high fidelity taq dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Hot Start Taq DNA Polymerase
    Description:
    Hot Start Taq DNA Polymerase 1 000 units
    Catalog Number:
    m0495l
    Price:
    265
    Size:
    1 000 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs high fidelity taq dna polymerase
    Hot Start Taq DNA Polymerase
    Hot Start Taq DNA Polymerase 1 000 units
    https://www.bioz.com/result/high fidelity taq dna polymerase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high fidelity taq dna polymerase - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. The promoter fragment was excised from PCR8-DARPP-32 by digesting it with Kpn I and Hin dIII, and then cloned in the pGL3-basic vector to produce the pGL3- DARPP-32 promoter luciferase reporter.

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. PCR products were gel purified, cloned into pGEM‐T Easy (Promega) and 10–15 clones sequenced using T7 and T3 primers at the Australian Genome Research Facility (Brisbane, Australia).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: Paragraph title: 2.1. Cloning and overexpression ... The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. Approximately 100 ng of cleaned-up PCR product was cloned into vector pCR2.1-TOPO using the TOPO-TA cloning kit (Invitrogen) according to the manufacturer's instructions.

    Centrifugation:

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion. .. After the cytopathic effect, cells were scraped off dishes, washed, resuspended in PBS, subjected to 3 freeze/thaw cycles, and cell debris clarified from lysate through centrifugation.

    Amplification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. The first amplification of 35 cycles used flanking primers in a 25 μl reaction.

    Article Title: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders
    Article Snippet: .. Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers. ..

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: In the second round of amplification, primers Ap1 ( 5’- TCTTGATAGGGATCCGCTAGGATA-3’ ) and Ap2 ( 5’-ACCGTGGTTCTGGACTATCTGGATC-3’ ), were used to amplify a 497 bp fragment which identifies the EBV type-1 EBNA2 gene product, whereas primers Bp1 ( 5’-CATGGTAGCCTTAGGACATA-3’ ) and Bp2 ( 5’-AGACTTAGTTGATGCCCTAG-3’ ) amplified a 150 bp fragment that characterizes EBV type-2 EBNA2 gene product. .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Pure virus was amplified and recombinant viral DNA purified. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma). .. Restriction endonucleases were used according to the manufacturer’s specifications (Roche).

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: .. For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. The PCR program was 30 s at 94°C for initial denaturation, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 6 min, with a final extension time of 10 min at 68°C.

    Polymerase Chain Reaction:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite modified DNA was stored at −20°C and used for PCR within 2 months. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL). .. PCR reactions were run in duplicate (20 µl volume reactions).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. The first amplification of 35 cycles used flanking primers in a 25 μl reaction.

    Article Title: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders
    Article Snippet: .. Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers. ..

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: .. The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. For the first round of PCR using E2p1 and E2p2 primers, amplification conditions were as follows: after an initial heat activation step of 15 min at 95°C, 40 cycles of amplification were performed: denaturation for 5 min. at 95°C, annealing for 1 min. at 58°C, and extension for 1 min. at 72°C, followed by a final extension step of 10 min. at 72°C.

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion. .. All viruses were amplified in Vero cells.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: PCR amplicons were sequenced bidirectionally using the Applied Biosystems Big Dye Terminator version 3.1 Cycle Sequencing Kit and an ABI 3130xl genetic analyzer. .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: To detect Calm1 , Calm2 , and Calm3 mRNAs, quantitative reverse transcriptase PCR (qRT–PCR) was performed using the SYBR Green Master Mix (Bio‐Rad) according to the manufacturer's instructions. .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Article Title: Coding sequences of sarcoplasmic reticulum calcium ATPase regulatory peptides and expression of calcium regulatory genes in recurrent exertional rhabdomyolysis, et al. Coding sequences of sarcoplasmic reticulum calcium ATPase regulatory peptides and expression of calcium regulatory genes in recurrent exertional rhabdomyolysis
    Article Snippet: .. Each reaction contained 2 μL of sample cDNA, 2 μL of 2.5 mM dNTPs, 2 μL of 10× PCR buffer, 1 μL of EvaGreen dye, 1.5 μL of 1:10 ROX reference dye dilution, 0.125 μL of Hot Start taq DNA Polymerase, 2 μL of 1.6 μM forward primer, 2 μL of 1600 μM reverse primer, and 7.4 μL of sterile nuclease‐free distilled water. ..

