hepes buffer  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HEPES buffer solution
    Description:
    HEPES has been described as one of the best all purpose buffers available for biological research At biological pH the molecule is zwitterionic and is effective as a buffer at pH 6 8 to 8 2 HEPES has been used in a wide variety of applications including tissue culture It is commonly used to buffer cell culture media in air HEPES finds its usage in in vitro experiments on Mg
    Catalog Number:
    83264
    Price:
    None
    Applications:
    HEPES has been used:. As a component of SAPI medium used for the culturing of S. Typhymurium inoculum. To prepare differentiation medium for PC12 cells. It is also a component of culture medium RPMI. As a component of dissection buffer for culturing rat cortical neurons. Along with MgCl2, KCl and Spermine in hypotonic buffer in mGRASP method to detect mammalian synapses. As a component of Danieu′s aquarium water used in agarose gel preparation
    Buy from Supplier


    Structured Review

    Millipore hepes buffer
    HEPES buffer solution
    HEPES has been described as one of the best all purpose buffers available for biological research At biological pH the molecule is zwitterionic and is effective as a buffer at pH 6 8 to 8 2 HEPES has been used in a wide variety of applications including tissue culture It is commonly used to buffer cell culture media in air HEPES finds its usage in in vitro experiments on Mg
    https://www.bioz.com/result/hepes buffer/product/Millipore
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    hepes buffer - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Ultrasensitive Detection of Proteins on Western Blots with Semiconducting Polymer Dots"

    Article Title: Ultrasensitive Detection of Proteins on Western Blots with Semiconducting Polymer Dots

    Journal: Macromolecular rapid communications

    doi: 10.1002/marc.201200809

    (A) Structure of CN-PPV polymer and the absorption (dashed) and emission (solid) spectra of CN-PPV Pdot (black) and CN-PPV Pdot-streptavidin conjugate (CNPPV-Strep, red) in a 0.1% PEG 20 mM HEPES buffer. (B) The absorption and emission spectra of Qdot
    Figure Legend Snippet: (A) Structure of CN-PPV polymer and the absorption (dashed) and emission (solid) spectra of CN-PPV Pdot (black) and CN-PPV Pdot-streptavidin conjugate (CNPPV-Strep, red) in a 0.1% PEG 20 mM HEPES buffer. (B) The absorption and emission spectra of Qdot

    Techniques Used:

    2) Product Images from "Metal Ions-Stimulated Iron Oxidation in Hydroxylases Facilitates Stabilization of HIF-1? Protein"

    Article Title: Metal Ions-Stimulated Iron Oxidation in Hydroxylases Facilitates Stabilization of HIF-1? Protein

    Journal:

    doi: 10.1093/toxsci/kfn251

    Proton NMR spectra of the incubated DHA solutions with or without Ni(II). Five millimolar DHA was dissolved alone (left) or in the presence 2.5mM Ni(II) (right) in HEPES buffer (pH 7.4) prepared in D 2 O. Spectra were recorded at a zero time point and then
    Figure Legend Snippet: Proton NMR spectra of the incubated DHA solutions with or without Ni(II). Five millimolar DHA was dissolved alone (left) or in the presence 2.5mM Ni(II) (right) in HEPES buffer (pH 7.4) prepared in D 2 O. Spectra were recorded at a zero time point and then

    Techniques Used: Proton NMR, Incubation

    3) Product Images from "Low affinity PEGylated hemoglobin from Trematomus bernacchii, a model for hemoglobin-based blood substitutes"

    Article Title: Low affinity PEGylated hemoglobin from Trematomus bernacchii, a model for hemoglobin-based blood substitutes

    Journal: BMC Biochemistry

    doi: 10.1186/1471-2091-12-66

    CO rebinding properties of derivatized hemoglobins . Effect of PEGylation on CO rebinding to HbA and Tb Hb and their PEGylated derivatives. The time courses of the deoxyheme fraction are shown for HbA (gray circles), PEG-Hb oxy (black circles), Tb Hb (gray solid line) and PEG Tb Hb (black solid line), in 100 mM HEPES, 1 mM sodium EDTA, 1 atm CO, pH 7.0 at 10°C. Data were fitted as reported in Materials and Methods. The fitting curves are shown in red.
    Figure Legend Snippet: CO rebinding properties of derivatized hemoglobins . Effect of PEGylation on CO rebinding to HbA and Tb Hb and their PEGylated derivatives. The time courses of the deoxyheme fraction are shown for HbA (gray circles), PEG-Hb oxy (black circles), Tb Hb (gray solid line) and PEG Tb Hb (black solid line), in 100 mM HEPES, 1 mM sodium EDTA, 1 atm CO, pH 7.0 at 10°C. Data were fitted as reported in Materials and Methods. The fitting curves are shown in red.

    Techniques Used:

    Oxygen binding properties of derivatized hemoglobins . Hill plots of oxygen-binding curves of HbA (closed squares), Tb Hb (closed circles) and PEG Tb Hb (open circles), measured in 100 mM HEPES 1 mM EDTA, 5 mM sodium ascorbate, 10 3 U/ml catalase, pH 7.0, at 10°C. Experimental points are fitted to the Hill equation, with calculated Hill's coefficients and P 50 's reported in Table 1.
    Figure Legend Snippet: Oxygen binding properties of derivatized hemoglobins . Hill plots of oxygen-binding curves of HbA (closed squares), Tb Hb (closed circles) and PEG Tb Hb (open circles), measured in 100 mM HEPES 1 mM EDTA, 5 mM sodium ascorbate, 10 3 U/ml catalase, pH 7.0, at 10°C. Experimental points are fitted to the Hill equation, with calculated Hill's coefficients and P 50 's reported in Table 1.

    Techniques Used: Binding Assay

    4) Product Images from "Thioredoxin System from Deinococcus radiodurans ▿"

    Article Title: Thioredoxin System from Deinococcus radiodurans ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01046-09

    Michaelis-Menten plot of D. radiodurans TrxR, determined using D. radiodurans Trx1 as a substrate. The reaction was monitored by consumption of NADPH via a decrease in absorbance at 340 nm. Initial velocity ( V o ) was measured as μmoles of NADPH consumed per minute. Reaction mixtures contained 100 mM HEPES buffer (pH 7.4), 2 mM EDTA, 30 μM solution of bovine insulin (Sigma), 0.1 mM NADPH (Calbiochem), 0.1 μM D. radiodurans TrxR, and D. radiodurans Trx1 (0 to 35 μM).
    Figure Legend Snippet: Michaelis-Menten plot of D. radiodurans TrxR, determined using D. radiodurans Trx1 as a substrate. The reaction was monitored by consumption of NADPH via a decrease in absorbance at 340 nm. Initial velocity ( V o ) was measured as μmoles of NADPH consumed per minute. Reaction mixtures contained 100 mM HEPES buffer (pH 7.4), 2 mM EDTA, 30 μM solution of bovine insulin (Sigma), 0.1 mM NADPH (Calbiochem), 0.1 μM D. radiodurans TrxR, and D. radiodurans Trx1 (0 to 35 μM).

    Techniques Used:

    5) Product Images from "Yeast Frataxin Is Stabilized by Low Salt Concentrations: Cold Denaturation Disentangles Ionic Strength Effects from Specific Interactions"

    Article Title: Yeast Frataxin Is Stabilized by Low Salt Concentrations: Cold Denaturation Disentangles Ionic Strength Effects from Specific Interactions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0095801

    Thermal denaturation curves of Yfh1 in the presence of salts. A) Thermal denaturation curves of 10 µM Yfh1 in a 10 mM HEPES buffer at pH 7.5, measured by monitoring the CD intensity at 220 nm as a function of temperature in the temperature range 0°C to 80°C in the presence of varying concentrations of NaCl, KCl, MgCl 2 and CaCl 2 . Denaturation curves in the presence of NaCl/KCl shown between the two extremes (“no salt” and 100 mM) have the following concentrations: 5/10/25/50 mM. Denaturation curves in the presence of MgCl 2 shown between the two extremes (“no salt” and 1 mM) have the following concentrations: 0.05/0.1/0.2/0.3/0.4 mM. Denaturation curves in the presence of CaCl 2 shown between the two extremes (“no salt” and 0.4 mM) have the following concentrations 0.05/0.08/0.1/0.2/0.3 mM. B) corresponding curves in the presence of varying concentrations of NaF, NaCl, NaH 2 PO 4 and Na 2 SO 4 . Curves shown between the two extremes (“no salt” and 100 mM) have the following millimolar concentrations: 5/10/25/50.
    Figure Legend Snippet: Thermal denaturation curves of Yfh1 in the presence of salts. A) Thermal denaturation curves of 10 µM Yfh1 in a 10 mM HEPES buffer at pH 7.5, measured by monitoring the CD intensity at 220 nm as a function of temperature in the temperature range 0°C to 80°C in the presence of varying concentrations of NaCl, KCl, MgCl 2 and CaCl 2 . Denaturation curves in the presence of NaCl/KCl shown between the two extremes (“no salt” and 100 mM) have the following concentrations: 5/10/25/50 mM. Denaturation curves in the presence of MgCl 2 shown between the two extremes (“no salt” and 1 mM) have the following concentrations: 0.05/0.1/0.2/0.3/0.4 mM. Denaturation curves in the presence of CaCl 2 shown between the two extremes (“no salt” and 0.4 mM) have the following concentrations 0.05/0.08/0.1/0.2/0.3 mM. B) corresponding curves in the presence of varying concentrations of NaF, NaCl, NaH 2 PO 4 and Na 2 SO 4 . Curves shown between the two extremes (“no salt” and 100 mM) have the following millimolar concentrations: 5/10/25/50.

    Techniques Used:

    Thermal denaturation of Yfh1 at comparable anion and cation concentrations. Thermal denaturation curves of 10 µM Yfh1 in a 10 mM HEPES buffer at pH 7.5, measured by monitoring the CD intensity at 220 nm as a function of temperature in the temperature range 0°C to 80°C in the presence of A) 2 mM NaF, NaCl, NaH 2 PO 4 and Na 2 SO 4 B) 2 mM NaCl, KCl, MgCl 2 and CaCl 2 , C) 25 and 50 µM FeSO 4 .
    Figure Legend Snippet: Thermal denaturation of Yfh1 at comparable anion and cation concentrations. Thermal denaturation curves of 10 µM Yfh1 in a 10 mM HEPES buffer at pH 7.5, measured by monitoring the CD intensity at 220 nm as a function of temperature in the temperature range 0°C to 80°C in the presence of A) 2 mM NaF, NaCl, NaH 2 PO 4 and Na 2 SO 4 B) 2 mM NaCl, KCl, MgCl 2 and CaCl 2 , C) 25 and 50 µM FeSO 4 .

    Techniques Used:

    Stability curves and thermodynamic parameters. A) Comparison of the stability curves for Yfh1 in HEPES alone (no salt) and in the presence of three representative salts of divalent cations at concentrations that yield the maximum value of ΔG. The dotted lines show average values of T S . B) Comparison of the stability curves for Yfh1 in HEPES alone (no salt) and in the presence of five representative salts of monovalent cations at concentrations that yield the maximum value of ΔG. The dotted lines show average values of T S . C) Dependence of Δ G max for divalent cations as a function of concentration. D) Δ G max for all anions as a function of concentration.
    Figure Legend Snippet: Stability curves and thermodynamic parameters. A) Comparison of the stability curves for Yfh1 in HEPES alone (no salt) and in the presence of three representative salts of divalent cations at concentrations that yield the maximum value of ΔG. The dotted lines show average values of T S . B) Comparison of the stability curves for Yfh1 in HEPES alone (no salt) and in the presence of five representative salts of monovalent cations at concentrations that yield the maximum value of ΔG. The dotted lines show average values of T S . C) Dependence of Δ G max for divalent cations as a function of concentration. D) Δ G max for all anions as a function of concentration.

    Techniques Used: Concentration Assay

    Comparison of NMR spectra of Yfh1. A) 15 N-HSQC NMR spectra of 0.25 mM Yfh1 in HEPES (blue cross peaks). B) (green cross peaks) in the presence of 200∶1 NaCl. 15 N-HSQC NMR spectra of 0.25 mM Yfh1 in HEPES and C) (red cross peaks) in the presence of 1∶1 CaCl 2 . The fourth panel (D, lower right) shows the superposition of the region of the three spectra in which it is possible to observe the largest changes. The outstanding chemical shift changes involving L102 and E103 are highlighted by arrows Residue numbers are those of PDB ID:2FQL.
    Figure Legend Snippet: Comparison of NMR spectra of Yfh1. A) 15 N-HSQC NMR spectra of 0.25 mM Yfh1 in HEPES (blue cross peaks). B) (green cross peaks) in the presence of 200∶1 NaCl. 15 N-HSQC NMR spectra of 0.25 mM Yfh1 in HEPES and C) (red cross peaks) in the presence of 1∶1 CaCl 2 . The fourth panel (D, lower right) shows the superposition of the region of the three spectra in which it is possible to observe the largest changes. The outstanding chemical shift changes involving L102 and E103 are highlighted by arrows Residue numbers are those of PDB ID:2FQL.

