q5 high fidelity dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Q5 High Fidelity DNA Polymerase
    Description:
    Q5 High Fidelity DNA Polymerase 500 units
    Catalog Number:
    m0491l
    Price:
    432
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs q5 high fidelity dna polymerase
    Q5 High Fidelity DNA Polymerase
    Q5 High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/q5 high fidelity dna polymerase/product/New England Biolabs
    Average 90 stars, based on 619 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    Article Title: The rph-1-Encoded Truncated RNase PH Protein Inhibits RNase P Maturation of Pre-tRNAs with Short Leader Sequences in the Absence of RppH
    Article Snippet: .. The 5′-3′ junctions of the cDNAs were amplified with pairs of gene-specific primers using Q5 high-fidelity DNA polymerase (NEB) and cloned into pWSK29 ( ) for sequencing. .. All DNA sequencing was carried out using the MWG sequencing service.

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmid vectors ( ) were transformed into E. coli NEB5α or LMG194 strains for heterologous expression and screening.

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector. .. Overlapping PCR was used to generate the Gsk3α-L195G, Gsk3α-K148R (kinase-dead) , Gsk3β-L132G, Gsk3β-K85R (kinase-dead) mutations.

    Article Title: SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1 [OPEN]
    Article Snippet: Using the treated DNA as template, eight proFaSnRK2.6 fragments of each sample were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs), ligated into the PMD19-T simple vector (Takara), and then sequenced. .. Sequences of 12 independent clones of each fragment were analyzed using Kismeth , and the methylation level of each fragment was calculated.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: For generating LF82 ∆ qseC::qseC , LF82 ∆ qseC::kan /pTKred was transformed with a 5.1-kb fragment from plasmid pMGR3 generated by Gibson cloning (New England BioLabs). .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template.

    Article Title: Reticulomics: Protein-Protein Interaction Studies with Two Plasmodesmata-Localized Reticulon Family Proteins Identify Binding Partners Enriched at Plasmodesmata, Endoplasmic Reticulum, and the Plasma Membrane 1
    Article Snippet: Paragraph title: Cloning of Expression Plasmids ... Q5 high-fidelity DNA polymerase (New England Biolabs) was used for all PCRs.

    Article Title: Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo
    Article Snippet: Paragraph title: Cloning, transfection, and dual-luciferase reporter assay. ... The fragment of human BCL-2 3′-UTR was amplified from cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and inserted into pRL-TK vector (Promega, Madison, WI) as described previously ( ).

    Amplification:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center. .. Mapping ChRO-seq and leChRO-seq sequencing reads.

    Article Title: The rph-1-Encoded Truncated RNase PH Protein Inhibits RNase P Maturation of Pre-tRNAs with Short Leader Sequences in the Absence of RppH
    Article Snippet: .. The 5′-3′ junctions of the cDNAs were amplified with pairs of gene-specific primers using Q5 high-fidelity DNA polymerase (NEB) and cloned into pWSK29 ( ) for sequencing. .. All DNA sequencing was carried out using the MWG sequencing service.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: Briefly, the traCG region of NTHI strain 86-028NP was amplified by PCR, digested with NcoI and PvuI, and ligated into pSPEC1 that had been digested with NcoI and PvuI. .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Viruslike Particles Encapsidating Respiratory Syncytial Virus M and M2 Proteins Induce Robust T Cell Responses
    Article Snippet: .. The M/M2 cassette was amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) from p8400 VRC CMV/R plasmid using a forward primer containing a Nco I-site and a reverse primer containing a Bam HI-site. .. The PCR product was gel purified using the Isolate II PCR and Gel Kit (Bioline), digested with Nco I and Bam HI, column purified using a DNA Clean & Concentrator column (Zymo Research), and ligated into the corresponding sites of linearized pRSFDuet1 SP.