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. The PCR program was 30 s at 94°C for initial denaturation, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 6 min, with a final extension time of 10 min at 68°C.

    TA Cloning:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Construct:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Donor plasmids for RMCE were constructed in the PCR2.1 backbone (Invitrogen) by the insertion of two expression cassettes: one encoding the GFP florescent marker and the other encoding the chimeric molecule specified. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Concentration Assay:

    Article Title: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders
    Article Snippet: Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers. .. Occasionally, 2.5% DMSO (final concentration) was used in difficult PCR reactions.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Real-time Polymerase Chain Reaction:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL). .. PCR reactions were run in duplicate (20 µl volume reactions).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Luciferase:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: Paragraph title: DARPP-32 promoter and luciferase activity assays ... To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Activity Assay:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: Paragraph title: DARPP-32 promoter and luciferase activity assays ... To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA).

    Expressing:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Genes with > log2 fold higher or lower expression in MFM vs. control muscle were also evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Donor plasmids for RMCE were constructed in the PCR2.1 backbone (Invitrogen) by the insertion of two expression cassettes: one encoding the GFP florescent marker and the other encoding the chimeric molecule specified. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Modification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite modified DNA was stored at −20°C and used for PCR within 2 months. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders
    Article Snippet: DNA for specimens collected prior to 2003 was extracted primarily using the STE method described by Hillis et al. [ ] and a modification of the Chelex extraction method [ ], described by Chippindale et al. [ ]. .. Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers.

    Crystallization Assay:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The recombinant protein used for crystallization comprised residues 20–247 of HpαCA plus six additional residues from the TEV cleavage site (GIDPFT).

    Over Expression:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: Paragraph title: 2.1. Cloning and overexpression ... The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse).

    Countercurrent Chromatography:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Transfection:

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: At 48 hours post transfection GFP fluorescent plaques were collected and further passaged in Vero cells until virus could be purified from a single plaque in a 96 well plate. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Ligation:

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. The deletion constructs were made by amplifying the pGL3- DARPP-32 plasmid with hot-start DNA polymerase, using specific primers designed with Kpn I and Hin dIII restriction sites, followed by ligation of the digested fragments.

    Generated:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. Primers were located in exon 1, forward: GTATTCTGAGAGGCTGCTGCTTAG and exon 11, reverse: TTCATTTGGCTTGTTACTCTTCTTG.

    DNA Sequencing:

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Sequencing:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders
    Article Snippet: We focused on two mitochondrial DNA (mtNDA) sequence regions for our phylogenetic analysis: a 1110 bp fragment of cytochrome b (Cytb), and a 619 bp fragment of NADH dehydrogenase subunit 2 plus adjacent tRNATRP and partial tRNAALA (ND2). .. Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers.

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: .. The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: BROCA sequencing included the following genes: ATM , ATR , BABAM1 , BAP1 , BARD1 , BLM , BRCA1 , BRCA2 , BRCC36 , BRE , BRIP1 , CDK12 , CHEK1 , CHEK2 , DCLRE1C , FAM175A , FANCC , ID4 , LIG4 , MLH1 , MRE11A , MSH2 , MSH6 , NBN , PALB2 , PIK3CA , PMS2 , PRKDC , PTEN , RAD50 , RAD51 , RAD51B , RAD51C , RAD51D , RBBP8 , SLX4 , TOPBP1 , TP53 , TP53BP1 , UIMC1 , USP28 , XRCC2 , XRCC3 , XRCC4 , XRCC5 , and XRCC6, and only clear loss-of-function mutations were reported ( ). .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Recombinant:

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The recombinant protein used for crystallization comprised residues 20–247 of HpαCA plus six additional residues from the TEV cleavage site (GIDPFT).

