hf buffer new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion High Fidelity PCR Master Mix with HF Buffer
    Description:
    Phusion High Fidelity PCR Master Mix with HF Buffer 500 rxns 50 ul vol
    Catalog Number:
    m0531l
    Price:
    736
    Size:
    500 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs hf buffer new england biolabs
    Phusion High Fidelity PCR Master Mix with HF Buffer
    Phusion High Fidelity PCR Master Mix with HF Buffer 500 rxns 50 ul vol
    https://www.bioz.com/result/hf buffer new england biolabs/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hf buffer new england biolabs - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Amplification:

    Article Title: A core set of venom proteins is released by entomopathogenic nematodes in the genus Steinernema
    Article Snippet: .. The tagmented cDNA was then amplified using the Phusion High Fidelity PCR master mix (New England Biolabs, M0531L) with 30 μl of tagmented cDNA, 2.5 μl of Primer-1 (Ad1_no MX), 2.5 μl of Primer-2(Ad2.#), and 35 μl of Phusion High Fidelity PCR master mix buffer. .. The amplification program was set to 1) 72°C 5 min, 2) 98°C 30 sec, 3) 98°C 10 sec, 63°C 30 sec., 72°C 1 min (repeat 10x), and 4) 4°C Hold.

    Article Title: Whole genome sequencing reveals potential targets for therapy in patients with refractory KRAS mutated metastatic colorectal cancer
    Article Snippet: .. Samples were next adenylated using Klenow fragment 3′-5′ exo minus enzyme, ligated with Illumina adapters, size selected at 350-450 bp, and PCR amplified using Phusion High-Fidelity PCR Master Mix w/HF buffer (New England Biolabs). .. The DNA libraries were clustered onto flowcells using Illumina’s cBot and HiSeq Paired End Cluster Generation kits as per manufacturer protocol (Illumina, San Diego, CA).

    Article Title: Mutation of the Galectin-3 Glycan Binding Domain (Lgals3-R200S) Enhances Cortical Bone Expansion in Male and Trabecular Bone Mass in Female Mice
    Article Snippet: .. Tail tip DNA from Lgals3- R200S positive animals was first amplified by Phusion HF DNA polymerase PCR using primers encompassing exon 5 of Lgals3 (FWD: 5’-TTCAGGAGAGGGAATGATGTTG-3’ and REV: 5’-CTGAAGGAGCTGAAGGACAC-3’). .. The product of this reaction was purified using a QIAquick PCR Purification Kit (Qiagen, Germantown, MD), then cloned into pMiniT Vectors with the NEB PCR Cloning Kit, and transformed into NEB 10-beta Competent E.coli (NEB, Ipswich, MA).

    Article Title: Genetic control of cellular morphogenesis in Müller glia. Genetic control of cellular morphogenesis in Müller glia
    Article Snippet: .. PCR amplification of these annealed oligos sequence was created using Phusion master mix (New England Biolabs, M0531 L) with 10uM scaffold and gRNA for 40 cycles in a thermal cycler. .. This PCR product was purified (PCR purification kit; Qiagen) and used as a template for the in vitro transcription reaction (T7 megascript; Ambion).

    Article Title: High-Resolution Enzymatic Mapping of Genomic 5-Hydroxymethylcytosine in Mouse Embryonic Stem Cells
    Article Snippet: .. Amplification of the DNA library was carried out by adding the entirety of the DNA-bound beads to a reaction mixture containing 0.2 mM of each dNTP, 1× Phusion HF Buffer, 300 nM forward primer (PCR_I), 300 nM reverse primers (PCR_IIpe) , and ten units of Phusion DNA polymerase (NEB: M0531S). .. The following thermocycler conditions were utilized for amplification: 30 s 98°C, 16 cycles (10 s 98°C, 15 s 70°C, 15 s 72°C), 10 min 72°C, and hold at 4°C.

