analysis in Paraffin-Embedded Tissues Using Real-Time Reverse Transcriptase-Polymerase Chain Reaction
    Article Snippet: .. Each RT-PCR reaction contained 0.1 μg of RNA in a 1× PCR buffer (Qiagen) supplemented with 1.25 mmol/L MgCl2 , 0.1 mmol/L of each deoxyribonucleoside triphosphate (dATP, dTTP, dGTP, dCTP), M1 and M2 primers (concentrations as shown in Table 1 ), 1 U Taq -polymerase (Qiagen), 50 U MULV reverse transcriptase (Applied Biosystems), and 20 U RNase inhibitor in a total volume of 40 μl. .. One step RT-PCR amplification was then performed in a Gene Amp PCR system 9700 thermocycler according to the following schedule: RT at 37°C for 60 minutes followed by denaturation at 94°C for 1 minute.

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: .. Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen). ..


    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: .. All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced. ..


    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany). .. Amplification products were separated by electrophoresis on 2% agarose gels in 40 mM Tris–20 mM acetic acid–1 mM EDTA buffer for 90 min at 100 V. A 100-bp DNA ladder (New England BioLabs) was used as a molecular size marker.


    Article Title: RNA Stability Regulates Human T Cell Leukemia Virus Type 1 Gene Expression in Chronically-Infected CD4 T Cells
    Article Snippet: Construction of pLTR-Luc (luciferase) was described previously ( ). .. The human ASL promoter (−310 to +59) was amplified by polymerase chain reaction performed on genomic DNA purified from Jurkat T cells using Taq DNA polymerase (Qiagen,) and the following primer pair: cacctcgagcgggcctgatgtcatagcctctacc (forward) and gtcaagcttctccgcctggccgcacg (reverse).


    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: PCR amplifications were performed by the random amplified polymorphic DNA (RAPD) technique with two arbitrary 16-mer oligonucleotide primers: (GACA)4 and M13 + 1, a modified wild-type phage M13 core sequence (GAGGGTGGCCGGTTCT) ( ). .. Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany).

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: For most herbarium specimens a modified protocol was used with a prolonged lysis step with proteinase K and β-mercaptoethanol ( ). .. Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen).

    Southern Blot:

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: Using the Multiprime DNA labeling system (Amersham Pharmacia Biotech, Piscataway, N.J.), probes for Southern blot analysis were labeled with [α-32 P]dCTP. .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.


    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).


    Article Title: Evaluation of Combined General Primer-Mediated PCR Sequencing and Type-Specific PCR Strategies for Determination of Human Papillomavirus Genotypes in Cervical Cell Specimens ▿
    Article Snippet: In this study, a PCR sequencing method was combined with type-specific PCR to detect HPV infection in cervical cells. .. The PCR conditions were adapted and optimized for the use of a different Taq DNA polymerase (QIAGEN) and for a different DNA thermocycler (iCycler from Bio-Rad).

    Gel Extraction:

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer. .. The PCR products were purified by gel extraction using the QIAquick PCR Purification kit (Qiagen).

    DNA Sequencing:

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’]. .. DNA sequencing of the nested PCR amplicons was performed by Macrogen (Seoul, Korea) [ ].

    DNA Labeling:

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: Using the Multiprime DNA labeling system (Amersham Pharmacia Biotech, Piscataway, N.J.), probes for Southern blot analysis were labeled with [α-32 P]dCTP. .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.


    Article Title: Characterization of the Mycobiome of the Seagrass, Zostera marina, Reveals Putative Associations With Marine Chytrids
    Article Snippet: Paragraph title: Sanger Sequencing ... Using these primers, we performed PCR on DNA from two leaf epiphyte samples (sample IDs: 108A and 109A) using Taq DNA Polymerase (QIAGEN, Hilden, Germany) with the following conditions: 95°C for 5 min, 35 cycles at 94°C for 30 s, 52°C for 15 s, 72°C for 1 min, and a final extension at 72°C for 8 min ( ).

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: Unless otherwise stated, all primers used to amplify G. sulfurreducens sequences were designed using the preliminary sequence of the G. sulfurreducens ). .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Five microliters of each cell suspension was transferred to a new well so that parallel PCR reactions using either a primer specific for the WT sequence (5′- ACATCCTGGATACCGCCGGCC) or for the Q61K mutant sequence (5′-ACATCCTGGATACCGCCGGCA) could be performed. .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: The grab sequence of GAS isolate A82 is identical with the grab sequence of S. pyogenes reference strain SF 370. .. 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer.

