Review




Structured Review

Janvier Labs helicobacter hepaticus
Helicobacter Hepaticus, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/Janvier Labs
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars

Images



Similar Products

95
ATCC acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261
Acttttatgtcccctgttgact 514 493 Beta 2 Microglobulin S Atgatgctgcttacatgtctc 261, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261/product/ATCC
Average 95 stars, based on 1 article reviews
acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier

86
ATCC helicobacter hepaticus hh3b1
Helicobacter Hepaticus Hh3b1, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus hh3b1/product/ATCC
Average 86 stars, based on 1 article reviews
helicobacter hepaticus hh3b1 - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

86
DSMZ helicobacter hepaticus infection
Helicobacter Hepaticus Infection, supplied by DSMZ, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus infection/product/DSMZ
Average 86 stars, based on 1 article reviews
helicobacter hepaticus infection - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

86
Janvier Labs helicobacter hepaticus
Helicobacter Hepaticus, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/Janvier Labs
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

86
DSMZ helicobacter hepaticus
Helicobacter Hepaticus, supplied by DSMZ, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/DSMZ
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

86
XpressBio helicobacter hepaticus
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus, supplied by XpressBio, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/XpressBio
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

95
ATCC accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Accession Nucleic Amino Species Source Number Acid Acid Helicobacter Hepaticus Atcc 51449, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449/product/ATCC
Average 95 stars, based on 1 article reviews
accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier

86
Envigo helicobacter hepaticus suspension
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus Suspension, supplied by Envigo, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus suspension/product/Envigo
Average 86 stars, based on 1 article reviews
helicobacter hepaticus suspension - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier

95
ATCC helicobacter hepaticus atcc 51449
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus Atcc 51449, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus atcc 51449/product/ATCC
Average 95 stars, based on 1 article reviews
helicobacter hepaticus atcc 51449 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier

Image Search Results


The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , Helicobacter spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , Helicobacter spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Multiplex Assay, Real-time Polymerase Chain Reaction, Plasmid Preparation, Control, Reverse Transcription Polymerase Chain Reaction, Amplification, Generated, Fluorescence

Analytical specificity of the mRT-PCR assay with 42 strains.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: Analytical specificity of the mRT-PCR assay with 42 strains.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Virus

Results of single and multiple infections in 102 clinical samples.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: Results of single and multiple infections in 102 clinical samples.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Infection