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Pure virus was amplified and recombinant viral DNA purified. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    DNA Extraction:

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: DNA manipulation DNA isolation was performed using the PureLink Genomic DNA mini kit (Life Technologies) except for TraDIS library genomic DNA isolation (see below). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Marker:

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Donor plasmids for RMCE were constructed in the PCR2.1 backbone (Invitrogen) by the insertion of two expression cassettes: one encoding the GFP florescent marker and the other encoding the chimeric molecule specified. .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Fluorescence:

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Methylation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Paragraph title: Promoter methylation analysis ... Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Paragraph title: 2.6. Methylation profiling – mouse germ cells ... Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Isolation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Promoter methylation analysis Genomic DNA was isolated by Proteinase K treatment, following a phenol-chloroform extraction protocol. .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: DNA was extracted (Qiagen, DNeasy kit) from freshly isolated germ cells and bisulfite‐treated (Zymo Research, EZ DNA Methylation Kit). .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: Isolation of plasmid DNA was carried out using the QIAprep spin miniprep kit (Qiagen). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: Total RNA was isolated from cell lines using the RNeasy Plus Mini Kit (QIAGEN). .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: Transcript Analysis by Reverse Transcription Polymerase Chain Reaction The total cellular RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer.

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: For cDNA synthesis using total RNA isolated from rat cortical neurons, 2 μg total RNA for each sample was treated with 1 unit of DNase I (Thermo Fisher Scientific) at 37°C for 30 min. DNase‐treated RNA was split in two: 1 μg was used for cDNA synthesis and the rest 1 μg for minus reverse transcriptase (−RT) reactions. .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Purification:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ). .. PCR products were gel purified, cloned into pGEM‐T Easy (Promega) and 10–15 clones sequenced using T7 and T3 primers at the Australian Genome Research Facility (Brisbane, Australia).

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Paragraph title: Viruses and virus purification ... PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. PCR products were cleaned up using the QIAquick PCR purification kit (Qiagen) according to the manufacturer's instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. Primers were located in exon 1, forward: GTATTCTGAGAGGCTGCTGCTTAG and exon 11, reverse: TTCATTTGGCTTGTTACTCTTCTTG.

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: Paragraph title: 4.5. Transcript Analysis by Reverse Transcription Polymerase Chain Reaction ... The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer.

    Quantitative RT-PCR:

    Article Title: Proteome and transcriptome profiling of equine myofibrillar myopathy identifies diminished peroxiredoxin 6 and altered cysteine metabolic pathways
    Article Snippet: Genes with > log2 fold higher or lower expression in MFM vs. control muscle were also evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). .. Thermocycling was conducted with EvaGreen dye (Biotium, Fremont, CA), ROX Reference Dye (Invitrogen, Life Technologies), and Hot Start Taq DNA Polymerase (New England BioLabs, Ipswich MA), using the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific, Rockford IL).

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. For quantitative RT-PCR, RNA was tested for quality on a Bioanalyzer (Agilent).

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: Paragraph title: cDNA synthesis and quantitative RT–PCR ... For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used.

    Gel Extraction:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. PCR products were gel extracted using the QIAGEN gel extraction kit (Qiagen, Hilden, Germany) and cloned into pCR2.1 (Invitrogen, Carlsbad, CA, USA).

    Nested PCR:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Paragraph title: EBV genotyping by nested PCR of the EBNA-2 gene ... Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Plasmid Preparation:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA). .. Plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) from at least ten clones, and sequence analyzed by IONTEK (Istanbul, Turkey).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: To construct the DARPP-32 promoter, we amplified the promoter region from −96 to −3115 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). .. A 3-kb fragment containing Kpn I and Hin dIII sites was then ligated into the PCR8 vector by using a TA cloning kit (Invitrogen Life Technologies).

    Article Title: Cloning, purification and preliminary crystallographic analysis of the complex of Helicobacter pylori α-carbonic anhydrase with acetazolamide
    Article Snippet: The coding sequence for HpαCA (247 amino-acid residues; UniProtKB ID K4NGD4_HELPY) lacking the N-terminal periplasmic targeting sequence was PCR-amplified from genomic DNA of strain 26695 of H. pylori using One Taq Hot Start DNA Polymerase (New England Biolabs) and the primers CACCAATACCAA­ATGGGATTATAAGAATA (forward) and TTAGCGGGTCTC­AGCTGAG (reverse). .. The amplified fragment was cloned into the pET151/D-TOPO vector using the TOPO cloning kit (Invitrogen) to produce an expression vector that contains an N-terminal His6 tag followed by a TEV protease cleavage site.