    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: PCR amplifications were performed by the random amplified polymorphic DNA (RAPD) technique with two arbitrary 16-mer oligonucleotide primers: (GACA)4 and M13 + 1, a modified wild-type phage M13 core sequence (GAGGGTGGCCGGTTCT) ( ). .. Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany).

    Article Title: Evaluation of Combined General Primer-Mediated PCR Sequencing and Type-Specific PCR Strategies for Determination of Human Papillomavirus Genotypes in Cervical Cell Specimens ▿
    Article Snippet: In this study, a PCR sequencing method was combined with type-specific PCR to detect HPV infection in cervical cells. .. The PCR conditions were adapted and optimized for the use of a different Taq DNA polymerase (QIAGEN) and for a different DNA thermocycler (iCycler from Bio-Rad).

    Article Title: Bufonid herpesvirus 1 (BfHV1) associated dermatitis and mortality in free ranging common toads (Bufo bufo) in Switzerland
    Article Snippet: Molecular diagnostics A PCR protocol was developed based on the nucleotide sequence of the DNA polymerase gene obtained by NGS (see above). .. More specifically, 40 pMol each of a forward (5′-CAAACTGAAGATACAGAAGGTTGGGG-3′) and a reverse (5′-GCGCGAGTGCTTTGTACGCAACC-3′) primer were added to a mix composed of 3 μl of 10X reaction buffer, 0.4 μl of a 10 mM dNTPs mix, 5 units of Taq DNA polymerase (Qiagen, Hombrechtikon, CH) and deionized-distilled water to a final volume of 30 μl.

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced. .. Full-length ospB and the ospF truncations were cloned into pGEX6P-1 using the BamHI and XhoI restriction sites, except for the C-terminal OspF construct where a SalI site was used at the 3′ end because of the XhoI site present in the C-terminal ospF sequence.

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: Paragraph title: PCR amplification and sequencing of pkdhfr and pfdhfr ... The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’].

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen).


    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: Paragraph title: Recombinant DNA techniques and PCR ... 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer.

    Article Title: Transient In Vivo ?-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate
    Article Snippet: CFU assays were performed with MethoCult H4230 methylcellulose medium (StemCell Technologies, Vancouver, BC, Canada) supplemented with recombinant human erythropoietin (5 U/ml; Amgen), recombinant human granulocyte-macrophage colony-stimulating factor (rhuGM-CSF, 10 ng/ml; Sandoz, East Hanover, NJ), recombinant human interleukin-3 (rhuIL-3, 10 ng/ml; Sandoz), and rhuSCF (100 ng/ml; Amgen) at 37°C in 5% CO2 . .. The primer sequences for the inner reaction were as follows: forward primer 5′-CAGCAGACCTCTGATCTCTT-3′ and reverse primer 5′-AGCCTTGACTCCACTCAGTT-3′; and the cycle conditions were 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1 min for 36 cycles amplified with Taq DNA polymerase (Qiagen).

    DNA Extraction:

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen).

    Nucleic Acid Electrophoresis:

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen). .. PCR fragments were checked for length and yield by gel electrophoresis on 1 % agarose gels and cleaned with either the Promega PCR cleaning kit (Promega) or Nucleospin Extract II (Macherey-Nagel, Düren, Germany) columns.


    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Five microliters of each cell suspension was transferred to a new well so that parallel PCR reactions using either a primer specific for the WT sequence (5′- ACATCCTGGATACCGCCGGCC) or for the Q61K mutant sequence (5′-ACATCCTGGATACCGCCGGCA) could be performed. .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: Paragraph title: Plasmid and mutant construction ... All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced.


    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: For the PCR screen, isolated colonies were picked into 10 μl of water in a 96-well PCR plate and then streaked onto LB plates containing ampicillin. .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer. .. Plasmid DNA was isolated using QIAprep Spin Plasmid kit (Qiagen).

    Size-exclusion Chromatography:

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: A nested PCR approach using the same assay and cycling conditions for both primary and nested PCR was used to amplify pfdhfr and pkdhfr (i.e., 95°C for 3 min, followed by 25 cycles of 95°C for 30 sec, 52°C for 90 sec, and 72°C for 90 sec). .. The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’].


    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: Using the Multiprime DNA labeling system (Amersham Pharmacia Biotech, Piscataway, N.J.), probes for Southern blot analysis were labeled with [α-32 P]dCTP. .. Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.