    Agarose Gel Electrophoresis:

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Cell Culture:

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Polymerase Chain Reaction:

    Article Title: A core set of venom proteins is released by entomopathogenic nematodes in the genus Steinernema
    Article Snippet: .. The tagmented cDNA was then amplified using the Phusion High Fidelity PCR master mix (New England Biolabs, M0531L) with 30 μl of tagmented cDNA, 2.5 μl of Primer-1 (Ad1_no MX), 2.5 μl of Primer-2(Ad2.#), and 35 μl of Phusion High Fidelity PCR master mix buffer. .. The amplification program was set to 1) 72°C 5 min, 2) 98°C 30 sec, 3) 98°C 10 sec, 63°C 30 sec., 72°C 1 min (repeat 10x), and 4) 4°C Hold.

    Article Title: Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy
    Article Snippet: .. Using hWASp specific primers Ex3-s (5′ CTGGTCGGCTGCTCTGGGAAC 3′) and Ex6-as (5′ CCTTGGTCTCCACCTGGATGCA 3′), in a Phusion (New England Biolabs, Ipswich, MA; cat. no. M0531L) PCR reaction (98 °C for 90 seconds, then 36 cycles of a 10-second 98 °C denaturation, and 30 seconds 72 °C annealing/elongation, followed by a 5-minute 72 °C hold), the endogenous hWASp product was 585 bp, and the vector-derived hWASp product was 283 bp. .. Alternatively, CFU-Cs were scored hWASp+ in subsequent NSG transplantation studies when both HIV GAG and human RNAseP were detected from CFU-C DNA by qPCR (see below).

    Article Title: Whole genome sequencing reveals potential targets for therapy in patients with refractory KRAS mutated metastatic colorectal cancer
    Article Snippet: .. Samples were next adenylated using Klenow fragment 3′-5′ exo minus enzyme, ligated with Illumina adapters, size selected at 350-450 bp, and PCR amplified using Phusion High-Fidelity PCR Master Mix w/HF buffer (New England Biolabs). .. The DNA libraries were clustered onto flowcells using Illumina’s cBot and HiSeq Paired End Cluster Generation kits as per manufacturer protocol (Illumina, San Diego, CA).

    Article Title: Mutation of the Galectin-3 Glycan Binding Domain (Lgals3-R200S) Enhances Cortical Bone Expansion in Male and Trabecular Bone Mass in Female Mice
    Article Snippet: .. Tail tip DNA from Lgals3- R200S positive animals was first amplified by Phusion HF DNA polymerase PCR using primers encompassing exon 5 of Lgals3 (FWD: 5’-TTCAGGAGAGGGAATGATGTTG-3’ and REV: 5’-CTGAAGGAGCTGAAGGACAC-3’). .. The product of this reaction was purified using a QIAquick PCR Purification Kit (Qiagen, Germantown, MD), then cloned into pMiniT Vectors with the NEB PCR Cloning Kit, and transformed into NEB 10-beta Competent E.coli (NEB, Ipswich, MA).

    Article Title: Genetic control of cellular morphogenesis in Müller glia. Genetic control of cellular morphogenesis in Müller glia
    Article Snippet: .. PCR amplification of these annealed oligos sequence was created using Phusion master mix (New England Biolabs, M0531 L) with 10uM scaffold and gRNA for 40 cycles in a thermal cycler. .. This PCR product was purified (PCR purification kit; Qiagen) and used as a template for the in vitro transcription reaction (T7 megascript; Ambion).

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Article Title: High-Resolution Enzymatic Mapping of Genomic 5-Hydroxymethylcytosine in Mouse Embryonic Stem Cells
    Article Snippet: .. Amplification of the DNA library was carried out by adding the entirety of the DNA-bound beads to a reaction mixture containing 0.2 mM of each dNTP, 1× Phusion HF Buffer, 300 nM forward primer (PCR_I), 300 nM reverse primers (PCR_IIpe) , and ten units of Phusion DNA polymerase (NEB: M0531S). .. The following thermocycler conditions were utilized for amplification: 30 s 98°C, 16 cycles (10 s 98°C, 15 s 70°C, 15 s 72°C), 10 min 72°C, and hold at 4°C.