    Article Title: Enhancing The Bystander Killing Effect Of An Oncolytic HSV By Arming It With A Secretable Apoptosis Activator
    Article Snippet: Purified FusOn-H3-RFP viral DNA was co-transfected with the linear donor plasmids at a ratio of 10:1 (viral : donor plasmid) into the CreGH cells using FuGENE HD (Promega, Madison, WI). .. PCR was then performed using hot start taq polymerase (NEB) to ensure correct insertion location and verify chimeric molecule insertion.

    Article Title: A global genomic approach uncovers novel components for twitching motility-mediated biofilm expansion in Pseudomonas aeruginosa
    Article Snippet: Isolation of plasmid DNA was carried out using the QIAprep spin miniprep kit (Qiagen). .. DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB) as described by the manufacturer with the inclusion of Betaine (Sigma) or DMSO (Sigma).

    Article Title: Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI
    Article Snippet: For complementation analysis, the major hemolysin open reading frame was amplified with primers F-Hemolysin-Comp (5′-CCCACGGCAATATACGGAGATACA-3′) and R-Hemolysin-Comp (5′-TGGCTTACAACGTGTTGGATCAGG-3′), a template of 100 ng of Serratia sp. SCBI gDNA, and One Taq Hot Start DNA polymerase (New England BioLabs). .. Approximately 100 ng of cleaned-up PCR product was cloned into vector pCR2.1-TOPO using the TOPO-TA cloning kit (Invitrogen) according to the manufacturer's instructions.

    Software:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: Trace sequences were analyzed using Sequencher version 4.9 software (Gene Codes Corporation) and ABI Sequence Scanner version 1.0 software. .. RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs).

    SYBR Green Assay:

    Article Title: A retained intron in the 3′‐ UTR of Calm3 mRNA mediates its Staufen2‐ and activity‐dependent localization to neuronal dendrites
    Article Snippet: .. For detecting mRNA levels by qPCR, a homemade SYBR Green Mix [containing the following components at a final concentration of 1 M betaine (B0300; Sigma), 1× standard Taq buffer (NEB), 16 μM dNTPs (N0447S; NEB), BSA 20 μg/ml (B9000S; NEB), 0.6 U per reaction Hot‐Start Taq DNA polymerase (M0495S; NEB), and 1 μl/ml of 1:100 SYBR Green (20010; Lumiprobe)] (in ddH2 O) was used. .. Forward and reverse primer pair mix was used 2 μl per reaction from the following stock concentrations: Renilla and firefly luciferase at 3 μM, GFP 5 μM, and Calm3 ORF Fwd/Rev 2.5 μM; Calm3 ORF Fwd/Calm3 intron Rev 4 μM, Stau2 5 μM, pp1a 3 μM, GFP Fwd/Calm3 intron Rev 4 μM, and Renilla luciferase Fwd/Calm3 intron Rev 4 μM.

    Agarose Gel Electrophoresis:

    Article Title: Expanding the biodiversity of Oenococcus oeni through comparative genomics of apple cider and kombucha strains
    Article Snippet: .. PCR was performed with standard settings using standard Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA), product size was determined by agarose gel or multiNA, concentration by fluorescence (iQuant) or multiNA (Shimadzu, Japan), and sequencing was performed by Eurofins Genomics (Ebersberg, Germany). ..

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. Aliquots of 25 µL of PCR products were separated on a 2% agarose gel using the standard GeneRuler 100 bp DNA Ladder (Thermo Scientific).

    Spectrophotometry:

    Article Title: RING domain–deficient BRCA1 promotes PARP inhibitor and platinum resistance
    Article Snippet: RT-PCR assays were performed with cDNA generated using the SuperScript III First-Strand Synthesis System (Life Technologies, Thermo Fisher Scientific) and Hot Start Taq DNA Polymerase (New England BioLabs). .. RNA concentrations were determined with a spectrophotometer (NanoDrop; Thermo Fisher Scientific).