    Article Title: Characterization of the Mycobiome of the Seagrass, Zostera marina, Reveals Putative Associations With Marine Chytrids
    Article Snippet: Using these primers, we performed PCR on DNA from two leaf epiphyte samples (sample IDs: 108A and 109A) using Taq DNA Polymerase (QIAGEN, Hilden, Germany) with the following conditions: 95°C for 5 min, 35 cycles at 94°C for 30 s, 52°C for 15 s, 72°C for 1 min, and a final extension at 72°C for 8 min ( ). .. PCR products were purified using the Nucleospin Gel and PCR kit (QIAGEN, Hilden, Germany).

    Article Title: RNA Stability Regulates Human T Cell Leukemia Virus Type 1 Gene Expression in Chronically-Infected CD4 T Cells
    Article Snippet: .. The human ASL promoter (−310 to +59) was amplified by polymerase chain reaction performed on genomic DNA purified from Jurkat T cells using Taq DNA polymerase (Qiagen,) and the following primer pair: cacctcgagcgggcctgatgtcatagcctctacc (forward) and gtcaagcttctccgcctggccgcacg (reverse). .. The amplified product was ligated into the XhoI and HindIII sites of pGL3-Basic (Promega) to create pASL-Luc.

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer. .. The PCR products were purified by gel extraction using the QIAquick PCR Purification kit (Qiagen).

    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: Briefly, DNA was purified by phenol-chloroform extraction ( ) and precipitated with 0.5 volume of 7.5 M ammonium acetate and 2 volumes of absolute ethanol. .. Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens
    Article Snippet: Paragraph title: DNA manipulations and reverse transcriptase (RT) PCR conditions. ... Taq DNA polymerase (Qiagen Inc.) was used for all PCR amplifications.

    Article Title: Towards Quantitative mRNA Analysis in Paraffin-Embedded Tissues Using Real-Time Reverse Transcriptase-Polymerase Chain Reaction
    Article Snippet: .. Each RT-PCR reaction contained 0.1 μg of RNA in a 1× PCR buffer (Qiagen) supplemented with 1.25 mmol/L MgCl2 , 0.1 mmol/L of each deoxyribonucleoside triphosphate (dATP, dTTP, dGTP, dCTP), M1 and M2 primers (concentrations as shown in Table 1 ), 1 U Taq -polymerase (Qiagen), 50 U MULV reverse transcriptase (Applied Biosystems), and 20 U RNase inhibitor in a total volume of 40 μl. .. One step RT-PCR amplification was then performed in a Gene Amp PCR system 9700 thermocycler according to the following schedule: RT at 37°C for 60 minutes followed by denaturation at 94°C for 1 minute.

    Article Title: Correlation of transcription of MALAT-1, a novel noncoding RNA, with deregulated expression of tumor suppressor p53 in small DNA tumor virus models
    Article Snippet: .. Semi-quantitative RT-PCR was performed using previously published primers for T Ag[ ]and Taq Polymerase (Qiagen, USA). ..

    Quantitative RT-PCR:

    Article Title: Correlation of transcription of MALAT-1, a novel noncoding RNA, with deregulated expression of tumor suppressor p53 in small DNA tumor virus models
    Article Snippet: Paragraph title: Semi-quantitative and quantitative real-time RT-PCR ... Semi-quantitative RT-PCR was performed using previously published primers for T Ag[ ]and Taq Polymerase (Qiagen, USA).


    Article Title: Co-feeding Transmission and Its Contribution to the Perpetuation of the Lyme Disease Spirochete Borrelia afzelii
    Article Snippet: For PCR, the body of a tick was opened, and the contained mass of soft tissue was dissected out in physiologic saline and transferred to a tube containing 180 μL lysis buffer (ATL Tissue Lysis Buffer, Qiagen, Hilden, Germany) and 20 μL proteinase K (600 mAU/mg). .. Aliquots of DNA suspensions (2 μL) were diluted to 50 μL by using 200 μm of each deoxynucleoside triphosphate, 1.5 mM MgCl2, 0.5 U Taq polymerase (Qiagen) as well as 15 pmol of the outer primer pair and PCR buffer supplied with the Taq polymerase.

    Article Title: Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data
    Article Snippet: For most herbarium specimens a modified protocol was used with a prolonged lysis step with proteinase K and β-mercaptoethanol ( ). .. Amplifications were performed in a volume of 50 µL containing 10–100 ng genomic DNA, 50× PCR Buffer (Qiagen), 20 pmol of each primer, 5 m m dNTPs, 25 m m MgCl2 , 0·5 µg bovine serum albumin (Promega, Madison, WI, USA), and 2 units Taq DNA polymerase (Qiagen).