    Sequencing:

    Article Title: Genetic control of cellular morphogenesis in Müller glia. Genetic control of cellular morphogenesis in Müller glia
    Article Snippet: .. PCR amplification of these annealed oligos sequence was created using Phusion master mix (New England Biolabs, M0531 L) with 10uM scaffold and gRNA for 40 cycles in a thermal cycler. .. This PCR product was purified (PCR purification kit; Qiagen) and used as a template for the in vitro transcription reaction (T7 megascript; Ambion).

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Gel Extraction:

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Plasmid Preparation:

    Article Title: Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy
    Article Snippet: .. Using hWASp specific primers Ex3-s (5′ CTGGTCGGCTGCTCTGGGAAC 3′) and Ex6-as (5′ CCTTGGTCTCCACCTGGATGCA 3′), in a Phusion (New England Biolabs, Ipswich, MA; cat. no. M0531L) PCR reaction (98 °C for 90 seconds, then 36 cycles of a 10-second 98 °C denaturation, and 30 seconds 72 °C annealing/elongation, followed by a 5-minute 72 °C hold), the endogenous hWASp product was 585 bp, and the vector-derived hWASp product was 283 bp. .. Alternatively, CFU-Cs were scored hWASp+ in subsequent NSG transplantation studies when both HIV GAG and human RNAseP were detected from CFU-C DNA by qPCR (see below).

    Article Title: Protocol 2: Viral Packaging and Cell Culture for CRISPR-based Screens
    Article Snippet: .. 0.22 μm 150 mL bottle top filter (Corning 430626) 0.45 μm Acrodisc Syringe Filter (VWR 28144-007) 6-well tissue culture-treated plates 15 cm tissue culture-treated plates Agarose gel, 2.0% DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016) Ethidium bromide Gel Extraction Kit (Qiagen 28704) Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) Inactivated Fetal Serum (Sigma Aldrich F4135-500ML) LB (Luria-Bertani) liquid medium LB-ampicillin agar plates Lentiviral sgRNA library (from Protocol 1 or Addgene) Luer-Lok Tip Syringes (Becton Dickinson, various sizes) Media and various plastics for screen cell culture Opti-MEM I Reduced-Serum Medium pCMV-dR8.2 packaging plasmid (Addgene 8455) pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454) Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML) Phosphate-buffered saline (PBS) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S) Plasmid Plus Maxi Kit (Qiagen 12963) Polybrene (EMD Millipore TR-1003-G) Puromycin QIAamp DNA Blood Maxi Kit (Qiagen 51194) sgRNA barcode PCR primers Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence Sequencing primers for Illumina HiSeq Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA x-tracta gel extractor (USA Scientific 5454-0100) X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001) .. Centrifuge with rotors for 6-well plate spin infection Erlenmeyer flask, 500 mL Gel imager Heat block NanoDrop spectrophotometer (NanoDrop) Thermocycler Tissue culture hood for BL2+ work Tissue culture incubator

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs hf psti high fidelity
    Adapter Design, PCR amplification of fragments. 1) The ligation product of a genomic DNA fragment (black) containing a <t>PstI</t> restriction site and a <t>MspI</t> restriction site. The forward adapter (blue) binds to a PstI generated overhang. The 4–9 bp barcode for this adapter is in bold with “X”. The MspI generated overhang corresponds to the reverse Y-adapter (green). The unpaired tail of the Y-adapter is underlined. 2) During the first round of PCR only the forward primer (red) can anneal. PCR synthesis of the complementary strand proceeds to the end of the fragment synthesizing the compliment of the Y-adapter tail. 3) During the second round of PCR the reverse primer (orange) can anneal to the newly synthesized compliment of the Y-adapter tail. This PCR reaction then proceeds to fill in the compliment of the forward adapter/primer on the other end of the same fragment.
    Hf Psti High Fidelity, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hf psti high fidelity/product/New England Biolabs
    Average 97 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hf psti high fidelity - by Bioz Stars, 2020-09
    97/100 stars
      Buy from Supplier

