hd ecodry infusion cloning  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    In Fusion HD EcoDry Cloning System
    Description:
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    Catalog Number:
    639688
    Price:
    None
    Size:
    96 Rxns
    Category:
    Legacy cloning kits and systems Legacy cloning products Cloning
    Buy from Supplier


    Structured Review

    TaKaRa hd ecodry infusion cloning
    While we continue to maintain our legacy In Fusion HD Cloning kits and systems we strongly recommend that you switch to the more recently developed In Fusion HD Cloning Plus products and the In Fusion HD EcoDry Cloning Plus products These newer versions provide the same robustness and reliability you have come to expect from In Fusion technology but have been optimized to include all the necessary components for your cloning workflow thereby providing more accurate and efficient results
    https://www.bioz.com/result/hd ecodry infusion cloning/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hd ecodry infusion cloning - by Bioz Stars, 2020-07
    94/100 stars

    Related Products / Commonly Used Together

    biorad thermal cycler

    Images

    Related Articles

    Clone Assay:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Article Title: Human Sialic acid O-acetyl esterase (SIAE) – mediated changes in sensitivity to etoposide in a medulloblastoma cell line
    Article Snippet: .. HD EcoDry InFusion cloning (Clontech) was then used to insert amplified genes into linearized constructs by incubation in a BioRad Thermal cycler for 15 minutes at 37 °C, followed by 15 minutes at 50 °C. .. The resulting DNA was transformed into Stellar competent E. coli (Clontech) according to manufacturer’s instructions.

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: .. Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. Full-length LXRα and RXRα were cloned from cDNA fragments (Source BioScience clone IRATp970C0271, Gene ID: 7376 and clone IOH39435, Gene ID: 6256) into pBIND vector (Promega).

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Article Title: Xenopus Nanos1 is required to prevent endoderm gene expression and apoptosis in primordial germ cells
    Article Snippet: .. VegT 3′UTR (296 nt, 2336-2631) containing the PBE (UGUAAAUA) was subcloned downstream of the DsRED open reading frame to produce DsRED- VegT PBE-DS3′UTR (In-Fusion HD EcoDry Cloning System, Clontech). .. DsRED- VegT PBE-DS3′UTR mutant was made by changing 3 nt within the PBE site (mutant PBE, UAAAAAAA) using the QuikChange II site-directed mutagenesis kit.

    Transfection:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Amplification:

    Article Title: Human Sialic acid O-acetyl esterase (SIAE) – mediated changes in sensitivity to etoposide in a medulloblastoma cell line
    Article Snippet: .. HD EcoDry InFusion cloning (Clontech) was then used to insert amplified genes into linearized constructs by incubation in a BioRad Thermal cycler for 15 minutes at 37 °C, followed by 15 minutes at 50 °C. .. The resulting DNA was transformed into Stellar competent E. coli (Clontech) according to manufacturer’s instructions.

    Mutagenesis:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Incubation:

    Article Title: Human Sialic acid O-acetyl esterase (SIAE) – mediated changes in sensitivity to etoposide in a medulloblastoma cell line
    Article Snippet: .. HD EcoDry InFusion cloning (Clontech) was then used to insert amplified genes into linearized constructs by incubation in a BioRad Thermal cycler for 15 minutes at 37 °C, followed by 15 minutes at 50 °C. .. The resulting DNA was transformed into Stellar competent E. coli (Clontech) according to manufacturer’s instructions.

    Construct:

    Article Title: Human Sialic acid O-acetyl esterase (SIAE) – mediated changes in sensitivity to etoposide in a medulloblastoma cell line
    Article Snippet: .. HD EcoDry InFusion cloning (Clontech) was then used to insert amplified genes into linearized constructs by incubation in a BioRad Thermal cycler for 15 minutes at 37 °C, followed by 15 minutes at 50 °C. .. The resulting DNA was transformed into Stellar competent E. coli (Clontech) according to manufacturer’s instructions.

    Polymerase Chain Reaction:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Generated:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Electrophoretic Mobility Shift Assay:

    Article Title: Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice
    Article Snippet: .. Electrophoretic mobility shift assay WT human MeCP2 and MeCP2-R306C (amino acids 274–340) were cloned in-frame to an N-terminal GST tag (GST-MeCP2 pGEX-5x3) using the In-Fusion EcoDry Cloning system (Clontech, Mountain View, CA), and C-terminal point mutations were generated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). .. Recombinant proteins were expressed in BL21(DE3) E. coli cells following 1 mM IPTG induction and purified using Glutathione Sepharose 4B beads (GE Healthcare) before elution into glutathione buffer (50 mM Tris–HCl pH 8.0, 10 mM glutathione) and dialyzed into PBS overnight at 4°C.

    Expressing:

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: HspB1 silences translation of PDZ-RhoGEF by enhancing miR-20a and miR-128 expression to promote neurite extension
    Article Snippet: .. cDNA of HspB1 obtained from vHspB1 transfected cortical neurons by RT-PCR was inserted into pIRES2-AcGFP1 (Clontech) using In-Fusion HD EcoDry Cloning System (Clontech) and the following primers: forward GGACTCAGATCTCGAGATGACCGAGCGCCGCGTGCCCTTC and reverse GTCGACTGCAGAATTCCTACTTGGCTCCAGACTGTTCAGA. .. The resulting plasmid was designated pHspB1.

    Plasmid Preparation:

    Article Title: Pleiotropic Effects of Deubiquitinating Enzyme Ubp5 on Growth and Pathogenesis of Cryptococcus neoformans
    Article Snippet: .. This PCR fragment and the digested plasmid pCH233 by Xba I were fused with In-Fusion® EcoDry™ Cloning System (Clontech). .. The reconstructed vector pUBP5-NAT was reintroduced into ubp5 Δ mutants via biolistic transformation.

    Article Title: C1q-TNF-related protein-9, a novel cardioprotetcive cardiokine, requires proteolytic cleavage to generate a biologically active globular domain isoform
    Article Snippet: .. The fCTRP9 gene was inserted into COOH-terminal-FLAG Tag eukaryotic expression vector pCMV Tag 4A (Stratagene, La Jolla, CA) or dual-Tag eukaryotic expression vector p3xFLAG-Myc-CMV-24 vector (Sigma) by In-Fusion HD Plus EcoDry Cloning System (Clontech Laboratories). .. The endotoxin-free plasmid was prepared by PureYield Plasmid Miniprep System (Promega, Madison, WI) for HEK 293T cell transfection by calcium phosphate method as reported before ( ).

    Article Title: Genome-wide analysis of LXR? activation reveals new transcriptional networks in human atherosclerotic foam cells
    Article Snippet: .. Therefore, five copies of the LXREs were cloned into pGL4.31 vector (Promega) with the In-Fusion HD EcoDry cloning system (Clontech Takara Bio Europe). .. Full-length LXRα and RXRα were cloned from cDNA fragments (Source BioScience clone IRATp970C0271, Gene ID: 7376 and clone IOH39435, Gene ID: 6256) into pBIND vector (Promega).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa hd ecodry infusion cloning
    Hd Ecodry Infusion Cloning, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hd ecodry infusion cloning/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hd ecodry infusion cloning - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results