    Nested PCR:

    Article Title: Co-feeding Transmission and Its Contribution to the Perpetuation of the Lyme Disease Spirochete Borrelia afzelii
    Article Snippet: To increase sensitivity for detecting spirochetal DNA in ticks, we used nested PCR. .. Aliquots of DNA suspensions (2 μL) were diluted to 50 μL by using 200 μm of each deoxynucleoside triphosphate, 1.5 mM MgCl2, 0.5 U Taq polymerase (Qiagen) as well as 15 pmol of the outer primer pair and PCR buffer supplied with the Taq polymerase.

    Article Title: Transient In Vivo ?-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate
    Article Snippet: The resulting DNA-containing cell lysates were analyzed for TNS9.3 by nested PCR. .. The primer sequences for the inner reaction were as follows: forward primer 5′-CAGCAGACCTCTGATCTCTT-3′ and reverse primer 5′-AGCCTTGACTCCACTCAGTT-3′; and the cycle conditions were 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1 min for 36 cycles amplified with Taq DNA polymerase (Qiagen).

    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: .. The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’]. .. The primary PCR was run using 2.5 μL DNA; 5 μL primary PCR was used in the nested PCR reaction.

    Plasmid Preparation:

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Binding of ?2-macroglobulin to GRAB (Protein G-related ?2-macroglobulin-binding protein), an important virulence factor of group A streptococci, is mediated by two charged motifs in the ?A region
    Article Snippet: 50 ng of chromosomal DNA as a template using Taq DNA polymerase (Qiagen) or Pfu DNA polymerase (Stratagene) under the buffer conditions recommended by the manufacturer. .. Plasmid DNA was isolated using QIAprep Spin Plasmid kit (Qiagen).

    Article Title: Transient In Vivo ?-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate
    Article Snippet: The primer sequences for the TNS9.3 vector for the outer reaction were as follows: forward primer 5′-GGTGGACCATCCTCTAGGTA-3′ and reverse primer 5′-GGCCTTGAGCATCTGGATTC-3′; and the cycle conditions were 94°C for 0.5 min, 55°C for 0.5 min, and 72°C for 1 min for 12 cycles amplified with an Advantage 2 polymerase PCR kit (BD Biosciences). .. The primer sequences for the inner reaction were as follows: forward primer 5′-CAGCAGACCTCTGATCTCTT-3′ and reverse primer 5′-AGCCTTGACTCCACTCAGTT-3′; and the cycle conditions were 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1 min for 36 cycles amplified with Taq DNA polymerase (Qiagen).

    Article Title: Shigella flexneri T3SS effectors OspB and OspF target the nucleus to down-regulate the host inflammatory response via interactions with retinoblastoma protein
    Article Snippet: Paragraph title: Plasmid and mutant construction ... All the plasmids, and the primers used to construct these plasmids, are described in and . ospB and its native promoter along with the ospF truncations were amplified by colony PCR using Taq polymerase (Qiagen), cloned into pGEM-T (Promega), and sequenced.


    Article Title: Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia
    Article Snippet: The primary PCR was performed in a 50 μL reaction buffer volume, the nested PCR in a 100 μ L reaction buffer volume containing: 200 μM each deoxyribonucleotide triphosphate (dNTP; Bioline, Australia), 3 mM MgCl2 , (Qiagen, Australia), 0.05U/ μL Taq polymerase (Qiagen, Australia), and 200 nM each primer pair (Life Technologies, Australia): a) pfdhfr primary reaction: pfdhfr -p-fw [5’-TTTATGATGGAACAAGTCTGC-3’] and pfdhfr -p-rev [5’-taaatgataaaatccaatgttgtat-3’]; b) pfdhfr nested reaction: pfdhfr -n-fw [5’-acaagtctgcgacgttttcgatatttatg-3’] and pkdhfr -n-rev [5’-agtatatacatcgctaacaga-3’]; c) pkdhfr primary reaction: pkdhfr -p-fw [5’-TTATGGAACAAGTTTCCGACG-3’] and pkdhfr -p-rev [5’-TAAATCACAAAGTCCAGAGTGGTGCCC-3’]; d) pkdhfr nested reaction: pkdhfr -n-fw [5’-TTTCCGACGTTTTCGATATTTACGC-3’] and pkdhfr -n-rev [5’-GTTGTACACCTCGCTGACCGA-3’]. .. Sequences were analysed using Chromas Pro software (Technolysium Ltd., Australia) and BioEdit Sequence Alignment Editor[ ] against the reference P . knowlesi genome[ ].