    Techniques Used: Nuclear Magnetic Resonance

    6) Product Images from "Multimerization rules for G-quadruplexes"

    Article Title: Multimerization rules for G-quadruplexes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx637

    Characterization of multimer interfaces by site-directed mutagenesis. ( A ) Native gel showing the effect of flanking nucleotides on dimer formation. Experiments were performed using the sequences GAGTGGGAAGGGTGGG, xGAGTGGGAAGGGTGGG, GAGTGGGAAGGGTGGGx and xGAGTGGGAAGGGTGGGx (x = A, C or T). ( B ) Hypothetical secondary structure model of dimeric G-quadruplexes consistent with the experiments in panel A. ( C ) Native gel showing the effect of flanking nucleotides on tetramer formation. Experiments were performed using the sequences GGGTGGGAAGAGTGGG, xGGGTGGGAAGAGTGGG, GGGTGGGAAGAGTGGGx and xGGGTGGGAAGAGTGGGx (x = A, C or T). ( D ) Hypothetical secondary structure model of a tetrameric G-quadruplexes consistent with the experiments in panel C. Experiments were performed at 1 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.
    Figure Legend Snippet: Characterization of multimer interfaces by site-directed mutagenesis. ( A ) Native gel showing the effect of flanking nucleotides on dimer formation. Experiments were performed using the sequences GAGTGGGAAGGGTGGG, xGAGTGGGAAGGGTGGG, GAGTGGGAAGGGTGGGx and xGAGTGGGAAGGGTGGGx (x = A, C or T). ( B ) Hypothetical secondary structure model of dimeric G-quadruplexes consistent with the experiments in panel A. ( C ) Native gel showing the effect of flanking nucleotides on tetramer formation. Experiments were performed using the sequences GGGTGGGAAGAGTGGG, xGGGTGGGAAGAGTGGG, GGGTGGGAAGAGTGGGx and xGGGTGGGAAGAGTGGGx (x = A, C or T). ( D ) Hypothetical secondary structure model of a tetrameric G-quadruplexes consistent with the experiments in panel C. Experiments were performed at 1 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.

    Techniques Used: Mutagenesis, Concentration Assay

    Mutations that induce formation of dimeric and tetrameric G-quadruplex structures. ( A ) Primary sequence and proposed topology of the reference construct used in these experiments. Mutated positions in the central tetrad are numbered. ( B ) Native gel showing different types of multimeric structures formed by mutants of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.
    Figure Legend Snippet: Mutations that induce formation of dimeric and tetrameric G-quadruplex structures. ( A ) Primary sequence and proposed topology of the reference construct used in these experiments. Mutated positions in the central tetrad are numbered. ( B ) Native gel showing different types of multimeric structures formed by mutants of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.

    Techniques Used: Sequencing, Construct, Concentration Assay

    Sequence requirements of G-quadruplex dimer formation. ( A ) Heat map showing the ability of all possible variants of the central tetrad in the reference construct to form dimers at 10 μM DNA concentration. ( B ) Dissociation constants of 13 of the variants identified in our screen. ( C ) Native gel and graph showing dimer formation as a function of DNA concentration. Dimers in panel (C) were generated using a construct with an AGGG mutation in the central tetrad of the reference construct and the sequence GAGTGGGAAGGGTGGGA. Experiments were typically performed between 10 nM and 10 μM G-quadruplex concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.
    Figure Legend Snippet: Sequence requirements of G-quadruplex dimer formation. ( A ) Heat map showing the ability of all possible variants of the central tetrad in the reference construct to form dimers at 10 μM DNA concentration. ( B ) Dissociation constants of 13 of the variants identified in our screen. ( C ) Native gel and graph showing dimer formation as a function of DNA concentration. Dimers in panel (C) were generated using a construct with an AGGG mutation in the central tetrad of the reference construct and the sequence GAGTGGGAAGGGTGGGA. Experiments were typically performed between 10 nM and 10 μM G-quadruplex concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.

    Techniques Used: Sequencing, Construct, Concentration Assay, Generated, Mutagenesis

    Sequence requirements of G-quadruplex tetramer formation. ( A ) Heat map showing the ability of all possible variants of the central tetrad of the reference construct to form tetramers at 10 μM DNA concentration. ( B ) DNA concentration at which tetramer formation is half the maximum value ( K 0.5 ) for 11 of the variants identified in our screen. ( C ) Native gel and graph showing tetramer formation as a function of DNA concentration. Experiments in panel (C) were performed using a construct with a GGAG mutation in the central tetrad of the reference construct and the sequence GGGTGGGAAGAGTGGGA. Experiments were typically performed between 10 nM and 10 μM G-quadruplex concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.
    Figure Legend Snippet: Sequence requirements of G-quadruplex tetramer formation. ( A ) Heat map showing the ability of all possible variants of the central tetrad of the reference construct to form tetramers at 10 μM DNA concentration. ( B ) DNA concentration at which tetramer formation is half the maximum value ( K 0.5 ) for 11 of the variants identified in our screen. ( C ) Native gel and graph showing tetramer formation as a function of DNA concentration. Experiments in panel (C) were performed using a construct with a GGAG mutation in the central tetrad of the reference construct and the sequence GGGTGGGAAGAGTGGGA. Experiments were typically performed between 10 nM and 10 μM G-quadruplex concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.

    Techniques Used: Sequencing, Construct, Concentration Assay, Mutagenesis

    Cooperative folding of dimeric and tetrameric G-quadruplexes. ( A ) Native gel showing dimer formation as a function of KCl concentration. ( B ) Native gel showing dimer formation as a function of MgCl 2 concentration. ( C ) Graph showing dimer formation as a function of KCl and MgCl 2 concentration. ( D ) Graph showing tetramer formation as a function of KCl and MgCl 2 concentration. Dimers were generated using a construct with an AGGG mutation in the central tetrad of the reference construct and the sequence GAGTGGGAAGGGTGGGA. Tetramers were generated using a construct with a GGAG mutation in the central tetrad of the reference construct and the sequence GGGTGGGAAGAGTGGGA. Experiments were performed at 1 μM G-quadruplex concentration in a buffer containing 20 mM HEPES pH 7.1 and either 0–1000 mM KCl or 0–20 mM MgCl 2 .
    Figure Legend Snippet: Cooperative folding of dimeric and tetrameric G-quadruplexes. ( A ) Native gel showing dimer formation as a function of KCl concentration. ( B ) Native gel showing dimer formation as a function of MgCl 2 concentration. ( C ) Graph showing dimer formation as a function of KCl and MgCl 2 concentration. ( D ) Graph showing tetramer formation as a function of KCl and MgCl 2 concentration. Dimers were generated using a construct with an AGGG mutation in the central tetrad of the reference construct and the sequence GAGTGGGAAGGGTGGGA. Tetramers were generated using a construct with a GGAG mutation in the central tetrad of the reference construct and the sequence GGGTGGGAAGAGTGGGA. Experiments were performed at 1 μM G-quadruplex concentration in a buffer containing 20 mM HEPES pH 7.1 and either 0–1000 mM KCl or 0–20 mM MgCl 2 .

    Techniques Used: Concentration Assay, Generated, Construct, Mutagenesis, Sequencing

    Structural characterization of dimeric and tetrameric G-quadruplexes. ( A ) Circular dichroism (CD) spectra of G-quadruplex variants that exist primarily as monomers, dimers or tetramers under the conditions of our screen. ( B ) Analysis of monomeric, dimeric and tetrameric G-quadruplexes by electrospray mass spectrometry. ( C ) Homodimeric and heterodimeric structures generated from two monomers of different lengths. ( D ) Detection of each of these structures on a native gel. Left part of gel: homodimeric markers generated from 17, 18, 19, 20 and 21 nt dimer-forming G-quadruplexes with the sequence GAGTGGGAAGGGTGGG(A 1–5 ). Right part of gel: homodimeric and heterodimeric structures generated by mixing 17 and 21 nt dimer-forming G-quadruplexes in different ratios. ( E ) Homotetrameric and heterotetrameric structures generated from two monomers of different lengths. ( F ) Detection of each of these structures on a native gel. Left part of gel: homotetrameric markers generated from 17, 18, 19, 20 and 21 nt tetramer-forming G-quadruplexes with the sequence GGGTGGGAAGAGTGGG(A 1–5 ). Right part of gel: homotetrameric and heterotetrameric structures generated by mixing 17 and 21 nt tetramer-forming G-quadruplexes in different ratios. Experiments in panel A were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1, while those in panel B were performed at 10 μM DNA concentration in a buffer containing 200 mM NH 4 OAc, pH 7. Experiments in panels D and F were performed at 1–1.5 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. ‘∞’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 17 nt monomer; ‘≥100’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 1 μM unlabeled 17 nt monomer; ‘2’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 17 nt monomer and 0.5 μM unlabeled 21 nt monomer; ‘0.5’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 0.5 μM unlabeled 17 nt monomer and 1 μM unlabeled 21 nt monomer; ‘≤0.01’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 21 nt monomer; ‘0’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 1 μM unlabeled 21 nt monomer.
    Figure Legend Snippet: Structural characterization of dimeric and tetrameric G-quadruplexes. ( A ) Circular dichroism (CD) spectra of G-quadruplex variants that exist primarily as monomers, dimers or tetramers under the conditions of our screen. ( B ) Analysis of monomeric, dimeric and tetrameric G-quadruplexes by electrospray mass spectrometry. ( C ) Homodimeric and heterodimeric structures generated from two monomers of different lengths. ( D ) Detection of each of these structures on a native gel. Left part of gel: homodimeric markers generated from 17, 18, 19, 20 and 21 nt dimer-forming G-quadruplexes with the sequence GAGTGGGAAGGGTGGG(A 1–5 ). Right part of gel: homodimeric and heterodimeric structures generated by mixing 17 and 21 nt dimer-forming G-quadruplexes in different ratios. ( E ) Homotetrameric and heterotetrameric structures generated from two monomers of different lengths. ( F ) Detection of each of these structures on a native gel. Left part of gel: homotetrameric markers generated from 17, 18, 19, 20 and 21 nt tetramer-forming G-quadruplexes with the sequence GGGTGGGAAGAGTGGG(A 1–5 ). Right part of gel: homotetrameric and heterotetrameric structures generated by mixing 17 and 21 nt tetramer-forming G-quadruplexes in different ratios. Experiments in panel A were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1, while those in panel B were performed at 10 μM DNA concentration in a buffer containing 200 mM NH 4 OAc, pH 7. Experiments in panels D and F were performed at 1–1.5 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. ‘∞’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 17 nt monomer; ‘≥100’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 1 μM unlabeled 17 nt monomer; ‘2’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 17 nt monomer and 0.5 μM unlabeled 21 nt monomer; ‘0.5’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 0.5 μM unlabeled 17 nt monomer and 1 μM unlabeled 21 nt monomer; ‘≤0.01’ lane ≤ 10 nM radiolabeled 17 nt monomer mixed with 1 μM unlabeled 21 nt monomer; ‘0’ lane ≤ 10 nM radiolabeled 21 nt monomer mixed with 1 μM unlabeled 21 nt monomer.

    Techniques Used: Mass Spectrometry, Generated, Sequencing, Concentration Assay

    Sequence model for tetrameric G-quadruplexes. ( A ) Effect of transplanting mutations that induce tetramer formation when present in the central tetrad of the reference construct to the 5′ tetrad (nucleotides 1, 5, 10 and 14) or the 3′ tetrad (nucleotides 3, 7, 12 and 16). Colors match those in Figure 5 . ( B ) Native gel and graph showing effects of point mutations in loops on tetramer formation. ( C ) Native gel and graph showing the ability of 10 randomly chosen sequences with up to two mutations in loops to form tetramers. Sequences are given in Supplementary Table S1 . ( D ) Loop requirements of G-quadruplex variants that form tetramers. Numbers indicate the positions of loops in the reference construct, and letters below indicate the nucleotides that can occur at each position. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. H = A, C or T. Mutations in panels B and C were made in the context of a construct with a GGAG mutation in the central tetrad of the reference construct with the sequence GGGTGGGAAGAGTGGGA.
    Figure Legend Snippet: Sequence model for tetrameric G-quadruplexes. ( A ) Effect of transplanting mutations that induce tetramer formation when present in the central tetrad of the reference construct to the 5′ tetrad (nucleotides 1, 5, 10 and 14) or the 3′ tetrad (nucleotides 3, 7, 12 and 16). Colors match those in Figure 5 . ( B ) Native gel and graph showing effects of point mutations in loops on tetramer formation. ( C ) Native gel and graph showing the ability of 10 randomly chosen sequences with up to two mutations in loops to form tetramers. Sequences are given in Supplementary Table S1 . ( D ) Loop requirements of G-quadruplex variants that form tetramers. Numbers indicate the positions of loops in the reference construct, and letters below indicate the nucleotides that can occur at each position. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. H = A, C or T. Mutations in panels B and C were made in the context of a construct with a GGAG mutation in the central tetrad of the reference construct with the sequence GGGTGGGAAGAGTGGGA.

