Review





Similar Products

acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261  (ATCC)
95
ATCC acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261
Acttttatgtcccctgttgact 514 493 Beta 2 Microglobulin S Atgatgctgcttacatgtctc 261, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261/product/ATCC
Average 95 stars, based on 1 article reviews
acttttatgtcccctgttgact 514 493 beta 2 microglobulin s atgatgctgcttacatgtctc 261 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier
helicobacter hepaticus hh3b1  (ATCC)
86
ATCC helicobacter hepaticus hh3b1
Helicobacter Hepaticus Hh3b1, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus hh3b1/product/ATCC
Average 86 stars, based on 1 article reviews
helicobacter hepaticus hh3b1 - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
helicobacter hepaticus infection  (DSMZ)
86
DSMZ helicobacter hepaticus infection
Helicobacter Hepaticus Infection, supplied by DSMZ, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus infection/product/DSMZ
Average 86 stars, based on 1 article reviews
helicobacter hepaticus infection - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
helicobacter hepaticus  (Janvier Labs)
86
Janvier Labs helicobacter hepaticus
Helicobacter Hepaticus, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/Janvier Labs
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
helicobacter hepaticus  (DSMZ)
86
DSMZ helicobacter hepaticus
Helicobacter Hepaticus, supplied by DSMZ, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/DSMZ
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
helicobacter hepaticus  (XpressBio)
86
XpressBio helicobacter hepaticus
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus, supplied by XpressBio, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus/product/XpressBio
Average 86 stars, based on 1 article reviews
helicobacter hepaticus - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449  (ATCC)
95
ATCC accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Accession Nucleic Amino Species Source Number Acid Acid Helicobacter Hepaticus Atcc 51449, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449/product/ATCC
Average 95 stars, based on 1 article reviews
accession nucleic amino species source number acid acid helicobacter hepaticus atcc 51449 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier
helicobacter hepaticus suspension  (Envigo)
86
Envigo helicobacter hepaticus suspension
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus Suspension, supplied by Envigo, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus suspension/product/Envigo
Average 86 stars, based on 1 article reviews
helicobacter hepaticus suspension - by Bioz Stars, 2025-03
86/100 stars
  Buy from Supplier
helicobacter hepaticus atcc 51449  (ATCC)
95
ATCC helicobacter hepaticus atcc 51449
The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , <t>Helicobacter</t> spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.
Helicobacter Hepaticus Atcc 51449, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/helicobacter hepaticus atcc 51449/product/ATCC
Average 95 stars, based on 1 article reviews
helicobacter hepaticus atcc 51449 - by Bioz Stars, 2025-03
95/100 stars
  Buy from Supplier

Image Search Results


The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , Helicobacter spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: The detection limit of the multiplex real-time PCR (mRT-PCR) assay. The detection limit of the assay was evaluated using 10-fold serially diluted plasmid DNA. Each serially diluted control DNA, ranging from 10 6 copies to 1 copy per reaction, was used to determine the detection limit of the RT-PCR assay. In the RT-PCR assay, the amplification curve of the specific probe for detecting SeV (A) , Mycoplama spp. (B) , R. pneumotropicus (C) , R. heylii (D) , Helicobacter spp. (E) , MNV (F) , MHV (G) , Salmonella spp. (H) , S. aureus (I) , S. moniliformis (J) , C. kutscheri (K) , and P. aeruginosa (L) is shown. The overall detection limit of this assay for each control DNA ranged from approximately 1 to 100 copy DNA per reaction. C T was plotted against the input of the quantity of each DNA (repeated 10 times). The linearity was generated by plotting the log quantity of each DNA versus the corresponding C T value, and the coefficient of determination of the linear regression was 0.993–1.0, with a slope ranging from −3.193 to −3.934. The fluorescence intensity is displayed on the Y -axis ( R 2 = reporter signal/passive reference signal). RFU, relative fluorescence unit; R 2 , fluorescence units.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Multiplex Assay, Real-time Polymerase Chain Reaction, Plasmid Preparation, Control, Reverse Transcription Polymerase Chain Reaction, Amplification, Generated, Fluorescence

Analytical specificity of the mRT-PCR assay with 42 strains.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: Analytical specificity of the mRT-PCR assay with 42 strains.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Virus

Results of single and multiple infections in 102 clinical samples.

Journal: Frontiers in Veterinary Science

Article Title: Performance of three multiplex real-time PCR assays for simultaneous detection of 12 infectious pathogens in mice affected with respiratory and digestive diseases

doi: 10.3389/fvets.2024.1421427

Figure Lengend Snippet: Results of single and multiple infections in 102 clinical samples.

Article Snippet: 5 , Helicobacter hepaticus , Xpressbio , Tissue , N/A , N/A , N/A , N/A , 25.28 , N/A , N/A , N/A , N/A , N/A , N/A , N/A.

Techniques: Infection