    99
    New England Biolabs hindiii hf
    CUTseq implementation and reproducibility. a CUTseq workflow. (1) RE, restriction enzyme. T7, T7 phage promoter. IVT, in vitro transcription. RA5, RA3, SP7, and SP9: Illumina’s sequencing adapters. b BT474 cells copy number profiles (100 kb resolution). ρ , Pearson’s correlation. c Pearson’s correlation ( ρ ) between the copy number profiles (100 kb resolution) of five cancer cell lines digested with <t>HindIII</t> (rows) or NlaIII (columns). d Chr17 copy number profiles (NlaIII, 100 kb resolution) in two HER2-positive (SKBR3 and BT474) and one HER2-negative cell line (MCF7). ERBB2/HER2 is highlighted in red. e Copy number profiles (NlaIII, 100 kb resolution) in five replicates (Rep) from FFPE tumor samples. COAD, colon adenocarcinoma. MELA, melanoma. ρ , Pearson’s correlation. f Pearson’s correlation ( ρ ) between the replicates shown in e at different resolutions. Each dot represents one pair of replicates. Error bars indicate the median and interquartile range. g Pearson’s correlation ( ρ ) between the fraction of the genome (100 kb resolution) either amplified or deleted in the replicates (Rep) shown in e . Each dot represents one pair of replicates. Dashed line: linear regression. h , i Length of amplified (AMP) or deleted (DEL) genomic segments in Rep1 ( h ) and Rep2 ( i ) samples shown in e , at various resolutions. j Zoom-in view on chr9 q-arm in sample TRN4 shown in e . Arrows indicate focal amplifications detected only at 10 kb resolution in both replicates. Red: centromeric region. The p-arm is not shown. k Copy number profiles (NlaIII, 100 kb resolution) determined using 120 pg of gDNA extracted from one FFPE breast cancer (BRCA) sample and three different numbers of PCR cycles. l Pearson’s correlation ( ρ ) between copy number profiles (100 kb resolution) determined using different amounts of gDNA extracted from the sample shown in k . In all the profiles, gray dots represent individual genomic windows, whereas black lines indicate segmented genomic intervals after circular binary segmentation 37 . The numbers below each box indicate chromosomes from chr1 (leftmost) to chr22 (rightmost). In all the cases, TRN refers to the ID of Turin samples, as shown in Supplementary Table 2 . All the source data for this figure are provided as a Source Data file
    Hindiii Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii hf/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    hindiii hf - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs phusion buffer hf
    Agarose gel electrophoresis analysis of PCR fragments multiplied by <t>Phusion</t> High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Phusion Buffer Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion buffer hf/product/New England Biolabs
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    phusion buffer hf - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Adapter Design, PCR amplification of fragments. 1) The ligation product of a genomic DNA fragment (black) containing a PstI restriction site and a MspI restriction site. The forward adapter (blue) binds to a PstI generated overhang. The 4–9 bp barcode for this adapter is in bold with “X”. The MspI generated overhang corresponds to the reverse Y-adapter (green). The unpaired tail of the Y-adapter is underlined. 2) During the first round of PCR only the forward primer (red) can anneal. PCR synthesis of the complementary strand proceeds to the end of the fragment synthesizing the compliment of the Y-adapter tail. 3) During the second round of PCR the reverse primer (orange) can anneal to the newly synthesized compliment of the Y-adapter tail. This PCR reaction then proceeds to fill in the compliment of the forward adapter/primer on the other end of the same fragment.