    Article Title: SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1 [OPEN]
    Article Snippet: .. Using the treated DNA as template, eight proFaSnRK2.6 fragments of each sample were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs), ligated into the PMD19-T simple vector (Takara), and then sequenced. .. Sequences of 12 independent clones of each fragment were analyzed using Kismeth , and the methylation level of each fragment was calculated.

    Article Title: Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo
    Article Snippet: .. The fragment of human BCL-2 3′-UTR was amplified from cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and inserted into pRL-TK vector (Promega, Madison, WI) as described previously ( ). ..

    Reporter Assay:

    Article Title: Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo
    Article Snippet: Paragraph title: Cloning, transfection, and dual-luciferase reporter assay. ... The fragment of human BCL-2 3′-UTR was amplified from cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and inserted into pRL-TK vector (Promega, Madison, WI) as described previously ( ).

    Binding Assay:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center. .. Mapping ChRO-seq and leChRO-seq sequencing reads.

    Stable Transfection:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector. .. Overlapping PCR was used to generate the Gsk3α-L195G, Gsk3α-K148R (kinase-dead) , Gsk3β-L132G, Gsk3β-K85R (kinase-dead) mutations.

    Polymerase Chain Reaction:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs). .. All restriction enzymes were purchased from New England Biolabs.

    Article Title: Viruslike Particles Encapsidating Respiratory Syncytial Virus M and M2 Proteins Induce Robust T Cell Responses
    Article Snippet: The M/M2 cassette was amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) from p8400 VRC CMV/R plasmid using a forward primer containing a Nco I-site and a reverse primer containing a Bam HI-site. .. The PCR product was gel purified using the Isolate II PCR and Gel Kit (Bioline), digested with Nco I and Bam HI, column purified using a DNA Clean & Concentrator column (Zymo Research), and ligated into the corresponding sites of linearized pRSFDuet1 SP.

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector. .. Overlapping PCR was used to generate the Gsk3α-L195G, Gsk3α-K148R (kinase-dead) , Gsk3β-L132G, Gsk3β-K85R (kinase-dead) mutations.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template. .. The Gibson assembly reaction, containing a 2.5-fold molar excess of insert fragments per 100 ng of vector backbone, was incubated in a thermocycler at 50 °C for 60 min and then directly transformed into chemically competent E. coli DH5α (New England BioLabs).

    Article Title: Activities of Thrombin and Factor Xa Are Essential for Replication of Hepatitis E Virus and Are Possibly Implicated in ORF1 Polyprotein Processing
    Article Snippet: .. PCR was performed using Q5 high-fidelity DNA polymerase (NEB), pSK-HEV2-Rluc as a template, and mutagenic primers. .. The PCR product was digested with the enzyme DpnI (NEB) to remove the wild-type pSK-HEV2-Rluc template plasmid.

    Article Title: Biosynthetic Origin of the Ether Ring in Platensimycin
    Article Snippet: PCR primers were obtained from Sigma-Aldrich. .. Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers.

    Construct:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Incubation:

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: Clones were then incubated in 96-well plates with LB medium containing chloramphenicol (12.5 μg/ml), and 1× Fosmid CopyControl induction solution at 30°C with shaking at 240 rpm. .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions.

    Article Title: TALK-1 channels control β cell endoplasmic reticulum Ca2+ homeostasis
    Article Snippet: PCRs were performed in 50 µL with Q5 high-fidelity DNA polymerase (New England Biolabs) with 100 ng of pCDNA3.1-KCNK3 plasmid. .. DNA was then incubated with 1 µL DpnI for two hours at 37 °C.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template. .. The Gibson assembly reaction, containing a 2.5-fold molar excess of insert fragments per 100 ng of vector backbone, was incubated in a thermocycler at 50 °C for 60 min and then directly transformed into chemically competent E. coli DH5α (New England BioLabs).

    Expressing:

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs). .. To demonstrate the singular subpolar location of expression of ComE, the com locus from NTHI strain 86-028NP was amplified from genomic DNA by PCR using a forward primer containing a BglII site and a reverse primer that encodes a FLAG epitope tag and an EcoRI site.