    Techniques Used: Sequencing, Construct, Concentration Assay, Mutagenesis

    Formation of heteromultimeric G-quadruplexes from pairs of mutants with different sequences. ( A ) Sequence requirements of heterodimer formation. Left: heat map showing the ability of pairs of sequences with different mutations in the central tetrad of the reference construct to form heterodimers. Colors match those in Figure 4 . Right: model describing the types of sequences that can form heterodimers. ( B ) Sequence requirements of heterotetramer formation. Left: heat map showing the ability of pairs of sequences with different mutations in the central tetrad of the reference construct to form heterotetramers. Colors match those in Figure 5 . Right: model describing the types of sequences that can form heterotetramers. In each heat map, spaces are used to separate the seven dimer-forming sequences (on the left part of the x axis and the top part of the y axis) from the six tetramer-forming sequences (on the right part of the x axis and the bottom part of the y axis). Experiments were performed using 10 μM of the unlabeled G-quadruplex variant indicated on the x axis mixed with ≤10 nM of the radiolabeled G-quadruplex variant indicated on the y axis. All experiments were performed in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.
    Figure Legend Snippet: Formation of heteromultimeric G-quadruplexes from pairs of mutants with different sequences. ( A ) Sequence requirements of heterodimer formation. Left: heat map showing the ability of pairs of sequences with different mutations in the central tetrad of the reference construct to form heterodimers. Colors match those in Figure 4 . Right: model describing the types of sequences that can form heterodimers. ( B ) Sequence requirements of heterotetramer formation. Left: heat map showing the ability of pairs of sequences with different mutations in the central tetrad of the reference construct to form heterotetramers. Colors match those in Figure 5 . Right: model describing the types of sequences that can form heterotetramers. In each heat map, spaces are used to separate the seven dimer-forming sequences (on the left part of the x axis and the top part of the y axis) from the six tetramer-forming sequences (on the right part of the x axis and the bottom part of the y axis). Experiments were performed using 10 μM of the unlabeled G-quadruplex variant indicated on the x axis mixed with ≤10 nM of the radiolabeled G-quadruplex variant indicated on the y axis. All experiments were performed in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1.

    Techniques Used: Sequencing, Construct, Variant Assay

    Sequence model for dimeric G-quadruplexes. ( A ) Effect of transplanting mutations that induce dimer formation when present in the central tetrad of the reference construct to the 5′ tetrad (nucleotides 1, 5, 10 and 14) or the 3′ tetrad (nucleotides 3, 7, 12 and 16). Colors match those in Figure 4 . ( B ) Native gel and graph showing effects of point mutations in loops on dimer formation. ( C ) Native gel and graph showing the ability of ten randomly chosen sequences with up to five mutations in loops to form dimers. Sequences are given in Supplementary Table S1 . ( D ) Loop requirements of G-quadruplex variants that form dimers. Numbers indicate the positions of loops in the reference construct, and letters below indicate the nucleotides that can occur at each position. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. H = A, C or T. Mutations in panels B and C were made in the context of a construct with an AGGG mutation in the central tetrad of the reference construct with the sequence GAGTGGGAAGGGTGGGA.
    Figure Legend Snippet: Sequence model for dimeric G-quadruplexes. ( A ) Effect of transplanting mutations that induce dimer formation when present in the central tetrad of the reference construct to the 5′ tetrad (nucleotides 1, 5, 10 and 14) or the 3′ tetrad (nucleotides 3, 7, 12 and 16). Colors match those in Figure 4 . ( B ) Native gel and graph showing effects of point mutations in loops on dimer formation. ( C ) Native gel and graph showing the ability of ten randomly chosen sequences with up to five mutations in loops to form dimers. Sequences are given in Supplementary Table S1 . ( D ) Loop requirements of G-quadruplex variants that form dimers. Numbers indicate the positions of loops in the reference construct, and letters below indicate the nucleotides that can occur at each position. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 and 20 mM HEPES pH 7.1. H = A, C or T. Mutations in panels B and C were made in the context of a construct with an AGGG mutation in the central tetrad of the reference construct with the sequence GAGTGGGAAGGGTGGGA.

    Techniques Used: Sequencing, Construct, Concentration Assay, Mutagenesis

    7) Product Images from "Modifications of proteins by polyunsaturated fatty acid peroxidation products"

    Article Title: Modifications of proteins by polyunsaturated fatty acid peroxidation products

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Lipid-dependent oxidation of BSA to carbonyl derivatives. Mixtures containing BSA (2 mg/ml), 50 mM Hepes buffer at pH 7.2, 25 mM ascorbate, 0.1 mM FeCl 3 , and 10 mM methyl arachidonate (●), methyl linolenate (♦), methyl linoleate (▴), methyl oleate (⋄), methyl stearate (▵), or no lipid (■) were incubated at 37°C.
    Figure Legend Snippet: Lipid-dependent oxidation of BSA to carbonyl derivatives. Mixtures containing BSA (2 mg/ml), 50 mM Hepes buffer at pH 7.2, 25 mM ascorbate, 0.1 mM FeCl 3 , and 10 mM methyl arachidonate (●), methyl linolenate (♦), methyl linoleate (▴), methyl oleate (⋄), methyl stearate (▵), or no lipid (■) were incubated at 37°C.

    Techniques Used: Incubation

    Lipid hydroperoxide-dependent conversion of BSA to carbonyl derivatives. Reaction mixtures containing 10 mM concentrations of a chemically prepared mixture of lipid hydroperoxides (gray bars), pure lipid hydroperoxide preparations (black bars), or no hydroperoxide (open bars) were incubated with 2 mg/ml BSA in 50 mM Hepes buffer, pH 7.2, in both the presence and absence of 1 mM Fe 2+ . After 2 hr at 37°C, the protein carbonyl content was measured. The lipid hydroperoxide mixtures and pure lipid hydroperoxides, methyl linoleate (C18:2), methyl linolenate (C18:3), and methyl arachidonate (C20:4) were obtained as described in the text.
    Figure Legend Snippet: Lipid hydroperoxide-dependent conversion of BSA to carbonyl derivatives. Reaction mixtures containing 10 mM concentrations of a chemically prepared mixture of lipid hydroperoxides (gray bars), pure lipid hydroperoxide preparations (black bars), or no hydroperoxide (open bars) were incubated with 2 mg/ml BSA in 50 mM Hepes buffer, pH 7.2, in both the presence and absence of 1 mM Fe 2+ . After 2 hr at 37°C, the protein carbonyl content was measured. The lipid hydroperoxide mixtures and pure lipid hydroperoxides, methyl linoleate (C18:2), methyl linolenate (C18:3), and methyl arachidonate (C20:4) were obtained as described in the text.

    Techniques Used: Incubation

    8) Product Images from "Altered biochemical specificity of G-quadruplexes with mutated tetrads"

    Article Title: Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw987

    Compensatory mutations in G-quadruplex structures. ( A ) Overview of the strategy used to identify compensatory mutations. Variants containing such mutations were chosen based on both activity (which was required to be > 20% of that of the reference construct) and extent of rescue (which was required to be at least 5-fold higher than expected based on multiplying single mutation effects). ( B ) Expected and observed GTP-binding activity for the G-G-G-G to G-A-T-T compensatory change. In each case, expected GTP-binding activity was calculated by multiplying the effects of the mutations that make up the G-G-G-G to G-A-T-T mutant, which are indicated below each pair of measurements. Observed activity is the experimentally measured GTP-binding activity of the indicated mutant. ( C ) Expected and observed peroxidase activity for the G-G-G-G to G-G-C-C and G-G-G-G to G-G-T-C compensatory changes. In each case, expected peroxidase activity was calculated by multiplying the effects of the individual mutations that make up the G-G-G-G to G-G-C-C or G-G-G-G to G-G-T-C mutant, which are indicated below each pair of measurements. Observed activity is the experimentally measured peroxidase activity of the indicated mutant. Experiments in panel (B) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. Experiments in panel (C) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . In all panels, GTP-binding and peroxidase activity is expressed relative to that of the reference construct. Reported values represent the average of three experiments and error bars indicate one standard deviation. For expected GTP-binding and peroxidase activity, standard deviations were calculated using standard methods of propagation of error.
    Figure Legend Snippet: Compensatory mutations in G-quadruplex structures. ( A ) Overview of the strategy used to identify compensatory mutations. Variants containing such mutations were chosen based on both activity (which was required to be > 20% of that of the reference construct) and extent of rescue (which was required to be at least 5-fold higher than expected based on multiplying single mutation effects). ( B ) Expected and observed GTP-binding activity for the G-G-G-G to G-A-T-T compensatory change. In each case, expected GTP-binding activity was calculated by multiplying the effects of the mutations that make up the G-G-G-G to G-A-T-T mutant, which are indicated below each pair of measurements. Observed activity is the experimentally measured GTP-binding activity of the indicated mutant. ( C ) Expected and observed peroxidase activity for the G-G-G-G to G-G-C-C and G-G-G-G to G-G-T-C compensatory changes. In each case, expected peroxidase activity was calculated by multiplying the effects of the individual mutations that make up the G-G-G-G to G-G-C-C or G-G-G-G to G-G-T-C mutant, which are indicated below each pair of measurements. Observed activity is the experimentally measured peroxidase activity of the indicated mutant. Experiments in panel (B) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. Experiments in panel (C) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . In all panels, GTP-binding and peroxidase activity is expressed relative to that of the reference construct. Reported values represent the average of three experiments and error bars indicate one standard deviation. For expected GTP-binding and peroxidase activity, standard deviations were calculated using standard methods of propagation of error.

    Techniques Used: Activity Assay, Construct, Mutagenesis, Binding Assay, Concentration Assay, Standard Deviation

    Correlated mutational effects in G-quadruplexes with GTP-binding and peroxidase activity. ( A ) GTP-binding activity of all possible single mutant variants of the reference construct. ( B–D ) GTP-binding activity of all possible double, triple, and quadruple mutant variants of the reference construct. ( E ) Peroxidase activity of all possible single mutant variants of the reference construct. ( F–H ) Peroxidase activity of all possible double, triple and quadruple mutant variants of the reference construct. In panels (B–D) and (F–H), the solid blue line indicates the expected relationship for independent mutational effects. All experiments in panels (A–D) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. All experiments in panels (E–H) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . In panels (A) and (E), reported values represent the average of three experiments and error bars indicate one standard deviation. In panels (B–D) and (F-H), reported values represent the GTP-binding or peroxidase activity obtained from a single experiment. In all panels, GTP-binding and peroxidase activity is expressed relative to that of the reference construct.
    Figure Legend Snippet: Correlated mutational effects in G-quadruplexes with GTP-binding and peroxidase activity. ( A ) GTP-binding activity of all possible single mutant variants of the reference construct. ( B–D ) GTP-binding activity of all possible double, triple, and quadruple mutant variants of the reference construct. ( E ) Peroxidase activity of all possible single mutant variants of the reference construct. ( F–H ) Peroxidase activity of all possible double, triple and quadruple mutant variants of the reference construct. In panels (B–D) and (F–H), the solid blue line indicates the expected relationship for independent mutational effects. All experiments in panels (A–D) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. All experiments in panels (E–H) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . In panels (A) and (E), reported values represent the average of three experiments and error bars indicate one standard deviation. In panels (B–D) and (F-H), reported values represent the GTP-binding or peroxidase activity obtained from a single experiment. In all panels, GTP-binding and peroxidase activity is expressed relative to that of the reference construct.

    Techniques Used: Binding Assay, Activity Assay, Mutagenesis, Construct, Concentration Assay, Standard Deviation

    Sequence requirements of G-quadruplexes with GTP-binding and peroxidase activity. ( A ) Measuring the GTP-binding activity of G-quadruplex variants by gel filtration. ( B ) Heat map showing the GTP-binding activity of all possible variants of the central tetrad in the reference sequence. ( C ) Measuring the peroxidase activity of G-quadruplex variants using the substrate ABTS. ( D ) Heat map showing the peroxidase activity of all possible variants of the central tetrad in the reference sequence. All GTP-binding assays were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. All peroxidase assays were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . Reported values in panels (B) and (D) represent the GTP-binding or peroxidase activity obtained from a single experiment. All measurements > 20% of the value of the reference construct in this screen were repeated two more times, and those with an average value > 20% of the reference construct are listed in Tables 1 and 2 .
    Figure Legend Snippet: Sequence requirements of G-quadruplexes with GTP-binding and peroxidase activity. ( A ) Measuring the GTP-binding activity of G-quadruplex variants by gel filtration. ( B ) Heat map showing the GTP-binding activity of all possible variants of the central tetrad in the reference sequence. ( C ) Measuring the peroxidase activity of G-quadruplex variants using the substrate ABTS. ( D ) Heat map showing the peroxidase activity of all possible variants of the central tetrad in the reference sequence. All GTP-binding assays were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM 32 P-γ-GTP. All peroxidase assays were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . Reported values in panels (B) and (D) represent the GTP-binding or peroxidase activity obtained from a single experiment. All measurements > 20% of the value of the reference construct in this screen were repeated two more times, and those with an average value > 20% of the reference construct are listed in Tables 1 and 2 .

    Techniques Used: Sequencing, Binding Assay, Activity Assay, Filtration, Concentration Assay, Construct

    Mutagenesis of a tetrad in a DNA G-quadruplex with GTP-binding and peroxidase activity. ( A ) Topological isoforms of G-quadruplexes formed from different combinations of parallel and antiparallel strands. ( B ) Primary sequence and possible structure of the reference construct used in these experiments. Mutated positions in the central tetrad are numbered. Note that our experiments do not indicate which strands are next to one another in this structure. ( C ) Peroxidase activity of the reference construct using the substrate ABTS. Solid orange curve = the most active previously described construct (ATTGGGAGGGATTGGGTGGG); solid blue curve = the reference construct; dotted orange curve = a 17 nucleotide random sequence pool. ( D ) Circular dichroism spectrum of the reference construct. DA = differential absorption. ( E ) Retention of the reference construct in a gel filtration column compared to single and double-stranded markers. Random sequence = a 17 nucleotide random sequence pool; single stranded = a randomly generated, 17 nucleotide oligonucleotide with the sequence GACTGCCTCGTCACGAT; double stranded = a mix of the single-stranded oligonucleotide GACTGCCTCGTCACGAT and its reverse complement. The experiment in panel (C) was performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . Experiments in panels (D) and (E) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM unlabeled GTP. In panel (E), reported values represent the average of three experiments and error bars indicate one standard deviation.
    Figure Legend Snippet: Mutagenesis of a tetrad in a DNA G-quadruplex with GTP-binding and peroxidase activity. ( A ) Topological isoforms of G-quadruplexes formed from different combinations of parallel and antiparallel strands. ( B ) Primary sequence and possible structure of the reference construct used in these experiments. Mutated positions in the central tetrad are numbered. Note that our experiments do not indicate which strands are next to one another in this structure. ( C ) Peroxidase activity of the reference construct using the substrate ABTS. Solid orange curve = the most active previously described construct (ATTGGGAGGGATTGGGTGGG); solid blue curve = the reference construct; dotted orange curve = a 17 nucleotide random sequence pool. ( D ) Circular dichroism spectrum of the reference construct. DA = differential absorption. ( E ) Retention of the reference construct in a gel filtration column compared to single and double-stranded markers. Random sequence = a 17 nucleotide random sequence pool; single stranded = a randomly generated, 17 nucleotide oligonucleotide with the sequence GACTGCCTCGTCACGAT; double stranded = a mix of the single-stranded oligonucleotide GACTGCCTCGTCACGAT and its reverse complement. The experiment in panel (C) was performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS, and 600 μM H 2 O 2 . Experiments in panels (D) and (E) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1, and 10 nM unlabeled GTP. In panel (E), reported values represent the average of three experiments and error bars indicate one standard deviation.