    Journal: PLoS ONE

    Article Title: Development of High-Density Genetic Maps for Barley and Wheat Using a Novel Two-Enzyme Genotyping-by-Sequencing Approach

    doi: 10.1371/journal.pone.0032253

    Figure Lengend Snippet: Adapter Design, PCR amplification of fragments. 1) The ligation product of a genomic DNA fragment (black) containing a PstI restriction site and a MspI restriction site. The forward adapter (blue) binds to a PstI generated overhang. The 4–9 bp barcode for this adapter is in bold with “X”. The MspI generated overhang corresponds to the reverse Y-adapter (green). The unpaired tail of the Y-adapter is underlined. 2) During the first round of PCR only the forward primer (red) can anneal. PCR synthesis of the complementary strand proceeds to the end of the fragment synthesizing the compliment of the Y-adapter tail. 3) During the second round of PCR the reverse primer (orange) can anneal to the newly synthesized compliment of the Y-adapter tail. This PCR reaction then proceeds to fill in the compliment of the forward adapter/primer on the other end of the same fragment.

    Article Snippet: Restriction Digest: Genomic DNA (200 ng) was digested in 20 ul reaction volume of NEB Buffer 4 with 8 U of HF-PstI (High-Fidelity) and 8 U of MspI (New England BioLabs Inc., Ipswich, MA 01938).

    Techniques: Polymerase Chain Reaction, Amplification, Ligation, Generated, Synthesized

    CUTseq implementation and reproducibility. a CUTseq workflow. (1) RE, restriction enzyme. T7, T7 phage promoter. IVT, in vitro transcription. RA5, RA3, SP7, and SP9: Illumina’s sequencing adapters. b BT474 cells copy number profiles (100 kb resolution). ρ , Pearson’s correlation. c Pearson’s correlation ( ρ ) between the copy number profiles (100 kb resolution) of five cancer cell lines digested with HindIII (rows) or NlaIII (columns). d Chr17 copy number profiles (NlaIII, 100 kb resolution) in two HER2-positive (SKBR3 and BT474) and one HER2-negative cell line (MCF7). ERBB2/HER2 is highlighted in red. e Copy number profiles (NlaIII, 100 kb resolution) in five replicates (Rep) from FFPE tumor samples. COAD, colon adenocarcinoma. MELA, melanoma. ρ , Pearson’s correlation. f Pearson’s correlation ( ρ ) between the replicates shown in e at different resolutions. Each dot represents one pair of replicates. Error bars indicate the median and interquartile range. g Pearson’s correlation ( ρ ) between the fraction of the genome (100 kb resolution) either amplified or deleted in the replicates (Rep) shown in e . Each dot represents one pair of replicates. Dashed line: linear regression. h , i Length of amplified (AMP) or deleted (DEL) genomic segments in Rep1 ( h ) and Rep2 ( i ) samples shown in e , at various resolutions. j Zoom-in view on chr9 q-arm in sample TRN4 shown in e . Arrows indicate focal amplifications detected only at 10 kb resolution in both replicates. Red: centromeric region. The p-arm is not shown. k Copy number profiles (NlaIII, 100 kb resolution) determined using 120 pg of gDNA extracted from one FFPE breast cancer (BRCA) sample and three different numbers of PCR cycles. l Pearson’s correlation ( ρ ) between copy number profiles (100 kb resolution) determined using different amounts of gDNA extracted from the sample shown in k . In all the profiles, gray dots represent individual genomic windows, whereas black lines indicate segmented genomic intervals after circular binary segmentation 37 . The numbers below each box indicate chromosomes from chr1 (leftmost) to chr22 (rightmost). In all the cases, TRN refers to the ID of Turin samples, as shown in Supplementary Table 2 . All the source data for this figure are provided as a Source Data file