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmid vectors ( ) were transformed into E. coli NEB5α or LMG194 strains for heterologous expression and screening.

    Article Title: Reticulomics: Protein-Protein Interaction Studies with Two Plasmodesmata-Localized Reticulon Family Proteins Identify Binding Partners Enriched at Plasmodesmata, Endoplasmic Reticulum, and the Plasma Membrane 1
    Article Snippet: Paragraph title: Cloning of Expression Plasmids ... Q5 high-fidelity DNA polymerase (New England Biolabs) was used for all PCRs.

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Modification:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The recombined clone, IA1-pL253 was further modified using recombineering to add a LoxP recombination site immediately downstream of the 5’UTR but before the Kozak sequence. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: NTHI strain 86-028NP was transformed with the resultant DNA fragment using a modified M-IV transformation protocol ( , ). .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Reticulomics: Protein-Protein Interaction Studies with Two Plasmodesmata-Localized Reticulon Family Proteins Identify Binding Partners Enriched at Plasmodesmata, Endoplasmic Reticulum, and the Plasma Membrane 1
    Article Snippet: Q5 high-fidelity DNA polymerase (New England Biolabs) was used for all PCRs. .. Genes of interest were cloned into the modified binary vector pB7FWG2,0 or pB7WGR2,0, providing expression from Agrobacterium tumefaciens transfer DNA, using the cauliflower mosaic virus 35S promoter upstream of coding fusions to GFP or RFP, respectively ( ).

    Western Blot:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: Individual puromycin-resistant colonies were picked, expanded, and screened for Gsk3 knockout by sequencing and Western blot. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Transformation Assay:

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: NTHI strain 86-028NP was transformed with the resultant DNA fragment using a modified M-IV transformation protocol ( , ). .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmid vectors ( ) were transformed into E. coli NEB5α or LMG194 strains for heterologous expression and screening.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: For generating LF82 ∆ qseC::qseC , LF82 ∆ qseC::kan /pTKred was transformed with a 5.1-kb fragment from plasmid pMGR3 generated by Gibson cloning (New England BioLabs). .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template.

    Article Title: Activities of Thrombin and Factor Xa Are Essential for Replication of Hepatitis E Virus and Are Possibly Implicated in ORF1 Polyprotein Processing
    Article Snippet: PCR was performed using Q5 high-fidelity DNA polymerase (NEB), pSK-HEV2-Rluc as a template, and mutagenic primers. .. Five microliters of DpnI-digested PCR mix was transformed into NEB-5α chemically competent cells (NEB).

    Electroporation:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: The resultant plasmid, pJAJ1, was confirmed by sequencing and used to transform the Δ traCG mutant via electroporation. .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Transfection:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: In brief, px330-P2A-puro vectors carrying Gsk3 guide RNAs were transfected into ES cells, followed by puromycin selection. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Article Title: Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo
    Article Snippet: Paragraph title: Cloning, transfection, and dual-luciferase reporter assay. ... The fragment of human BCL-2 3′-UTR was amplified from cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and inserted into pRL-TK vector (Promega, Madison, WI) as described previously ( ).

    Ligation:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: RNA was removed from beads by Trizol and followed by the 3’ adapter ligation (NEB # M0204L). .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Generated:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: TALK-1 channels control β cell endoplasmic reticulum Ca2+ homeostasis
    Article Snippet: The TASK-1 G203D point mutation was generated using a previously described approach ( ). .. PCRs were performed in 50 µL with Q5 high-fidelity DNA polymerase (New England Biolabs) with 100 ng of pCDNA3.1-KCNK3 plasmid.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: PCR products were generated with primers designed by Gibson Assembly software that flanked regions adjacent to the qseBC operon and incorporated a 1-kb region downstream of qseBC. .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template.