    Techniques Used: Mutagenesis, Binding Assay, Activity Assay, Sequencing, Construct, Filtration, Generated, Concentration Assay, Standard Deviation

    Sequence models for G-quadruplexes that bind GTP and promote peroxidase reactions. ( A ) Comparing the effects of mutations in the 5’, central and 3’ tetrad on the ability of the reference construct to bind GTP. The color scheme used to indicate the activity of each mutant matches that in Figure 3 . ( B ) Sequence model for G-quadruplexes that bind GTP. 5’ tetrad = positions 1, 5, 10 and 14; central tetrad = positions 2, 6, 11 and 15; 3’ tetrad = positions 3, 7, 12 and 16; spacer nucleotides = 4, 8, 9, 13 and 17. ( C ) Expected and observed activities of 10 randomly chosen sequences that satisfy the requirements of our model. The blue line indicates the relationship if expected and observed activities were identical, and was calculated by assuming that spacer sequence does not influence activity. GTP-binding activity is expressed relative to that of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1 and 10 nM 32 P-γ-GTP. ( D ) Comparing the effects of mutations in the 5’, central and 3’ tetrad on the ability of the reference construct to promote peroxidase reactions. The color scheme used to indicate the activity of each mutant matches that in Figure 3 . ( E ) Sequence model for G-quadruplexes that promote peroxidase reactions. 5’ tetrad = positions 1, 5, 10 and 14; central tetrad = positions 2, 6, 11 and 15; 3’ tetrad = positions 3, 7, 12 and 16; spacer nucleotides = 4, 8, 9, 13 and 17. ( F ) Expected and observed activities of 30 randomly chosen sequences that satisfy the requirements of our model. The blue line indicates the relationship if expected and observed activities were identical, and was calculated by assuming that spacer sequence does not influence activity. Peroxidase activity is expressed relative to that of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS and 600 μM H 2 O 2 . In panels (B) and (E), the IUPAC nucleotide code was used to indicate the nucleotides that are permitted to occur at variable positions in each sequence model. W = A or T; H = A, C or T; D = A, G or T; B = C, G or T; N = A, C, G or T.
    Figure Legend Snippet: Sequence models for G-quadruplexes that bind GTP and promote peroxidase reactions. ( A ) Comparing the effects of mutations in the 5’, central and 3’ tetrad on the ability of the reference construct to bind GTP. The color scheme used to indicate the activity of each mutant matches that in Figure 3 . ( B ) Sequence model for G-quadruplexes that bind GTP. 5’ tetrad = positions 1, 5, 10 and 14; central tetrad = positions 2, 6, 11 and 15; 3’ tetrad = positions 3, 7, 12 and 16; spacer nucleotides = 4, 8, 9, 13 and 17. ( C ) Expected and observed activities of 10 randomly chosen sequences that satisfy the requirements of our model. The blue line indicates the relationship if expected and observed activities were identical, and was calculated by assuming that spacer sequence does not influence activity. GTP-binding activity is expressed relative to that of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1 and 10 nM 32 P-γ-GTP. ( D ) Comparing the effects of mutations in the 5’, central and 3’ tetrad on the ability of the reference construct to promote peroxidase reactions. The color scheme used to indicate the activity of each mutant matches that in Figure 3 . ( E ) Sequence model for G-quadruplexes that promote peroxidase reactions. 5’ tetrad = positions 1, 5, 10 and 14; central tetrad = positions 2, 6, 11 and 15; 3’ tetrad = positions 3, 7, 12 and 16; spacer nucleotides = 4, 8, 9, 13 and 17. ( F ) Expected and observed activities of 30 randomly chosen sequences that satisfy the requirements of our model. The blue line indicates the relationship if expected and observed activities were identical, and was calculated by assuming that spacer sequence does not influence activity. Peroxidase activity is expressed relative to that of the reference construct. Experiments were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 8, 0.05% Triton X-100, 0.5 μM hemin, 1% DMSO, 5 mM ABTS and 600 μM H 2 O 2 . In panels (B) and (E), the IUPAC nucleotide code was used to indicate the nucleotides that are permitted to occur at variable positions in each sequence model. W = A or T; H = A, C or T; D = A, G or T; B = C, G or T; N = A, C, G or T.

    Techniques Used: Sequencing, Construct, Activity Assay, Mutagenesis, Binding Assay, Concentration Assay

    The circular dichroism spectra of single mutant variants of the reference construct are similar to those of parallel strand G-quadruplexes. ( A ) GTP-binding activity of all single mutant variants of the reference construct. Measurements were performed as described in the legend to Figure 3 . ( B ) Peroxidase activity of all single mutant variants of the reference construct. Measurements were performed as described in the legend to Figure 3 . ( C ) Circular dichroism spectra of all single mutant variants of the reference construct. In each graph, the blue curve represents the circular dichroism spectrum of the reference construct, and the orange curve represents the circular dichroism spectrum of the indicated mutant. DA = differential absorption. All experiments in panel (C) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1 and 10 nM unlabeled GTP.
    Figure Legend Snippet: The circular dichroism spectra of single mutant variants of the reference construct are similar to those of parallel strand G-quadruplexes. ( A ) GTP-binding activity of all single mutant variants of the reference construct. Measurements were performed as described in the legend to Figure 3 . ( B ) Peroxidase activity of all single mutant variants of the reference construct. Measurements were performed as described in the legend to Figure 3 . ( C ) Circular dichroism spectra of all single mutant variants of the reference construct. In each graph, the blue curve represents the circular dichroism spectrum of the reference construct, and the orange curve represents the circular dichroism spectrum of the indicated mutant. DA = differential absorption. All experiments in panel (C) were performed at 10 μM DNA concentration in a buffer containing 200 mM KCl, 1 mM MgCl 2 , 20 mM HEPES pH 7.1 and 10 nM unlabeled GTP.

    Techniques Used: Mutagenesis, Construct, Binding Assay, Activity Assay, Concentration Assay

    9) Product Images from "The L-Thr kinase/ L-Thr-phosphate decarboxylase (CobD) enzyme from Methanosarcina mazei Gö1 contains metallocenters needed for optimal activity"

    Article Title: The L-Thr kinase/ L-Thr-phosphate decarboxylase (CobD) enzyme from Methanosarcina mazei Gö1 contains metallocenters needed for optimal activity

    Journal: Biochemistry

    doi: 10.1021/acs.biochem.9b00268

    Anoxically purified Mm CobD is a more active enzyme. ATPase activity assay measured with ADP-Glo™ ATPase Assay Kit (Promega). Reaction mixtures contained HEPES buffer (50 mM, pH 8.5 at 25°C), MgCl 2 (5 mM), ATP (1 mM), L-Thr (5 mM), and purified Mm CobD protein (5 μM) incubated at 25°C for 30 min. Proteins were purified and incubated under normoxic or anoxic conditions, as indicated. Anoxically purified protein was oxidized by exposure to air for 15 min or H 2 O 2 (2 μM) prior to assaying. No-enzyme controls were subtracted to reduce background. Representative data of two independent experiments. Values were compared to a standard curve and converted to mM of ADP produced per mg of protein, with the standard error of the mean of quadruplicate reactions represented by the error bars. Unpaired t-test, p values are relative to anoxically purified Mm CobD assayed under anoxic conditions. Unpaired t-test was used to calculate p values ≤ 0.001 (**), ≤ 0.03 (*), or not significant (ns) using Prism v6 (GraphPad).
    Figure Legend Snippet: Anoxically purified Mm CobD is a more active enzyme. ATPase activity assay measured with ADP-Glo™ ATPase Assay Kit (Promega). Reaction mixtures contained HEPES buffer (50 mM, pH 8.5 at 25°C), MgCl 2 (5 mM), ATP (1 mM), L-Thr (5 mM), and purified Mm CobD protein (5 μM) incubated at 25°C for 30 min. Proteins were purified and incubated under normoxic or anoxic conditions, as indicated. Anoxically purified protein was oxidized by exposure to air for 15 min or H 2 O 2 (2 μM) prior to assaying. No-enzyme controls were subtracted to reduce background. Representative data of two independent experiments. Values were compared to a standard curve and converted to mM of ADP produced per mg of protein, with the standard error of the mean of quadruplicate reactions represented by the error bars. Unpaired t-test, p values are relative to anoxically purified Mm CobD assayed under anoxic conditions. Unpaired t-test was used to calculate p values ≤ 0.001 (**), ≤ 0.03 (*), or not significant (ns) using Prism v6 (GraphPad).

    Techniques Used: Purification, Activity Assay, ATPase Assay, Incubation, Produced

    10) Product Images from "Mechanism of the Interaction between the Intrinsically Disordered C-Terminus of the Pro-Apoptotic ARTS Protein and the Bir3 Domain of XIAP"

    Article Title: Mechanism of the Interaction between the Intrinsically Disordered C-Terminus of the Pro-Apoptotic ARTS Protein and the Bir3 Domain of XIAP

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0024655

    Secondary structure analysis of ARTS CTD. A: Far UV CD spectrum of ARTS CTD in phosphate buffer, pH 7.4 at 20°C and an ionic strength of 50 mM. The strong absorption at 200 nm indicates a pattern of unfolded region, where α-helices or β-strands characteristic are absent. B: The effect of temperature on the CD spectrum of ARTS CTD. All experiments were performed in 20 mM phosphate buffer, pH 7.4 at 20°C and an ionic strength of 50 mM. Peptide concentration was 60 µM. The temperature range was 10–90°C. A linear increase of the CD signal at 222 nm as a function of temperature is consistent with an apparent temperature-induced formation of a residual structure. C: The 1 H-NMR spectrum of ARTS CTD in 90% 20 mM deuterated Hepes buffer and10% D 2 O, pH 6.8, at 15°C, ionic strength of 50 mM. The resonances have a narrow dispersion, as expected for an unstructured polypeptide. The fingerprint resonances range between 8.75–7.95 ppm, Δ = 0.80 ppm.
    Figure Legend Snippet: Secondary structure analysis of ARTS CTD. A: Far UV CD spectrum of ARTS CTD in phosphate buffer, pH 7.4 at 20°C and an ionic strength of 50 mM. The strong absorption at 200 nm indicates a pattern of unfolded region, where α-helices or β-strands characteristic are absent. B: The effect of temperature on the CD spectrum of ARTS CTD. All experiments were performed in 20 mM phosphate buffer, pH 7.4 at 20°C and an ionic strength of 50 mM. Peptide concentration was 60 µM. The temperature range was 10–90°C. A linear increase of the CD signal at 222 nm as a function of temperature is consistent with an apparent temperature-induced formation of a residual structure. C: The 1 H-NMR spectrum of ARTS CTD in 90% 20 mM deuterated Hepes buffer and10% D 2 O, pH 6.8, at 15°C, ionic strength of 50 mM. The resonances have a narrow dispersion, as expected for an unstructured polypeptide. The fingerprint resonances range between 8.75–7.95 ppm, Δ = 0.80 ppm.

    Techniques Used: Concentration Assay, Nuclear Magnetic Resonance

    11) Product Images from "Isolation of Phage Lysins That Effectively Kill Pseudomonas aeruginosa in Mouse Models of Lung and Skin Infection"

    Article Title: Isolation of Phage Lysins That Effectively Kill Pseudomonas aeruginosa in Mouse Models of Lung and Skin Infection

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.00024-19

    Activity of the lysins against log-phase and stationary P. aeruginosa bacteria. The P. aeruginosa bacteria were grown overnight (stationary [Stat]), diluted 1:100, and grown to log phase (Log). Bacteria were washed and incubated with lysins at the indicated concentrations in 30 mM HEPES buffer, pH 7.4, for 1 h at 37°C. Viable bacteria were quantified by serial dilution and plating. Experiments were done in duplicate; error bars represent standard deviations.
    Figure Legend Snippet: Activity of the lysins against log-phase and stationary P. aeruginosa bacteria. The P. aeruginosa bacteria were grown overnight (stationary [Stat]), diluted 1:100, and grown to log phase (Log). Bacteria were washed and incubated with lysins at the indicated concentrations in 30 mM HEPES buffer, pH 7.4, for 1 h at 37°C. Viable bacteria were quantified by serial dilution and plating. Experiments were done in duplicate; error bars represent standard deviations.