    Journal: Nature Communications

    Article Title: CUTseq is a versatile method for preparing multiplexed DNA sequencing libraries from low-input samples

    doi: 10.1038/s41467-019-12570-2

    Figure Lengend Snippet: CUTseq implementation and reproducibility. a CUTseq workflow. (1) RE, restriction enzyme. T7, T7 phage promoter. IVT, in vitro transcription. RA5, RA3, SP7, and SP9: Illumina’s sequencing adapters. b BT474 cells copy number profiles (100 kb resolution). ρ , Pearson’s correlation. c Pearson’s correlation ( ρ ) between the copy number profiles (100 kb resolution) of five cancer cell lines digested with HindIII (rows) or NlaIII (columns). d Chr17 copy number profiles (NlaIII, 100 kb resolution) in two HER2-positive (SKBR3 and BT474) and one HER2-negative cell line (MCF7). ERBB2/HER2 is highlighted in red. e Copy number profiles (NlaIII, 100 kb resolution) in five replicates (Rep) from FFPE tumor samples. COAD, colon adenocarcinoma. MELA, melanoma. ρ , Pearson’s correlation. f Pearson’s correlation ( ρ ) between the replicates shown in e at different resolutions. Each dot represents one pair of replicates. Error bars indicate the median and interquartile range. g Pearson’s correlation ( ρ ) between the fraction of the genome (100 kb resolution) either amplified or deleted in the replicates (Rep) shown in e . Each dot represents one pair of replicates. Dashed line: linear regression. h , i Length of amplified (AMP) or deleted (DEL) genomic segments in Rep1 ( h ) and Rep2 ( i ) samples shown in e , at various resolutions. j Zoom-in view on chr9 q-arm in sample TRN4 shown in e . Arrows indicate focal amplifications detected only at 10 kb resolution in both replicates. Red: centromeric region. The p-arm is not shown. k Copy number profiles (NlaIII, 100 kb resolution) determined using 120 pg of gDNA extracted from one FFPE breast cancer (BRCA) sample and three different numbers of PCR cycles. l Pearson’s correlation ( ρ ) between copy number profiles (100 kb resolution) determined using different amounts of gDNA extracted from the sample shown in k . In all the profiles, gray dots represent individual genomic windows, whereas black lines indicate segmented genomic intervals after circular binary segmentation 37 . The numbers below each box indicate chromosomes from chr1 (leftmost) to chr22 (rightmost). In all the cases, TRN refers to the ID of Turin samples, as shown in Supplementary Table 2 . All the source data for this figure are provided as a Source Data file

    Article Snippet: We then used I-DOT One to dispense first 5 ng diluted in 350 nl of gDNA extracted from HeLa cells, followed by 100 nl of 20 U/μl of HindIII (NEB, catalog number R3104) and 50 nl of CutSmart buffer (NEB, catalog number R3104), in 96 of the 384 wells.

    Techniques: In Vitro, Sequencing, Formalin-fixed Paraffin-Embedded, Amplification, Polymerase Chain Reaction

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Journal: Scientific Reports

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    doi: 10.1038/s41598-017-07010-4

    Figure Lengend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Article Snippet: For truncations of the AtETR1 and LeETR1 plasmids by the two-fragment approach, a slightly different PCR protocol was used: 20 μL PCR mixture prepared with nuclease-free water (Cell Signaling Technology) contained 1 ng DNA template, 500 nM each primer, 200 μM each dNTP (deoxynucleoside triphosphate; NEB), 0.4 U μL−1 Phusion High-Fidelity DNA Polymerase (NEB), and either 1× Phusion buffer HF (NEB) or 3% (v/v) DMSO (NEB) with 1× Phusion buffer GC (NEB).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.

    Journal: BMC Molecular Biology

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities

    doi: 10.1186/1471-2199-9-94

    Figure Lengend Snippet: UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.

    Article Snippet: M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA).

    Techniques: Functional Assay, Purification, Agarose Gel Electrophoresis