    DNA Sequencing:

    Article Title: The rph-1-Encoded Truncated RNase PH Protein Inhibits RNase P Maturation of Pre-tRNAs with Short Leader Sequences in the Absence of RppH
    Article Snippet: The 5′-3′ junctions of the cDNAs were amplified with pairs of gene-specific primers using Q5 high-fidelity DNA polymerase (NEB) and cloned into pWSK29 ( ) for sequencing. .. All DNA sequencing was carried out using the MWG sequencing service.

    Article Title: Biosynthetic Origin of the Ether Ring in Platensimycin
    Article Snippet: Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers. .. Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The rph-1-Encoded Truncated RNase PH Protein Inhibits RNase P Maturation of Pre-tRNAs with Short Leader Sequences in the Absence of RppH
    Article Snippet: Paragraph title: RT-PCR cloning and sequencing of 5′-3′-ligated transcripts. ... The 5′-3′ junctions of the cDNAs were amplified with pairs of gene-specific primers using Q5 high-fidelity DNA polymerase (NEB) and cloned into pWSK29 ( ) for sequencing.

    Recombinant:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    BAC Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Methylation:

    Article Title: SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1 [OPEN]
    Article Snippet: Paragraph title: Methylation Analysis of proFaSnRK2.6 ... Using the treated DNA as template, eight proFaSnRK2.6 fragments of each sample were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs), ligated into the PMD19-T simple vector (Takara), and then sequenced.

    Mutagenesis:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: The resultant plasmid, pJAJ1, was confirmed by sequencing and used to transform the Δ traCG mutant via electroporation. .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Viruslike Particles Encapsidating Respiratory Syncytial Virus M and M2 Proteins Induce Robust T Cell Responses
    Article Snippet: The M/M2 cassette was amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) from p8400 VRC CMV/R plasmid using a forward primer containing a Nco I-site and a reverse primer containing a Bam HI-site. .. The M134A mutation was created by PCR using the Q5 Site-directed Mutagenesis Kit (New England Biolabs) with pRSFDuet1M/M2 SP CP as template, and back-to-back primers with a 3-nucleotide substitution located in the middle of the forward primer.

    Article Title: TALK-1 channels control β cell endoplasmic reticulum Ca2+ homeostasis
    Article Snippet: Paragraph title: Site-directed mutagenesis ... PCRs were performed in 50 µL with Q5 high-fidelity DNA polymerase (New England Biolabs) with 100 ng of pCDNA3.1-KCNK3 plasmid.

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: Paragraph title: Generation of Gsk3 Mutant ES Cell Lines ... For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Article Title: Activities of Thrombin and Factor Xa Are Essential for Replication of Hepatitis E Virus and Are Possibly Implicated in ORF1 Polyprotein Processing
    Article Snippet: Paragraph title: Site-directed mutagenesis. ... PCR was performed using Q5 high-fidelity DNA polymerase (NEB), pSK-HEV2-Rluc as a template, and mutagenic primers.

    Isolation:

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template. .. Isolated plasmid DNA was screened for correct size and sequence.

    Purification:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: The 5’ end was phosphorylated using PNK (NEB # M0201L) followed by a purification with Trizol (Life Technologies # 15596–026). .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Article Title: Viruslike Particles Encapsidating Respiratory Syncytial Virus M and M2 Proteins Induce Robust T Cell Responses
    Article Snippet: The M/M2 cassette was amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) from p8400 VRC CMV/R plasmid using a forward primer containing a Nco I-site and a reverse primer containing a Bam HI-site. .. The PCR product was gel purified using the Isolate II PCR and Gel Kit (Bioline), digested with Nco I and Bam HI, column purified using a DNA Clean & Concentrator column (Zymo Research), and ligated into the corresponding sites of linearized pRSFDuet1 SP.