    Techniques Used: Activity Assay, Incubation, Serial Dilution

    Activity of leading lysins against various bacteria. Various isolates of P. aeruginosa (A), Klebsiella and Enterobacter (B), and other Gram-negative and Gram-positive bacteria (C) were incubated with 100-μg/ml lysins in 30 mM HEPES buffer, pH 7.4, for 1 h at 37°C. Viable bacteria were enumerated by serial dilution and plating. Experiments were done in duplicate; error bars represent standard deviations. Also see Fig. S7 in the supplemental material.
    Figure Legend Snippet: Activity of leading lysins against various bacteria. Various isolates of P. aeruginosa (A), Klebsiella and Enterobacter (B), and other Gram-negative and Gram-positive bacteria (C) were incubated with 100-μg/ml lysins in 30 mM HEPES buffer, pH 7.4, for 1 h at 37°C. Viable bacteria were enumerated by serial dilution and plating. Experiments were done in duplicate; error bars represent standard deviations. Also see Fig. S7 in the supplemental material.

    Techniques Used: Activity Assay, Incubation, Serial Dilution

    Characterization of PlyPa03 and PlyPa91. (A) Time-kill curve. Log-phase P. aeruginosa PAO1 cells were incubated for various lengths of time at 37°C with 100-μg/ml lysin in 30 mM HEPES buffer. (B) Effect of pH. Log-phase P. aeruginosa PAO1 cells were incubated for 1 h at 37°C with 100-μg/ml lysin in 25 mM the following buffers: pH 5.0, acetate buffer; pH 6.0, MES buffer; pH 7.0 and 8.0, HEPES buffer; pH 9.0, CHES buffer; pH 10.0, CAPS buffer. (C) Effect of NaCl. Log-phase P. aeruginosa PAO1 cells were incubated with 100-μg/ml PlyPa03 or PlyPa91 for 1 h at 37°C in 30 mM HEPES, pH 7.4, and various concentrations of NaCl. (D) Effect of urea. Log-phase P. aeruginosa PAO1 cells were incubated with 100-μg/ml PlyPa03 or PlyPa91 for 1 h at 37°C in 30 mM HEPES, pH 7.4, and various concentrations of urea. In all cases, the surviving bacteria were enumerated by serial dilution and plating. Experiments were done in triplicate; error bars represent standard deviations.
    Figure Legend Snippet: Characterization of PlyPa03 and PlyPa91. (A) Time-kill curve. Log-phase P. aeruginosa PAO1 cells were incubated for various lengths of time at 37°C with 100-μg/ml lysin in 30 mM HEPES buffer. (B) Effect of pH. Log-phase P. aeruginosa PAO1 cells were incubated for 1 h at 37°C with 100-μg/ml lysin in 25 mM the following buffers: pH 5.0, acetate buffer; pH 6.0, MES buffer; pH 7.0 and 8.0, HEPES buffer; pH 9.0, CHES buffer; pH 10.0, CAPS buffer. (C) Effect of NaCl. Log-phase P. aeruginosa PAO1 cells were incubated with 100-μg/ml PlyPa03 or PlyPa91 for 1 h at 37°C in 30 mM HEPES, pH 7.4, and various concentrations of NaCl. (D) Effect of urea. Log-phase P. aeruginosa PAO1 cells were incubated with 100-μg/ml PlyPa03 or PlyPa91 for 1 h at 37°C in 30 mM HEPES, pH 7.4, and various concentrations of urea. In all cases, the surviving bacteria were enumerated by serial dilution and plating. Experiments were done in triplicate; error bars represent standard deviations.

    Techniques Used: Incubation, Serial Dilution

    Bactericidal activity of lysins against P. aeruginosa PAO1. Purified lysins were diluted to various concentrations and incubated with log-phase P. aeruginosa PAO1 for 1 h at 37°C in 30 mM HEPES, pH 7.4. The values of the number of CFU per milliliter were established by serial dilution and plating. (A) Initial lysins. (B) Additional homologues of PlyPa02. Experiments were conducted in duplicate; error bars represent standard deviations.
    Figure Legend Snippet: Bactericidal activity of lysins against P. aeruginosa PAO1. Purified lysins were diluted to various concentrations and incubated with log-phase P. aeruginosa PAO1 for 1 h at 37°C in 30 mM HEPES, pH 7.4. The values of the number of CFU per milliliter were established by serial dilution and plating. (A) Initial lysins. (B) Additional homologues of PlyPa02. Experiments were conducted in duplicate; error bars represent standard deviations.

    Techniques Used: Activity Assay, Purification, Incubation, Serial Dilution

    12) Product Images from "eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging"

    Article Title: eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging

    Journal: ACS Chemical Biology

    doi: 10.1021/acschembio.5b00211

    Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .
    Figure Legend Snippet: Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .

    Techniques Used: Binding Assay, Introduce, Concentration Assay

    13) Product Images from "Btk-dependent Rac activation and actin rearrangement following Fc?RI aggregation promotes enhanced chemotactic responses of mast cells"

    Article Title: Btk-dependent Rac activation and actin rearrangement following Fc?RI aggregation promotes enhanced chemotactic responses of mast cells

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.071043

    Synergistic cell migration is primarily dependent on chemotaxis. ( A ) IgE-sensitized BMMCs were washed three times with HEPES buffer containing 0.5% BSA, and then cells were stimulated with indicated agonists [antigen, Ag (10 ng/ml), SCF (10 ng/ml), adenosine (1 μM), PGE 2 (100 nM)]. After 3 hours, cell-free supernatants (Sup) from antigen and/or other agonist-stimulated BMMCs were applied to the lower chamber. Sensitized or unsensitized BMMCs were placed in the upper chambers. After incubation for 4 hours, BMMCs migrating to the lower chambers were collected and counted. ( B ) Sensitized BMMCs were preincubated with or without actinomycin D (5 μg/ml) for 30 minutes, and cell migration was measured. ( C ) To test whether the cell migration was chemotaxis or chemokinesis, indicated agonists were placed in the lower chamber or both upper and lower chambers. Sensitized BMMCs were placed in upper chambers. After 4 hours, BMMCs migrating to the lower chambers were collected and counted. Results are means ± s.e. of three separate experiments. * P
    Figure Legend Snippet: Synergistic cell migration is primarily dependent on chemotaxis. ( A ) IgE-sensitized BMMCs were washed three times with HEPES buffer containing 0.5% BSA, and then cells were stimulated with indicated agonists [antigen, Ag (10 ng/ml), SCF (10 ng/ml), adenosine (1 μM), PGE 2 (100 nM)]. After 3 hours, cell-free supernatants (Sup) from antigen and/or other agonist-stimulated BMMCs were applied to the lower chamber. Sensitized or unsensitized BMMCs were placed in the upper chambers. After incubation for 4 hours, BMMCs migrating to the lower chambers were collected and counted. ( B ) Sensitized BMMCs were preincubated with or without actinomycin D (5 μg/ml) for 30 minutes, and cell migration was measured. ( C ) To test whether the cell migration was chemotaxis or chemokinesis, indicated agonists were placed in the lower chamber or both upper and lower chambers. Sensitized BMMCs were placed in upper chambers. After 4 hours, BMMCs migrating to the lower chambers were collected and counted. Results are means ± s.e. of three separate experiments. * P

    Techniques Used: Migration, Chemotaxis Assay, Incubation

    The role of PI3K in synergistic chemotactic responses. ( A ) Sensitized BMMCs were preincubated with or without wortmannin (100 nM), in the upper chamber and placed in 600 μl HEPES buffer containing 0.5% BSA and wortmannin for 30 minutes. The upper chambers were then replaced in the lower chambers containing the indicated agonists. ( B ) Sensitized BMMCs were preincubated with indicated inhibitors for 20 minutes and then stimulated with the indicated agonists for 5 minutes. Following electrophoresis and membrane transfer, proteins were probed using anti-phospho-AKT (Ser473 -P ). To normalize protein loading, membranes were stripped and probed for β-actin, or alternatively identically loaded samples were probed for β-actin. The data shown are from three separate experiments, each repeated at least three times, with identical results, on separate cell preparations. ( C ) Sensitized BMMCs were preincubated with or without AS 252424 (3 μM) or IC 87114 (3 μM) in the upper chambers and placed in 600 μl HEPES buffer containing 0.5% BSA and indicated inhibitors for 30 minutes, and then upper chambers were replaced in the lower chamber containing the indicated agonists. Results in A and C are means ± s.e. of three separate experiments. * P
    Figure Legend Snippet: The role of PI3K in synergistic chemotactic responses. ( A ) Sensitized BMMCs were preincubated with or without wortmannin (100 nM), in the upper chamber and placed in 600 μl HEPES buffer containing 0.5% BSA and wortmannin for 30 minutes. The upper chambers were then replaced in the lower chambers containing the indicated agonists. ( B ) Sensitized BMMCs were preincubated with indicated inhibitors for 20 minutes and then stimulated with the indicated agonists for 5 minutes. Following electrophoresis and membrane transfer, proteins were probed using anti-phospho-AKT (Ser473 -P ). To normalize protein loading, membranes were stripped and probed for β-actin, or alternatively identically loaded samples were probed for β-actin. The data shown are from three separate experiments, each repeated at least three times, with identical results, on separate cell preparations. ( C ) Sensitized BMMCs were preincubated with or without AS 252424 (3 μM) or IC 87114 (3 μM) in the upper chambers and placed in 600 μl HEPES buffer containing 0.5% BSA and indicated inhibitors for 30 minutes, and then upper chambers were replaced in the lower chamber containing the indicated agonists. Results in A and C are means ± s.e. of three separate experiments. * P

    Techniques Used: Electrophoresis

    14) Product Images from "Guiding neuronal development with in situ microfabrication"

    Article Title: Guiding neuronal development with in situ microfabrication

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0407204101

    Chemical and topographical features of microfabricated protein matrices. ( a ) Functional avidin microstructures. ( Left ) Biotin-binding capacity can be tuned by altering the composition of photocrosslinking solutions. The top strip shows differential interference contrast images of 3D structures produced by using solutions containing methylene blue and either 200 mg/ml avidin (i.e., 100% avidin), 100 mg/ml avidin plus 100 mg/ml BSA (50% avidin), 50 mg/ml avidin plus 150 mg/ml BSA (25% avidin), or 200 mg/ml BSA (0% avidin). After the structures were incubated in a fluorescein-biotin solution (1.2 μM) and rinsed, fluorescence imaging shows that photocrosslinked avidin retains the capacity to capture biotin (lower strip) with a binding capacity that scales essentially as the ratio of avidin in the fabrication solution. Plotted data represents signal along a horizontal line drawn through the four structures. (Scale bar: 10 μm.) ( Right ) Probing solution pH by using avidin microstructures. The matrices shown ( Left ) were subjected to cycling between acidic (pH 4 acetate) and neutral (pH 7 Hepes) solutions, causing reversible and reproducible modulation in the fluorescence intensity of fluorescein. Bar plots represent normalized signal from the 100% and 0% avidin structures, with signal averaged from (50 × 100 pixel) regions within the centers of the microstructures. From experiments in which two-photon fluorescence was used to probe labeled avidin lines (data not shown), biotin-binding capacities were estimated to be in the low- to mid-micromolar range (≈10 3 molecules per μm 2 of surface). ( b ) 3D protein lines created by multiphoton crosslinking of BSA. ( Left ) To construct functional banjo strings, the laser focus was first scanned along the surface of a coverslip (out of focus in the image), then into solution several micrometers (out-of-focus middle regions on the highest strings), and finally back to the coverslip to obtain a second attachment region. ( Right ) The third string is “plucked” by using a continuous-wave titanium/sapphire laser focus as an optical tweezer (arrow). (Scale bar: 10 μm.) ( c ) Scanning electron micrograph of a low-profile protein line fabricated underneath an NG108-15 neurite that is descending from the cell body (out of view, above image) to the glass substrate. (Scale bar: 1 μm.)
    Figure Legend Snippet: Chemical and topographical features of microfabricated protein matrices. ( a ) Functional avidin microstructures. ( Left ) Biotin-binding capacity can be tuned by altering the composition of photocrosslinking solutions. The top strip shows differential interference contrast images of 3D structures produced by using solutions containing methylene blue and either 200 mg/ml avidin (i.e., 100% avidin), 100 mg/ml avidin plus 100 mg/ml BSA (50% avidin), 50 mg/ml avidin plus 150 mg/ml BSA (25% avidin), or 200 mg/ml BSA (0% avidin). After the structures were incubated in a fluorescein-biotin solution (1.2 μM) and rinsed, fluorescence imaging shows that photocrosslinked avidin retains the capacity to capture biotin (lower strip) with a binding capacity that scales essentially as the ratio of avidin in the fabrication solution. Plotted data represents signal along a horizontal line drawn through the four structures. (Scale bar: 10 μm.) ( Right ) Probing solution pH by using avidin microstructures. The matrices shown ( Left ) were subjected to cycling between acidic (pH 4 acetate) and neutral (pH 7 Hepes) solutions, causing reversible and reproducible modulation in the fluorescence intensity of fluorescein. Bar plots represent normalized signal from the 100% and 0% avidin structures, with signal averaged from (50 × 100 pixel) regions within the centers of the microstructures. From experiments in which two-photon fluorescence was used to probe labeled avidin lines (data not shown), biotin-binding capacities were estimated to be in the low- to mid-micromolar range (≈10 3 molecules per μm 2 of surface). ( b ) 3D protein lines created by multiphoton crosslinking of BSA. ( Left ) To construct functional banjo strings, the laser focus was first scanned along the surface of a coverslip (out of focus in the image), then into solution several micrometers (out-of-focus middle regions on the highest strings), and finally back to the coverslip to obtain a second attachment region. ( Right ) The third string is “plucked” by using a continuous-wave titanium/sapphire laser focus as an optical tweezer (arrow). (Scale bar: 10 μm.) ( c ) Scanning electron micrograph of a low-profile protein line fabricated underneath an NG108-15 neurite that is descending from the cell body (out of view, above image) to the glass substrate. (Scale bar: 1 μm.)