    Agarose Gel Electrophoresis:

    Article Title: 8-Oxoguanine-mediated transcriptional mutagenesis causes Ras activation in mammalian cells
    Article Snippet: Amplified cDNA and pUC18 cloning vector were digested with XbaI and Hind III overnight at 37 °C, resolved on a 1% agarose gel, and gel purified. cDNA was ligated into pUC18, and the ligation reactions were used to transform DH5α E. coli . .. PCR was done for 25 cycles at an annealing temperature of 72 °C using Taq DNA polymerase (Qiagen).

    Article Title: Bufonid herpesvirus 1 (BfHV1) associated dermatitis and mortality in free ranging common toads (Bufo bufo) in Switzerland
    Article Snippet: More specifically, 40 pMol each of a forward (5′-CAAACTGAAGATACAGAAGGTTGGGG-3′) and a reverse (5′-GCGCGAGTGCTTTGTACGCAACC-3′) primer were added to a mix composed of 3 μl of 10X reaction buffer, 0.4 μl of a 10 mM dNTPs mix, 5 units of Taq DNA polymerase (Qiagen, Hombrechtikon, CH) and deionized-distilled water to a final volume of 30 μl. .. The obtained amplicons were resolved in a 2% agarose gel and examined under UV light.

    Article Title: Correlation of transcription of MALAT-1, a novel noncoding RNA, with deregulated expression of tumor suppressor p53 in small DNA tumor virus models
    Article Snippet: Semi-quantitative RT-PCR was performed using previously published primers for T Ag[ ]and Taq Polymerase (Qiagen, USA). .. Amplified cDNA was electrophoresed on 2% agarose gel (Sigma).

    Next-Generation Sequencing:

    Article Title: Bufonid herpesvirus 1 (BfHV1) associated dermatitis and mortality in free ranging common toads (Bufo bufo) in Switzerland
    Article Snippet: Molecular diagnostics A PCR protocol was developed based on the nucleotide sequence of the DNA polymerase gene obtained by NGS (see above). .. More specifically, 40 pMol each of a forward (5′-CAAACTGAAGATACAGAAGGTTGGGG-3′) and a reverse (5′-GCGCGAGTGCTTTGTACGCAACC-3′) primer were added to a mix composed of 3 μl of 10X reaction buffer, 0.4 μl of a 10 mM dNTPs mix, 5 units of Taq DNA polymerase (Qiagen, Hombrechtikon, CH) and deionized-distilled water to a final volume of 30 μl.


    Article Title: Characterization of the Mycobiome of the Seagrass, Zostera marina, Reveals Putative Associations With Marine Chytrids
    Article Snippet: Using these primers, we performed PCR on DNA from two leaf epiphyte samples (sample IDs: 108A and 109A) using Taq DNA Polymerase (QIAGEN, Hilden, Germany) with the following conditions: 95°C for 5 min, 35 cycles at 94°C for 30 s, 52°C for 15 s, 72°C for 1 min, and a final extension at 72°C for 8 min ( ). .. The resulting ABI files were viewed and a consensus sequence was produced using seqtrace following the Swabs to Genomes workflow ( ).


    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany). .. Amplification products were separated by electrophoresis on 2% agarose gels in 40 mM Tris–20 mM acetic acid–1 mM EDTA buffer for 90 min at 100 V. A 100-bp DNA ladder (New England BioLabs) was used as a molecular size marker.


    Article Title: Phenotypic Switching and Genetic Diversity of Cryptococcus neoformans
    Article Snippet: Amplification reactions were performed with volumes of 50 μl containing PCR buffer, 100 ng of template DNA, 0.2 mM each deoxynucleoside triphosphate, 10 pmol of primer, 3 mM magnesium acetate, and 1.5 U of Taq DNA polymerase (Qiagen, Hilden, Germany). .. The DNA was stained with ethidium bromide, visualized with UV transillumination, and photographed.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen high quality taq polymerases qiagen taq dna polymerase
    High Quality Taq Polymerases Qiagen Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high quality taq polymerases qiagen taq dna polymerase/product/Qiagen
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high quality taq polymerases qiagen taq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Qiagen high quality taq polymerase
    High Quality Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 74/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high quality taq polymerase/product/Qiagen
    Average 74 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high quality taq polymerase - by Bioz Stars, 2020-01
    74/100 stars
      Buy from Supplier

    Image Search Results