    Sequencing:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: Paragraph title: Chromatin Run-On and sequencing (ChRO-seq) library preparation. ... A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: The rph-1-Encoded Truncated RNase PH Protein Inhibits RNase P Maturation of Pre-tRNAs with Short Leader Sequences in the Absence of RppH
    Article Snippet: .. The 5′-3′ junctions of the cDNAs were amplified with pairs of gene-specific primers using Q5 high-fidelity DNA polymerase (NEB) and cloned into pWSK29 ( ) for sequencing. .. All DNA sequencing was carried out using the MWG sequencing service.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: The resultant plasmid, pJAJ1, was confirmed by sequencing and used to transform the Δ traCG mutant via electroporation. .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: Transductants that released nitrite from NNG were selected for fosmid DNA purification and Sanger sequencing of the terminal ends of the fosmid inserts. .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions.

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: Individual puromycin-resistant colonies were picked, expanded, and screened for Gsk3 knockout by sequencing and Western blot. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template. .. Isolated plasmid DNA was screened for correct size and sequence.

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Bradford Protein Assay:

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    CRISPR:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: The following guide RNAs used to knock out Gsk3 were designed using the online CRISPR design tool (crispr.mit.edu) ( ): Gsk3α : 5′-TGATTGGTAATGGCTCATT-3′; Gsk3β : 5′-ATTCCAAAGGAATGGATAT-3′. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Plasmid Preparation:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: The resultant plasmid, pJAJ1, was confirmed by sequencing and used to transform the Δ traCG mutant via electroporation. .. All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs).

    Article Title: Viruslike Particles Encapsidating Respiratory Syncytial Virus M and M2 Proteins Induce Robust T Cell Responses
    Article Snippet: .. The M/M2 cassette was amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) from p8400 VRC CMV/R plasmid using a forward primer containing a Nco I-site and a reverse primer containing a Bam HI-site. .. The PCR product was gel purified using the Isolate II PCR and Gel Kit (Bioline), digested with Nco I and Bam HI, column purified using a DNA Clean & Concentrator column (Zymo Research), and ligated into the corresponding sites of linearized pRSFDuet1 SP.

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmid vectors ( ) were transformed into E. coli NEB5α or LMG194 strains for heterologous expression and screening.

    Article Title: TALK-1 channels control β cell endoplasmic reticulum Ca2+ homeostasis
    Article Snippet: .. PCRs were performed in 50 µL with Q5 high-fidelity DNA polymerase (New England Biolabs) with 100 ng of pCDNA3.1-KCNK3 plasmid. .. DNA was then incubated with 1 µL DpnI for two hours at 37 °C.

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector. .. Overlapping PCR was used to generate the Gsk3α-L195G, Gsk3α-K148R (kinase-dead) , Gsk3β-L132G, Gsk3β-K85R (kinase-dead) mutations.

    Article Title: SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2.6, an Ortholog of OPEN STOMATA1, Is a Negative Regulator of Strawberry Fruit Development and Ripening 1 [OPEN]
    Article Snippet: .. Using the treated DNA as template, eight proFaSnRK2.6 fragments of each sample were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs), ligated into the PMD19-T simple vector (Takara), and then sequenced. .. Sequences of 12 independent clones of each fragment were analyzed using Kismeth , and the methylation level of each fragment was calculated.

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: Plasmid pTKIP harboring a HygR cassette flanked by FRT sites served as the selectable resistance gene to screen for chromosomal integration. .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template.

    Article Title: Activities of Thrombin and Factor Xa Are Essential for Replication of Hepatitis E Virus and Are Possibly Implicated in ORF1 Polyprotein Processing
    Article Snippet: Plasmid pSK-HEV2-Rluc was used as the backbone for site-directed mutagenesis. .. PCR was performed using Q5 high-fidelity DNA polymerase (NEB), pSK-HEV2-Rluc as a template, and mutagenic primers.

    Article Title: Biosynthetic Origin of the Ether Ring in Platensimycin
    Article Snippet: Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers. .. DNA gel extraction and plasmid preparation kits were purchased from Omega Bio-Tek.