    Techniques Used: Functional Assay, Avidin-Biotin Assay, Binding Assay, Stripping Membranes, Produced, Incubation, Fluorescence, Imaging, Labeling, Construct

    15) Product Images from "Alzheimer's Disease-Linked Mutations in Presenilin-1 Result in a Drastic Loss of Activity in Purified ?-Secretase Complexes"

    Article Title: Alzheimer's Disease-Linked Mutations in Presenilin-1 Result in a Drastic Loss of Activity in Purified ?-Secretase Complexes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0035133

    Generation of stable cell lines overexpressing all human γ-secretase components with FAD-linked PS1 variants. MEF PS1/2 −/− were stably co-transduced with lentiviral vectors carrying genes encoding hNCT-V5, Flag-hPEN2, hAPH1aL-HA and clones were isolated by limiting dilution to generate a cell line, designated as γ- PS1/2, that overexpresses high amount of the three subunits. γ- PS1/2 MEFs were further transduced with hPS1 variants harbouring FAD-linked mutations or mutations in the catalytic aspartate residue(s), or PS1-WT, and cloned. Each clone, derived form the γ- PS1/2, was conveniently named according to the mutation present in PS1 preceded by the symbol γ and followed by the number of the clone (γ-MEF) in order to distinguish them from wild-type MEF (WT MEF) and MEF PS1/2 −/− . Two clones per γ-secretase variant were selected for characterization. (A–B) Whole cell protein extracts of the different cell lines were prepared in 1% NP40-HEPES buffer, separated by SDS-PAGE on 4–12% Bis-Tris or 12% Tris-Glycine gels and analysed by immunostaining to detect the γ-secretase core components NCT (NCT164), PS1 (NTF, MAB1563; CTF; MAB5232), APH1aL-HA (3F10), and Flag-PEN2 (M2) (A), and endogenous APP (A8717) (B). β-Actin was used as a loading control. Each lane represents one selected clone. CTF : C-terminal fragment, FL : full-length, im. : immature NCT; m. : mature NCT, N : N-glycosylated, NTF : N-terminal fragment, O : O-glycosylated.
    Figure Legend Snippet: Generation of stable cell lines overexpressing all human γ-secretase components with FAD-linked PS1 variants. MEF PS1/2 −/− were stably co-transduced with lentiviral vectors carrying genes encoding hNCT-V5, Flag-hPEN2, hAPH1aL-HA and clones were isolated by limiting dilution to generate a cell line, designated as γ- PS1/2, that overexpresses high amount of the three subunits. γ- PS1/2 MEFs were further transduced with hPS1 variants harbouring FAD-linked mutations or mutations in the catalytic aspartate residue(s), or PS1-WT, and cloned. Each clone, derived form the γ- PS1/2, was conveniently named according to the mutation present in PS1 preceded by the symbol γ and followed by the number of the clone (γ-MEF) in order to distinguish them from wild-type MEF (WT MEF) and MEF PS1/2 −/− . Two clones per γ-secretase variant were selected for characterization. (A–B) Whole cell protein extracts of the different cell lines were prepared in 1% NP40-HEPES buffer, separated by SDS-PAGE on 4–12% Bis-Tris or 12% Tris-Glycine gels and analysed by immunostaining to detect the γ-secretase core components NCT (NCT164), PS1 (NTF, MAB1563; CTF; MAB5232), APH1aL-HA (3F10), and Flag-PEN2 (M2) (A), and endogenous APP (A8717) (B). β-Actin was used as a loading control. Each lane represents one selected clone. CTF : C-terminal fragment, FL : full-length, im. : immature NCT; m. : mature NCT, N : N-glycosylated, NTF : N-terminal fragment, O : O-glycosylated.

    Techniques Used: Stable Transfection, Transduction, Clone Assay, Isolation, Derivative Assay, Mutagenesis, Variant Assay, SDS Page, Immunostaining

    Aβ production in cell lines overexpressing human γ-secretase components with FAD-linked PS1 variants. WT MEF, γ-MEF and γ - PS1/2 were transduced with an APP-based substrate corresponding to the 99 C-terminal residues of human APP fused to the APP signal peptide in N-terminus (SPA4CT [36] ) and a Flag Tag in C-terminus. Cell proteins were extracted in 1% NP40-HEPES buffer, separated by SDS-PAGE on 12% Tris-Glycine gels and analysed by immunostaining with an antibody targeting the C-terminal part of APP (A8717) (A, C). Aβ1–40 and Aβ1–42 levels were also measured in the corresponding cell culture media (B, D). Data corresponds to three independent experiments (Mean ± SEM).
    Figure Legend Snippet: Aβ production in cell lines overexpressing human γ-secretase components with FAD-linked PS1 variants. WT MEF, γ-MEF and γ - PS1/2 were transduced with an APP-based substrate corresponding to the 99 C-terminal residues of human APP fused to the APP signal peptide in N-terminus (SPA4CT [36] ) and a Flag Tag in C-terminus. Cell proteins were extracted in 1% NP40-HEPES buffer, separated by SDS-PAGE on 12% Tris-Glycine gels and analysed by immunostaining with an antibody targeting the C-terminal part of APP (A8717) (A, C). Aβ1–40 and Aβ1–42 levels were also measured in the corresponding cell culture media (B, D). Data corresponds to three independent experiments (Mean ± SEM).

    Techniques Used: Transduction, FLAG-tag, SDS Page, Immunostaining, Cell Culture

    Enzymatic activity of partially purified γ-secretase complexes with FAD-linked PS1 mutants. (A) γ-Secretase activity assays performed with γ-MEF and γ - PS1/2 microsomal extracts prepared in 1% CHAPSO-HEPES buffer. Equal protein levels from the different extracts were diluted to 0.25% CHAPSO-HEPES buffer and incubated for 4 h at 37°C with lipids and 1 µM of recombinant human APP-based substrate (C100-Flag). Samples were analyzed by SDS-PAGE and immunostained with anti-Flag (M2) or anti-PS1 (MAB1563). The relative amounts of AICD-Flag generated in the reactions, reflecting γ-secretase activity, were estimated by densitometry. PS1 immunostaining was used to assess the amount of input material. (B) Equal amounts of microsomal proteins were immunoprecipitated overnight at 4°C with either anti-Flag M2 or anti-HA affinity resins, and submitted to a C100-His assay according to the same protocol as in (A). Protein samples were separated by SDS-PAGE and analysed by immunostaining for γ-secretase subunits ((NCT164 (NCT), MAB1563 (PS1-NTF), or UD1 (PEN2)). AICD-His cleavage products were immunostained with an anti-APP-CTF antibody (A8717). *Indicates a non-specific band corresponding to the IgG light chains. (C) Aβ1–40 and Aβ1–42 were quantified by sandwich ELISA and represented in pg/mL (left Y-axis) or in percentage (right Y-axis) of the mean of Aβ1–40 levels generated by the two wild-type clones. Aβ1–42/Aβ1–40 ratios are indicated on the top of the bars. The results were confirmed in three independent experiments and a representative dataset is shown.
    Figure Legend Snippet: Enzymatic activity of partially purified γ-secretase complexes with FAD-linked PS1 mutants. (A) γ-Secretase activity assays performed with γ-MEF and γ - PS1/2 microsomal extracts prepared in 1% CHAPSO-HEPES buffer. Equal protein levels from the different extracts were diluted to 0.25% CHAPSO-HEPES buffer and incubated for 4 h at 37°C with lipids and 1 µM of recombinant human APP-based substrate (C100-Flag). Samples were analyzed by SDS-PAGE and immunostained with anti-Flag (M2) or anti-PS1 (MAB1563). The relative amounts of AICD-Flag generated in the reactions, reflecting γ-secretase activity, were estimated by densitometry. PS1 immunostaining was used to assess the amount of input material. (B) Equal amounts of microsomal proteins were immunoprecipitated overnight at 4°C with either anti-Flag M2 or anti-HA affinity resins, and submitted to a C100-His assay according to the same protocol as in (A). Protein samples were separated by SDS-PAGE and analysed by immunostaining for γ-secretase subunits ((NCT164 (NCT), MAB1563 (PS1-NTF), or UD1 (PEN2)). AICD-His cleavage products were immunostained with an anti-APP-CTF antibody (A8717). *Indicates a non-specific band corresponding to the IgG light chains. (C) Aβ1–40 and Aβ1–42 were quantified by sandwich ELISA and represented in pg/mL (left Y-axis) or in percentage (right Y-axis) of the mean of Aβ1–40 levels generated by the two wild-type clones. Aβ1–42/Aβ1–40 ratios are indicated on the top of the bars. The results were confirmed in three independent experiments and a representative dataset is shown.

    Techniques Used: Activity Assay, Purification, Incubation, Recombinant, SDS Page, Generated, Immunostaining, Immunoprecipitation, Sandwich ELISA, Clone Assay

    16) Product Images from "The Density and Refractive Index of Adsorbing Protein Layers"

    Article Title: The Density and Refractive Index of Adsorbing Protein Layers

    Journal: Biophysical Journal

    doi: 10.1529/biophysj.103.030072

    The evolution of the adsorbed mass of ( a ) Fb, ( b ) IgG, ( c ) HSA, and ( d ) Lys layers as obtained from the QCM-D and OWLS techniques. The adsorption of proteins was tested from HEPES (with and without 6 M urea) using 40- and 80- μ g/mL concentrations on the hydrophilic TiO 2 and on the hydrophobic Teflon-AF.
    Figure Legend Snippet: The evolution of the adsorbed mass of ( a ) Fb, ( b ) IgG, ( c ) HSA, and ( d ) Lys layers as obtained from the QCM-D and OWLS techniques. The adsorption of proteins was tested from HEPES (with and without 6 M urea) using 40- and 80- μ g/mL concentrations on the hydrophilic TiO 2 and on the hydrophobic Teflon-AF.

    Techniques Used: QCM-D, Adsorption

    17) Product Images from "eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging"

    Article Title: eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging

    Journal: ACS Chemical Biology

    doi: 10.1021/acschembio.5b00211

    Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .
    Figure Legend Snippet: Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .

    Techniques Used: Binding Assay, Introduce, Concentration Assay

    18) Product Images from "mRNA Encoding a Bispecific Single Domain Antibody Construct Protects against Influenza A Virus Infection in Mice"

    Article Title: mRNA Encoding a Bispecific Single Domain Antibody Construct Protects against Influenza A Virus Infection in Mice

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2020.04.015

    Delivery of DOTAP/Cholesterol mRNA Lipid Nanoparticles via Intratracheal Instillation (A) Particle size analysis after incubating DOTAP/cholesterol mRNA lipoplexes in HEPES buffer or bronchoalveolar lavage fluid (BALF). BALB/c mice were i.t. administered with DOTAP/cholesterol particles formulated with different mRNA sequences (mRNA dose of 5 μg). (B) Graph and representative whole-body images showing expression levels of luciferase mRNA (5-methoxyuridine) in lungs of BALB/c mice measured via bioluminescence imaging at 6 h (n = 3 mice). DOTAP/cholesterol nanoparticles containing 1 mol% of the lipophilic dye DiR and packaged with mCherry mRNA (5-methoxyuridine) were i.t. administered, after which nanoparticle uptake (DiR fluorescence) and mRNA expression (mCherry protein) were evaluated in a variety of pulmonary cells subsets (n = 5 mice) at 6 and 24 h post administration. The flow cytometry gating strategy used to discriminate between pulmonary immune cell subsets can be found in the Figure S1 and was adopted from Knight et al. 45 PBS-instilled mice serve as negative controls. (C) Graph shows nanoparticle uptake in CD45 positive cells (immune cells) and CD45 negative cells (nonimmune cells). (D) Nanoparticle uptake in a variety of pulmonary immune cells subsets, including alveolar macrophages, CD103 + dendritic cells (CD103 + DCs), granulocytes, other subsets of monocytes and macrophages that are not encompassed by the other subsets (Mono/macrophage), interstitial macrophages, and CD11b + DCs. (E) Representative flow cytometry plots of nanoparticle uptake and mCherry mRNA expression in alveolar macrophages. The mean percentage of DiR-positive and mCherry-positive cells, together with the mean fluorescence intensity of each signal, are given in each flow plot. (F) 5 μg of FcγRIV VHH-M2e VHH or FcγRIV VHH-RSVF VHH (irrelevant mRNA) formulated in DOTAP/cholesterol particles or 50 μg FcγRIV VHH-M2e VHH protein was instilled i.t. in BALB/c mice. 6, 24, or 48 h after instillation, BALF was isolated and cells were removed from the BALF and the ability of His 6 -tagged proteins to bind to M2e was investigated in a peptide ELISA (see Figure S2 ). De absolute titers were calculated using the standard curve shown in Figure S2 . Graphs show mean ± SEM (n = 3 mice per group). Statistical analyses on datasets were performed by one-way ANOVA followed by Tukey’s post hoc test. Asterisks indicate statistical significance compared to negative control (∗p
    Figure Legend Snippet: Delivery of DOTAP/Cholesterol mRNA Lipid Nanoparticles via Intratracheal Instillation (A) Particle size analysis after incubating DOTAP/cholesterol mRNA lipoplexes in HEPES buffer or bronchoalveolar lavage fluid (BALF). BALB/c mice were i.t. administered with DOTAP/cholesterol particles formulated with different mRNA sequences (mRNA dose of 5 μg). (B) Graph and representative whole-body images showing expression levels of luciferase mRNA (5-methoxyuridine) in lungs of BALB/c mice measured via bioluminescence imaging at 6 h (n = 3 mice). DOTAP/cholesterol nanoparticles containing 1 mol% of the lipophilic dye DiR and packaged with mCherry mRNA (5-methoxyuridine) were i.t. administered, after which nanoparticle uptake (DiR fluorescence) and mRNA expression (mCherry protein) were evaluated in a variety of pulmonary cells subsets (n = 5 mice) at 6 and 24 h post administration. The flow cytometry gating strategy used to discriminate between pulmonary immune cell subsets can be found in the Figure S1 and was adopted from Knight et al. 45 PBS-instilled mice serve as negative controls. (C) Graph shows nanoparticle uptake in CD45 positive cells (immune cells) and CD45 negative cells (nonimmune cells). (D) Nanoparticle uptake in a variety of pulmonary immune cells subsets, including alveolar macrophages, CD103 + dendritic cells (CD103 + DCs), granulocytes, other subsets of monocytes and macrophages that are not encompassed by the other subsets (Mono/macrophage), interstitial macrophages, and CD11b + DCs. (E) Representative flow cytometry plots of nanoparticle uptake and mCherry mRNA expression in alveolar macrophages. The mean percentage of DiR-positive and mCherry-positive cells, together with the mean fluorescence intensity of each signal, are given in each flow plot. (F) 5 μg of FcγRIV VHH-M2e VHH or FcγRIV VHH-RSVF VHH (irrelevant mRNA) formulated in DOTAP/cholesterol particles or 50 μg FcγRIV VHH-M2e VHH protein was instilled i.t. in BALB/c mice. 6, 24, or 48 h after instillation, BALF was isolated and cells were removed from the BALF and the ability of His 6 -tagged proteins to bind to M2e was investigated in a peptide ELISA (see Figure S2 ). De absolute titers were calculated using the standard curve shown in Figure S2 . Graphs show mean ± SEM (n = 3 mice per group). Statistical analyses on datasets were performed by one-way ANOVA followed by Tukey’s post hoc test. Asterisks indicate statistical significance compared to negative control (∗p