    DNA Methylation Assay:

    Article Title: Epigenetic Mechanisms Underlying the Dynamic Expression of Cancer-Testis Genes, PAGE2, -2B and SPANX-B, during Mesenchymal-to-Epithelial Transition
    Article Snippet: Bisulphite treatment of 200 ng genomic DNA was performed using Zymo DNA Methylation Gold Kit (Zymo Research, Irvine, CA, USA). .. Two rounds of DNA amplification were performed using One Taq Hot Start DNA polymerase (New England Bioscience/NEB, Ipswich, MA, USA) using a Perkin Elmer 9700 thermal cycler (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors), Cripto: Expression, epigenetic regulation and potential diagnostic use in testicular germ cell tumors
    Article Snippet: DNA was extracted (Qiagen, DNeasy kit) from freshly isolated germ cells and bisulfite‐treated (Zymo Research, EZ DNA Methylation Kit). .. Between 2 and 4 ng of bisulfite‐treated and untreated (control) DNA was subjected to two rounds of PCR amplification with Hot‐start Taq DNA Polymerase (NEB) (conditions described in ).

    Activation Assay:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. For the first round of PCR using E2p1 and E2p2 primers, amplification conditions were as follows: after an initial heat activation step of 15 min at 95°C, 40 cycles of amplification were performed: denaturation for 5 min. at 95°C, annealing for 1 min. at 58°C, and extension for 1 min. at 72°C, followed by a final extension step of 10 min. at 72°C.

    CTG Assay:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: .. The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. The PCR cycling conditions included 30 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C, with an initial 5 min denaturation step at 95 °C and a final 5 min extension step at 72 °C (35 cycles).

    Staining:

    Article Title: Involvement of Actin Cytoskeletal Components in Breast Cancer Cell Fusion with Human Mesenchymal Stroma/Stem-Like Cells
    Article Snippet: The cDNA reaction was performed for 10 min at 25 °C, followed by 1 h at 42 °C, and stopped at 72 °C for 10 min. Then, 2.5 µL of cDNA were amplified by polymerase chain reaction (PCR) with the following specific primers (customized by Eurofins MWG GmbH, Ebersberg, Germany): - FSCN (sense: 5′-CTG GCT ACA CGC TGG AGT TC-3′; antisense: 5′-CTG AGT CCC CTG CTG TCT CC-3′; amplification product 492 bp) - GAPDH (sense: 5′-ACC ACA GTC CAT GCC ATC AC-3′; anti-sense: 5′-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) The PCR reaction included 200 nM of each primer, 200 µM of dNTP, and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the appropriate buffer. .. Visualization was performed by GelRed staining (Biotium Inc., Fremont, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs high fidelity dna polymerase
    High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs platinum taq dna polymerase high fidelity
    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by <t>DNA</t> sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the <t>Taq</t> DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.
    Platinum Taq Dna Polymerase High Fidelity, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq dna polymerase high fidelity/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    platinum taq dna polymerase high fidelity - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Article Snippet: PCR fragment consisted of lraIR gene (from ATG to stop codon) obtained by LraI-Fw/LraI-Rev primers and Platinum™ Taq DNA Polymerase High Fidelity was purified, digested with Hin dIII and cloned into pMAL-c5X vector digested with Xmn I and Hin dIII restriction enzymes and transformed into ER2523 competent cells (New England Biolabs, Ltd. UK) previously transformed with pAZIL-LraRM construct ( ).

    Techniques: DNA Sequencing, Sequencing, Activity Assay

    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Article Snippet: Recombinant Lra I Restriction Endonuclease Overexpression in E. coli and Purification PCR fragment consisted of lraIR gene (from ATG to stop codon) obtained by LraI-Fw/LraI-Rev primers and Platinum™ Taq DNA Polymerase High Fidelity was purified, digested with Hin dIII and cloned into pMAL-c5X vector digested with Xmn I and Hin dIII restriction enzymes and transformed into ER2523 competent cells (New England Biolabs, Ltd. UK) previously transformed with pAZIL-LraRM construct ( ).

    Techniques: DNA Sequencing, Sequencing, Activity Assay