    Article Title: Reticulomics: Protein-Protein Interaction Studies with Two Plasmodesmata-Localized Reticulon Family Proteins Identify Binding Partners Enriched at Plasmodesmata, Endoplasmic Reticulum, and the Plasma Membrane 1
    Article Snippet: Q5 high-fidelity DNA polymerase (New England Biolabs) was used for all PCRs. .. Genes of interest were cloned into the modified binary vector pB7FWG2,0 or pB7WGR2,0, providing expression from Agrobacterium tumefaciens transfer DNA, using the cauliflower mosaic virus 35S promoter upstream of coding fusions to GFP or RFP, respectively ( ).

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Article Title: Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo
    Article Snippet: .. The fragment of human BCL-2 3′-UTR was amplified from cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and inserted into pRL-TK vector (Promega, Madison, WI) as described previously ( ). ..

    Software:

    Article Title: QseC inhibition as an antivirulence approach for colitis-associated bacteria
    Article Snippet: PCR products were generated with primers designed by Gibson Assembly software that flanked regions adjacent to the qseBC operon and incorporated a 1-kb region downstream of qseBC. .. PCR was performed with Q5 High-Fidelity DNA polymerase (New England BioLabs) using the LF82 parental strain as a template.

    Selection:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: In brief, px330-P2A-puro vectors carrying Gsk3 guide RNAs were transfected into ES cells, followed by puromycin selection. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    Transgenic Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Knock-Out:

    Article Title: A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3α and GSK3β in Regulating Embryonic Stem Cell Fate
    Article Snippet: Individual puromycin-resistant colonies were picked, expanded, and screened for Gsk3 knockout by sequencing and Western blot. .. For the generation of GSK3-expressing stable cell lines, the coding sequences of Gsk3α and Gsk3β were cloned from mouse ES cells cDNA by Q5® High-Fidelity DNA Polymerase (NEB) and inserted into the PiggyBac vector.

    FLAG-tag:

    Article Title: Nontypeable Haemophilus influenzae releases DNA and DNABII proteins via a T4SS-like complex and ComE of the type IV pilus machinery
    Article Snippet: All PCR assays were performed with Q5 High-Fidelity DNA polymerase (New England Biolabs). .. To demonstrate the singular subpolar location of expression of ComE, the com locus from NTHI strain 86-028NP was amplified from genomic DNA by PCR using a forward primer containing a BglII site and a reverse primer that encodes a FLAG epitope tag and an EcoRI site.

    DNA Purification:

    Article Title: Iron-Dependent Enzyme Catalyzes the Initial Step in Biodegradation of N-Nitroglycine by Variovorax sp. Strain JS1663
    Article Snippet: Transductants that released nitrite from NNG were selected for fosmid DNA purification and Sanger sequencing of the terminal ends of the fosmid inserts. .. Candidate genes identified through bioinformatics analysis of nucleotide sequences of fosmids showing NNG transformation were subcloned into the E. coli expression vector pBAD/HisA (Invitrogen) using the overlapping oligonucleotide primers listed in , fosmid or genomic DNA templates, Q5 High-fidelity DNA polymerase, and the NEBuilder HiFi DNA assembly cloning kit (New England BioLabs) according to the manufacturer's instructions.

    Gel Extraction:

    Article Title: Biosynthetic Origin of the Ether Ring in Platensimycin
    Article Snippet: Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers. .. DNA gel extraction and plasmid preparation kits were purchased from Omega Bio-Tek.

    Homologous Recombination:

    Article Title: Biosynthetic Origin of the Ether Ring in Platensimycin
    Article Snippet: Q5 high-fidelity DNA polymerase, restriction endonucleases, and T4 DNA ligase were purchased from NEB and used by following the protocols provided by the manufacturers. .. The John Innes Center (Norwich, U.K.) provided the REDIRECT Technology kit for PCR-targeting homologous recombination.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs q5 high fidelity dna polymerase
    Q5 High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 411 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity dna polymerase/product/New England Biolabs
    Average 90 stars, based on 411 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs phusion high fidelity dna polymerase
    Phusion High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/New England Biolabs
    Average 90 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results