    Techniques Used: Particle Size Analysis, Mouse Assay, Expressing, Luciferase, Imaging, Fluorescence, Flow Cytometry, Isolation, Peptide ELISA, Negative Control

    19) Product Images from "Effects of Carbon Dioxide Aerosols on the Viability of Escherichia coli during Biofilm Dispersal"

    Article Title: Effects of Carbon Dioxide Aerosols on the Viability of Escherichia coli during Biofilm Dispersal

    Journal: Scientific Reports

    doi: 10.1038/srep13766

    Confocal microscopic image of one-day grown E. coli biofilms stained with the BacLight stain (SYTO-9 and propidium iodide) after their respective treatments. ( a ) Untreated control biofilm. ( b ) HEPES soaked biofilm. ( c ) E. coli biofilm after treatment with Proteinase K and DNase I. ( d ) E. coli biofilm treated with CO 2 aerosols. The scale bars are 50 μm.
    Figure Legend Snippet: Confocal microscopic image of one-day grown E. coli biofilms stained with the BacLight stain (SYTO-9 and propidium iodide) after their respective treatments. ( a ) Untreated control biofilm. ( b ) HEPES soaked biofilm. ( c ) E. coli biofilm after treatment with Proteinase K and DNase I. ( d ) E. coli biofilm treated with CO 2 aerosols. The scale bars are 50 μm.

    Techniques Used: Staining

    SEM images showing the effects of a treatment with either CO 2 aerosols or hydrolytic enzymes on the E. coli biofilms grown for one day. ( a ) Untreated control chip showing the presence of an extensive E. coli biofilm on the Si surface. ( b ) Biofilm after CO 2 aerosol treatment. ( c ) Image of E. coli biofilm after being soaked in 25 mM HEPES buffer for two hours. ( d ) E. coli biofilm after treatment with HEPES buffer containing both Proteinase K and DNase I.
    Figure Legend Snippet: SEM images showing the effects of a treatment with either CO 2 aerosols or hydrolytic enzymes on the E. coli biofilms grown for one day. ( a ) Untreated control chip showing the presence of an extensive E. coli biofilm on the Si surface. ( b ) Biofilm after CO 2 aerosol treatment. ( c ) Image of E. coli biofilm after being soaked in 25 mM HEPES buffer for two hours. ( d ) E. coli biofilm after treatment with HEPES buffer containing both Proteinase K and DNase I.

    Techniques Used: Chromatin Immunoprecipitation

    20) Product Images from "eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging"

    Article Title: eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn2+ Imaging

    Journal: ACS Chemical Biology

    doi: 10.1021/acschembio.5b00211

    Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .
    Figure Legend Snippet: Design and Zn 2+ binding properties of eZinCh-2. (A) Crystal structure of green fluorescent protein (PDB code: 1GFL) 33 showing the positions that were used to introduce cysteine or histidine residues. (B) eZinCh-2 sensor design containing a Cys 2 His 2 binding pocket on the dimerization interface of both fluorescent proteins. (C) Emission spectra of eZinCh-2 before (empty) and after (Zn 2+ saturated) addtion of Zn 2+ . (D–G) Zn 2+ titrations of eZinCh-2 at different pH’s, showing the emission ratio of citrine over cerulean as a function of Zn 2+ concentration. To obtain picomolar to micromolar free Zn 2+ concentrations, HEDTA (squares) and different amounts of EGTA (5 mM and 1 mM, circles and triangles, respectively) were used as buffering systems ( Tables S2–S5 ). Solid lines represent a fit assuming a 1:1 binding event, yielding K d ’s of 256 nM (pH 6.0), 1.03 nM (pH 7.1), 10 pM (pH 7.8), and 5 pM (pH 8.0). Measurements were performed in 150 mM MES (pH 6.0), 150 mM HEPES (pH 7.1), or 50 mM Tris (pH 7.8 and 8.0) and 100 mM NaCl, 10% (v/v) glycerol, 0.01% Tween and 1 mM DTT at 20 °C. (H) Emission ratio of eZinCh-2 before (gray bars) and after (white bars) the addition of Pb 2+ , Fe 2+ , Cu 2+ , Co 2+ , or Cd 2+ (all 20 μM) or Mg 2+ or Ca 2+ (both 0.5 mM) in the presence of 10 μM TPEN. The black bars show the emission ratio upon subsequent addition of 20 μM Zn 2+ .

    Techniques Used: Binding Assay, Introduce, Concentration Assay

    21) Product Images from "In Vitro Activity of Acanthamoeba castellanii on Human Platelets and Erythrocytes ▿"

    Article Title: In Vitro Activity of Acanthamoeba castellanii on Human Platelets and Erythrocytes ▿

    Journal:

    doi: 10.1128/IAI.00202-08

    Time courses of the increase in [Ca 2+ ] i in human platelets loaded with 3 μM Fura 2-AM and suspended in Tyrode-HEPES buffer at a density of 100,000 platelets μl −1 at 37°C after stimulation with 80 μl of fPBS
    Figure Legend Snippet: Time courses of the increase in [Ca 2+ ] i in human platelets loaded with 3 μM Fura 2-AM and suspended in Tyrode-HEPES buffer at a density of 100,000 platelets μl −1 at 37°C after stimulation with 80 μl of fPBS

    Techniques Used:

    Increase in [Ca 2+ ] i in human platelets loaded with 3 μM Fura 2-AM and suspended in Tyrode-HEPES buffer at a density of 100,000 platelets μl −1 at 37°C after stimulation with 80 μl of PBS buffer (control),
    Figure Legend Snippet: Increase in [Ca 2+ ] i in human platelets loaded with 3 μM Fura 2-AM and suspended in Tyrode-HEPES buffer at a density of 100,000 platelets μl −1 at 37°C after stimulation with 80 μl of PBS buffer (control),

    Techniques Used:

    22) Product Images from "Rab13 Traffics on Vesicles Independent of Prenylation *"

    Article Title: Rab13 Traffics on Vesicles Independent of Prenylation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M116.722298

    Rab13 resists membrane extraction by GDI. A , HEK-293T cell homogenates were spun for 30 min at 200,000 × g , and the resulting pellet was resuspended in HEPES buffer and incubated without or with increasing concentrations of purified myc-His-GDI
    Figure Legend Snippet: Rab13 resists membrane extraction by GDI. A , HEK-293T cell homogenates were spun for 30 min at 200,000 × g , and the resulting pellet was resuspended in HEPES buffer and incubated without or with increasing concentrations of purified myc-His-GDI

    Techniques Used: Incubation, Purification

    Related Articles

    In Vitro:

    Article Title: The Growth and Tumor Suppressors NORE1A and RASSF1A Are Targets for Calpain-Mediated Proteolysis
    Article Snippet: .. Preparation of cell extracts and in vitro cleavage Cells growing in tissue culture were extracted in the Buffer A: 30 mM HEPES, pH 7.4, 20 mM KCl, 1 mM NaVO4 , 20 mM NaF, 20 mM β-glycerophosphate, 7.5 mM MgCl2 , 1% Triton X-100, 2 mM EGTA, 0.1% 2-mercaptoethanol and protease inhibitor cocktail for mammalian cells and tissues, Sigma Cat # P8340 at 0.3% (v/v). ..

    Protease Inhibitor:

    Article Title: The Growth and Tumor Suppressors NORE1A and RASSF1A Are Targets for Calpain-Mediated Proteolysis
    Article Snippet: .. Preparation of cell extracts and in vitro cleavage Cells growing in tissue culture were extracted in the Buffer A: 30 mM HEPES, pH 7.4, 20 mM KCl, 1 mM NaVO4 , 20 mM NaF, 20 mM β-glycerophosphate, 7.5 mM MgCl2 , 1% Triton X-100, 2 mM EGTA, 0.1% 2-mercaptoethanol and protease inhibitor cocktail for mammalian cells and tissues, Sigma Cat # P8340 at 0.3% (v/v). ..

    Concentration Assay:

    Article Title: Yeast Frataxin Is Stabilized by Low Salt Concentrations: Cold Denaturation Disentangles Ionic Strength Effects from Specific Interactions
    Article Snippet: .. Samples were prepared using a Yfh1 concentration of 10 µM in 10 mM HEPES buffer at pH 7.5 and with a variety of salts: NaCl (Sigma-Adrich), KCl (Aldrich), MgCl2 (Aldrich), CaCl2 (J.T.Baker), NaF (May & Baker), NaH2 PO4 (Carlo Erba), Na2 SO4 (Sigma-Aldrich) and NaI (Carlo Erba). ..

    Nuclear Magnetic Resonance:

    Article Title: Metal Ions-Stimulated Iron Oxidation in Hydroxylases Facilitates Stabilization of HIF-1? Protein
    Article Snippet: .. The 1 H NMR spectra were recorded on a Varian UNITY INOVA spectrometer at 400 MHz immediately after the dehydroascorbate (DHA) (Sigma) was dissolved in 50mM HEPES buffer, pH 7.4 (Sigma). .. HEPES buffer was prepared in D2 O and contained 0.75 wt% sodium-2,2,3,3-tetradeuterio-3-trimethylsilylpropionate as an internal standard (Sigma).

    other:

    Article Title: Low affinity PEGylated hemoglobin from Trematomus bernacchii, a model for hemoglobin-based blood substitutes
    Article Snippet: Reagents 2-iminothiolane (IMT), HEPES buffer, ethylendiaminotetraacetic acid (EDTA), phosphate buffered saline solution (PBS), sodium ascorbate, catalase and the reagents for the Hayashi enzymatic reducing system [ ] were purchased from Sigma Chemical Co. (St. Louis, MO, U.S.A.) and maleimido polyethylene glycol (MAL-PEG) (5600 Da-MW) from Nektar Molecule Engineering (Nektar Therapeutics, San Carlos, CA, U.S.A.).

    Software:

    Article Title: Extracellular Acidification Inhibits the ROS-Dependent Formation of Neutrophil Extracellular Traps
    Article Snippet: .. Neutrophils (2 × 106 /ml) in bicarbonate- or HEPES-buffered medium containing 60 µM luminol (Sigma-Aldrich) were transferred to iIC-coated or uncoated (PMA, medium control) 96-well LUMITRAC™600 plates (Greiner Bio-One) and ROS-dependent chemiluminescence was analyzed using an infinite 200 reader and the Tecan i-control 1.7 Software (Tecan, Germany). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Millipore hepes electrochemistry buffer
    <t>p58C</t> 266-464 participates in redox switching on DNA. The cartoon (top left) depicts p58C DNA binding and redox switching on an Au electrode. (Bottom left) CV scan of electrochemically unaltered p58C 266-464 . (Right) bulk oxidation (above) of p58C 266-464 and subsequent CV scans (below). This construct displays similar electrochemical behavior to p58C 272-464 . All electrochemistry was performed in anaerobic conditions with 40 μM [4Fe4S] p58C 266-464 in 20 mM <t>HEPES</t> (pH 7.2), 75 mM NaCl. CV was performed at 100 mV/s scan rate.
    Hepes Electrochemistry Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hepes electrochemistry buffer/product/Millipore
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hepes electrochemistry buffer - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Millipore hepes buffered serum supplemented dmem
    Entry phase and dose response. (A) Cell cultures (2 × 10 5 cells/well) in 96-well strip plates were switched to <t>HEPES-buffered</t> serum-supplemented <t>DMEM,</t> cooled on ice for 30 min, and infected at 4°C with 6 × 10 3 PFU of hr R3 per well. Cells were kept at 4°C for an additional 1 h before they were warmed to 23°C for 30 min and 37°C for the rest of the experiment. At 1-h intervals immediately following infection, strips of wells were treated for 1-h periods with 50 μM EB in serum-free DMEM and returned to regular medium. Before and after each treatment, the cells were rinsed three times with serum-free DMEM and serum-supplemented DMEM, respectively. The number of lacZ + cells was scored 11 h postinfection (●) and normalized to the number counted in mock-treated controls (maximally 187 ± 20 [ n = 3]). Separate strips of infected control cells were fixed and stained immediately following each mock treatment to monitor β-galactosidase expression over time (○). Data points represent means of triplicate measurements with standard errors of the means. (B) Cell cultures (2 × 10 5 cells/well) were switched to serum-free DMEM, cooled on ice, and infected at 4°C with 2.4 × 10 3 PFU of hr R3 per well. After infection, the cells were rinsed and treated with EB (●) or EBX (○) for 1 h at 4°C and for additional 30-min periods at 23 and 37°C. Triplicate counts of lacZ + cells were performed 6 h later (all points are means and standard errors of means; control score, 141 ± 5.9).
    Hepes Buffered Serum Supplemented Dmem, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hepes buffered serum supplemented dmem/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hepes buffered serum supplemented dmem - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Millipore divalent cation free hepes tyrode buffer
    Activation-independent platelet aggregation mediated by multimeric VWF or isolated VWF A1 domain. Perfusion over immobilized VWF of washed blood cells suspended in <t>Hepes/Tyrode</t> buffer, pH 7.4 (see legend to ). In the presence of soluble multimeric
    Divalent Cation Free Hepes Tyrode Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/divalent cation free hepes tyrode buffer/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    divalent cation free hepes tyrode buffer - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Millipore hepes naoh buffer
    The effects of pH and temperature on the activities and stabilities of Teth514_1788 and Teth514_1789. ( A ) The thermal stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at a temperature range between 30–90°C for 30 min. ( B ) The pH stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at 4°C for 24 h. ( C ) The pH dependence on the phosphorolytic and synthetic activities of Teth514_1788 (44 n m ) in 40 m m sodium citrate (pH 3.0–5.5), bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane-HCl (pH 5.5–7.0), <t>HEPES-NaOH</t> (pH 7.0–8.5), and glycine-NaOH (pH 8.5–10.5). ( D ) The pH dependence of the phosphorolytic and synthetic activities of Teth514_1789 (32 n m ) in the same buffers listed in Panel C. In Panels C and D, the closed and open symbols represent the synthetic and phosphorolytic activities, respectively.
    Hepes Naoh Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hepes naoh buffer/product/Millipore
    Average 91 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    hepes naoh buffer - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    p58C 266-464 participates in redox switching on DNA. The cartoon (top left) depicts p58C DNA binding and redox switching on an Au electrode. (Bottom left) CV scan of electrochemically unaltered p58C 266-464 . (Right) bulk oxidation (above) of p58C 266-464 and subsequent CV scans (below). This construct displays similar electrochemical behavior to p58C 272-464 . All electrochemistry was performed in anaerobic conditions with 40 μM [4Fe4S] p58C 266-464 in 20 mM HEPES (pH 7.2), 75 mM NaCl. CV was performed at 100 mV/s scan rate.

    Journal: PLoS ONE

    Article Title: Functional and structural similarity of human DNA primase [4Fe4S] cluster domain constructs

    doi: 10.1371/journal.pone.0209345

    Figure Lengend Snippet: p58C 266-464 participates in redox switching on DNA. The cartoon (top left) depicts p58C DNA binding and redox switching on an Au electrode. (Bottom left) CV scan of electrochemically unaltered p58C 266-464 . (Right) bulk oxidation (above) of p58C 266-464 and subsequent CV scans (below). This construct displays similar electrochemical behavior to p58C 272-464 . All electrochemistry was performed in anaerobic conditions with 40 μM [4Fe4S] p58C 266-464 in 20 mM HEPES (pH 7.2), 75 mM NaCl. CV was performed at 100 mV/s scan rate.

    Article Snippet: All p58C constructs were buffer exchanged into HEPES electrochemistry buffer (20 mM HEPES (pH 7.2), 75 mM NaCl) using Amicon ultra centrifugal filters (0.5 mL, 3 kDa MWCO) (Millipore Sigma).

    Techniques: Binding Assay, Construct

    Entry phase and dose response. (A) Cell cultures (2 × 10 5 cells/well) in 96-well strip plates were switched to HEPES-buffered serum-supplemented DMEM, cooled on ice for 30 min, and infected at 4°C with 6 × 10 3 PFU of hr R3 per well. Cells were kept at 4°C for an additional 1 h before they were warmed to 23°C for 30 min and 37°C for the rest of the experiment. At 1-h intervals immediately following infection, strips of wells were treated for 1-h periods with 50 μM EB in serum-free DMEM and returned to regular medium. Before and after each treatment, the cells were rinsed three times with serum-free DMEM and serum-supplemented DMEM, respectively. The number of lacZ + cells was scored 11 h postinfection (●) and normalized to the number counted in mock-treated controls (maximally 187 ± 20 [ n = 3]). Separate strips of infected control cells were fixed and stained immediately following each mock treatment to monitor β-galactosidase expression over time (○). Data points represent means of triplicate measurements with standard errors of the means. (B) Cell cultures (2 × 10 5 cells/well) were switched to serum-free DMEM, cooled on ice, and infected at 4°C with 2.4 × 10 3 PFU of hr R3 per well. After infection, the cells were rinsed and treated with EB (●) or EBX (○) for 1 h at 4°C and for additional 30-min periods at 23 and 37°C. Triplicate counts of lacZ + cells were performed 6 h later (all points are means and standard errors of means; control score, 141 ± 5.9).

    Journal: Journal of Virology

    Article Title: Modified FGF4 Signal Peptide Inhibits Entry of Herpes Simplex Virus Type 1

    doi: 10.1128/JVI.75.6.2634-2645.2001

    Figure Lengend Snippet: Entry phase and dose response. (A) Cell cultures (2 × 10 5 cells/well) in 96-well strip plates were switched to HEPES-buffered serum-supplemented DMEM, cooled on ice for 30 min, and infected at 4°C with 6 × 10 3 PFU of hr R3 per well. Cells were kept at 4°C for an additional 1 h before they were warmed to 23°C for 30 min and 37°C for the rest of the experiment. At 1-h intervals immediately following infection, strips of wells were treated for 1-h periods with 50 μM EB in serum-free DMEM and returned to regular medium. Before and after each treatment, the cells were rinsed three times with serum-free DMEM and serum-supplemented DMEM, respectively. The number of lacZ + cells was scored 11 h postinfection (●) and normalized to the number counted in mock-treated controls (maximally 187 ± 20 [ n = 3]). Separate strips of infected control cells were fixed and stained immediately following each mock treatment to monitor β-galactosidase expression over time (○). Data points represent means of triplicate measurements with standard errors of the means. (B) Cell cultures (2 × 10 5 cells/well) were switched to serum-free DMEM, cooled on ice, and infected at 4°C with 2.4 × 10 3 PFU of hr R3 per well. After infection, the cells were rinsed and treated with EB (●) or EBX (○) for 1 h at 4°C and for additional 30-min periods at 23 and 37°C. Triplicate counts of lacZ + cells were performed 6 h later (all points are means and standard errors of means; control score, 141 ± 5.9).

    Article Snippet: In some experiments, aliquots of diluted virus were first dialyzed (Spectra/Por; molecular weight cutoff, 12,000 to 14,000) overnight at 4°C against a 60-fold excess volume of HEPES-buffered serum-supplemented DMEM or forced by syringe through 0.22-μm-pore-size membranes (Millex-GV; Millipore) before the remaining infectious virus was assayed.

    Techniques: Stripping Membranes, Infection, Staining, Expressing

    Effect of pretreating cells with EB on subsequent virus infection. Cell cultures (2 × 10 5 cells/well) in microtiter wells were switched to serum-free HEPES-buffered DMEM and incubated for 30 min at 37°C. A first set of cells were then pretreated for 1 h with EB, rinsed three times, and infected for 1 h with 7,400 PFU of hr R3 per well before they were returned to regular medium. Rinses and infections were carried out in the absence of EB in either serum-free (Δ) or serum-supplemented (▴) DMEM. A second set of cells was pretreated for 1 h with (●) or without (○) EB and infected for 1 h with 7,400 PFU of hr R3 per well in the presence of EB before they were returned to regular medium. Triplicate counts of lacZ + cells were performed 8 h postinfection (all points are means with standard errors of the means; control score, 265 ± 13 [ n = 3]).

    Journal: Journal of Virology

    Article Title: Modified FGF4 Signal Peptide Inhibits Entry of Herpes Simplex Virus Type 1

    doi: 10.1128/JVI.75.6.2634-2645.2001

    Figure Lengend Snippet: Effect of pretreating cells with EB on subsequent virus infection. Cell cultures (2 × 10 5 cells/well) in microtiter wells were switched to serum-free HEPES-buffered DMEM and incubated for 30 min at 37°C. A first set of cells were then pretreated for 1 h with EB, rinsed three times, and infected for 1 h with 7,400 PFU of hr R3 per well before they were returned to regular medium. Rinses and infections were carried out in the absence of EB in either serum-free (Δ) or serum-supplemented (▴) DMEM. A second set of cells was pretreated for 1 h with (●) or without (○) EB and infected for 1 h with 7,400 PFU of hr R3 per well in the presence of EB before they were returned to regular medium. Triplicate counts of lacZ + cells were performed 8 h postinfection (all points are means with standard errors of the means; control score, 265 ± 13 [ n = 3]).

    Article Snippet: In some experiments, aliquots of diluted virus were first dialyzed (Spectra/Por; molecular weight cutoff, 12,000 to 14,000) overnight at 4°C against a 60-fold excess volume of HEPES-buffered serum-supplemented DMEM or forced by syringe through 0.22-μm-pore-size membranes (Millex-GV; Millipore) before the remaining infectious virus was assayed.

    Techniques: Infection, Incubation

    Activation-independent platelet aggregation mediated by multimeric VWF or isolated VWF A1 domain. Perfusion over immobilized VWF of washed blood cells suspended in Hepes/Tyrode buffer, pH 7.4 (see legend to ). In the presence of soluble multimeric

    Journal:

    Article Title: Activation-independent platelet adhesion and aggregation under elevated shear stress

    doi: 10.1182/blood-2006-04-011551

    Figure Lengend Snippet: Activation-independent platelet aggregation mediated by multimeric VWF or isolated VWF A1 domain. Perfusion over immobilized VWF of washed blood cells suspended in Hepes/Tyrode buffer, pH 7.4 (see legend to ). In the presence of soluble multimeric

    Article Snippet: This procedure was repeated twice, each time using half the amount of apyrase, and after the final centrifugation the cells were suspended in divalent cation-free Hepes/Tyrode buffer, pH 7.4, containing 50 mg/mL bovine serum albumin (BSA; Calbiochem, La Jolla, CA).

    Techniques: Activation Assay, Isolation

    The effects of pH and temperature on the activities and stabilities of Teth514_1788 and Teth514_1789. ( A ) The thermal stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at a temperature range between 30–90°C for 30 min. ( B ) The pH stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at 4°C for 24 h. ( C ) The pH dependence on the phosphorolytic and synthetic activities of Teth514_1788 (44 n m ) in 40 m m sodium citrate (pH 3.0–5.5), bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane-HCl (pH 5.5–7.0), HEPES-NaOH (pH 7.0–8.5), and glycine-NaOH (pH 8.5–10.5). ( D ) The pH dependence of the phosphorolytic and synthetic activities of Teth514_1789 (32 n m ) in the same buffers listed in Panel C. In Panels C and D, the closed and open symbols represent the synthetic and phosphorolytic activities, respectively.

    Journal: PLoS ONE

    Article Title: Discovery of Two β-1,2-Mannoside Phosphorylases Showing Different Chain-Length Specificities from Thermoanaerobacter sp. X-514

    doi: 10.1371/journal.pone.0114882

    Figure Lengend Snippet: The effects of pH and temperature on the activities and stabilities of Teth514_1788 and Teth514_1789. ( A ) The thermal stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at a temperature range between 30–90°C for 30 min. ( B ) The pH stabilities of 360 n m Teth514_1788 (closed symbols) and 320 n m Teth514_1789 (open symbols) at 4°C for 24 h. ( C ) The pH dependence on the phosphorolytic and synthetic activities of Teth514_1788 (44 n m ) in 40 m m sodium citrate (pH 3.0–5.5), bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane-HCl (pH 5.5–7.0), HEPES-NaOH (pH 7.0–8.5), and glycine-NaOH (pH 8.5–10.5). ( D ) The pH dependence of the phosphorolytic and synthetic activities of Teth514_1789 (32 n m ) in the same buffers listed in Panel C. In Panels C and D, the closed and open symbols represent the synthetic and phosphorolytic activities, respectively.

    Article Snippet: After washing with buffer A containing 22 mm imidazole and subsequently eluting the proteins with a 22–400 mm imidazole linear gradient in buffer A, the fractions containing the recombinant protein were pooled, dialyzed against 10 mm HEPES-NaOH buffer (pH 7.0), and concentrated (AMICON Ultra-15 filter; Millipore, Billerica, MA, USA).

    Techniques: