Structured Review

Thermo Fisher hcv rna
Detection of <t>HCV</t> <t>RNA</t> in LCM-fractioned cells.
Hcv Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hcv rna/product/Thermo Fisher
Average 91 stars, based on 38 article reviews
Price from $9.99 to $1999.99
hcv rna - by Bioz Stars, 2020-05
91/100 stars

Images

1) Product Images from "Hepatitis C Virus Neuroinvasion: Identification of Infected Cells ▿"

Article Title: Hepatitis C Virus Neuroinvasion: Identification of Infected Cells ▿

Journal:

doi: 10.1128/JVI.01890-08

Detection of HCV RNA in LCM-fractioned cells.
Figure Legend Snippet: Detection of HCV RNA in LCM-fractioned cells.

Techniques Used: Laser Capture Microdissection

2) Product Images from "Lymphotropic HCV strain can infect human primary naïve CD4+ cells and affect their proliferation and IFN-γ secretion activity"

Article Title: Lymphotropic HCV strain can infect human primary naïve CD4+ cells and affect their proliferation and IFN-γ secretion activity

Journal: Journal of gastroenterology

doi: 10.1007/s00535-010-0297-2

Detection of negative-strand HCV-RNA among lymphoid cells
Figure Legend Snippet: Detection of negative-strand HCV-RNA among lymphoid cells

Techniques Used:

Detection of negative-strand HCV-RNA among lymphoid cells
Figure Legend Snippet: Detection of negative-strand HCV-RNA among lymphoid cells

Techniques Used:

3) Product Images from "hnRNP L and NF90 Interact with Hepatitis C Virus 5′-Terminal Untranslated RNA and Promote Efficient Replication"

Article Title: hnRNP L and NF90 Interact with Hepatitis C Virus 5′-Terminal Untranslated RNA and Promote Efficient Replication

Journal: Journal of Virology

doi: 10.1128/JVI.00225-14

Depletion of hnRNP L or NF90 impairs HCV replication. Huh-7.5 cells were transfected with siRNAs targeting the indicated proteins or scrambled si-Ctrl and then 48 h later retransfected with H77S.3/GLuc2A RNA. (A) Immunoblots of IGF2BP1, hnRNP L, ADAR1,
Figure Legend Snippet: Depletion of hnRNP L or NF90 impairs HCV replication. Huh-7.5 cells were transfected with siRNAs targeting the indicated proteins or scrambled si-Ctrl and then 48 h later retransfected with H77S.3/GLuc2A RNA. (A) Immunoblots of IGF2BP1, hnRNP L, ADAR1,

Techniques Used: Transfection, Western Blot

hnRNP L and NF90 depletion do not affect HCV IRES translation or miR-122 enhancement of HCV replication. (A) Diagram of the HCV minigenome RNA comprising the HCV 5′UTR followed by N-terminal core protein sequence fused to GLuc and the HCV 3′
Figure Legend Snippet: hnRNP L and NF90 depletion do not affect HCV IRES translation or miR-122 enhancement of HCV replication. (A) Diagram of the HCV minigenome RNA comprising the HCV 5′UTR followed by N-terminal core protein sequence fused to GLuc and the HCV 3′

Techniques Used: Sequencing

Identification of proteins binding to the 5′ end of the HCV 5′UTR. (A) RNA baits used in the pulldown experiments. (Left) ssRNA oligonucleotide representing the 5′ most 47 bases in the HCV genome (H77S virus, black font). Two copies
Figure Legend Snippet: Identification of proteins binding to the 5′ end of the HCV 5′UTR. (A) RNA baits used in the pulldown experiments. (Left) ssRNA oligonucleotide representing the 5′ most 47 bases in the HCV genome (H77S virus, black font). Two copies

Techniques Used: Binding Assay

Cellular localization and association of hnRNP L and NF90 with HCV RNA and NS5A. (A) Distribution of hnRNP L and NF90 in cytoplasmic and nuclear fractions. Total lysate and cytoplasmic and nuclear fractions of Huh-7.5 cells with or without HCV infection
Figure Legend Snippet: Cellular localization and association of hnRNP L and NF90 with HCV RNA and NS5A. (A) Distribution of hnRNP L and NF90 in cytoplasmic and nuclear fractions. Total lysate and cytoplasmic and nuclear fractions of Huh-7.5 cells with or without HCV infection

Techniques Used: Infection

4) Product Images from "Interaction of Hepatitis C Virus Nonstructural Protein 5A with Core Protein Is Critical for the Production of Infectious Virus Particles "

Article Title: Interaction of Hepatitis C Virus Nonstructural Protein 5A with Core Protein Is Critical for the Production of Infectious Virus Particles

Journal: Journal of Virology

doi: 10.1128/JVI.00826-08

IP-RT-PCR of HCV-replicating cells performed to examine the association between the core protein and the HCV genome RNA. Huh-7 cells were transfected with the in vitro transcript of the HCV genome (wild type or CL3B/SA) and lysed in 500 μl of hypotonic buffer at 72 h posttransfection. After IP with an anti-core protein antibody or mouse IgG, immunoprecipitates were eluted in 100 μl of elution buffer. RNAs in immunocomplexes were isolated by acid guanidinium thiocyanate-phenol-chloroform extraction. PCR was carried out as described in Materials and Methods with primer sets amplifying the fragments of nt 129 to 2367 and nt 7267 to 9463 of the JFH-1 genome. One-tenth (10 μl) of each eluted immunoprecipitate was used for assays of the core protein amounts to ensure IP efficiency (lower panel). RNA extracted from a small aliquot of each cell lysate used in IP-RT-PCR is shown as the input.
Figure Legend Snippet: IP-RT-PCR of HCV-replicating cells performed to examine the association between the core protein and the HCV genome RNA. Huh-7 cells were transfected with the in vitro transcript of the HCV genome (wild type or CL3B/SA) and lysed in 500 μl of hypotonic buffer at 72 h posttransfection. After IP with an anti-core protein antibody or mouse IgG, immunoprecipitates were eluted in 100 μl of elution buffer. RNAs in immunocomplexes were isolated by acid guanidinium thiocyanate-phenol-chloroform extraction. PCR was carried out as described in Materials and Methods with primer sets amplifying the fragments of nt 129 to 2367 and nt 7267 to 9463 of the JFH-1 genome. One-tenth (10 μl) of each eluted immunoprecipitate was used for assays of the core protein amounts to ensure IP efficiency (lower panel). RNA extracted from a small aliquot of each cell lysate used in IP-RT-PCR is shown as the input.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Transfection, In Vitro, Isolation, Polymerase Chain Reaction

5) Product Images from "Lipoprotein Receptors Redundantly Participate in Entry of Hepatitis C Virus"

Article Title: Lipoprotein Receptors Redundantly Participate in Entry of Hepatitis C Virus

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005610

SR-B1 is dispensable for HCV entry into Huh7 cells. (A) Expressions of CD81, SR-B1, CLDN1, and OCLN in parental, CD81 KO, SR-B1 KO, CLDN1 KO and OCLN KO Huh7 cells were determined by immunoblotting analysis. (B) Cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR. (C) Infectious titers in the supernatants at 72 h post-infection were determined by focus-forming assay. In all cases, asterisks indicate significant differences (*P
Figure Legend Snippet: SR-B1 is dispensable for HCV entry into Huh7 cells. (A) Expressions of CD81, SR-B1, CLDN1, and OCLN in parental, CD81 KO, SR-B1 KO, CLDN1 KO and OCLN KO Huh7 cells were determined by immunoblotting analysis. (B) Cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR. (C) Infectious titers in the supernatants at 72 h post-infection were determined by focus-forming assay. In all cases, asterisks indicate significant differences (*P

Techniques Used: Infection, Quantitative RT-PCR, Focus Forming Assay

SR-B1 and LDLR have a redundant role in HCV entry. (A) Expressions of SR-B1 and LDLR in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). (B) Parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels were determined at 24, 48 and 72 h post-infection by qRT-PCR. (C, D) Fluorescence localizations in parental, SR-KO, LD-KO and SR/LD-KO Huh7 cells were observed with a confocal microscope, upon infection with HCVcc at an MOI of 1 at 12, 24, 36, 48 and 60 h post-infection. The frequency is shown as the ratio of infected cells to total cells. (E) SR-B1 and LDLR were exogenously expressed in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Expressions of SR-B1 and LDLR in these cells were determined by immunoblotting analysis (left panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (right panel). (F) SR-B1 and LDLR were exogenously expressed in SR/LD-DKO Huh7 cells by infection with different amount of lentiviral vectors. Expressions of SR-B1 and LDLR in these cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). Asterisks indicate significant differences (*P
Figure Legend Snippet: SR-B1 and LDLR have a redundant role in HCV entry. (A) Expressions of SR-B1 and LDLR in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). (B) Parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels were determined at 24, 48 and 72 h post-infection by qRT-PCR. (C, D) Fluorescence localizations in parental, SR-KO, LD-KO and SR/LD-KO Huh7 cells were observed with a confocal microscope, upon infection with HCVcc at an MOI of 1 at 12, 24, 36, 48 and 60 h post-infection. The frequency is shown as the ratio of infected cells to total cells. (E) SR-B1 and LDLR were exogenously expressed in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Expressions of SR-B1 and LDLR in these cells were determined by immunoblotting analysis (left panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (right panel). (F) SR-B1 and LDLR were exogenously expressed in SR/LD-DKO Huh7 cells by infection with different amount of lentiviral vectors. Expressions of SR-B1 and LDLR in these cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). Asterisks indicate significant differences (*P

Techniques Used: Infection, Quantitative RT-PCR, Fluorescence, Microscopy

SR-B1, LDLR and VLDLR participate in the binding step of HCV entry. (A) Parental, CD81 KO, CLDN KO, OCLN KO and SR/LD-DKO Huh7 cells were inoculated with HCVcc at an MOI of 1 at 4°C for 1 h and washed three times with PBS, and HCV RNA levels were determined after the binding. (B) SR/LD-DKO Huh7 cells expressing SR-B1, LDLR or VLDLR were infected with HCVcc at an MOI of 1 at 4°C for 1 h and washed three times with PBS, and HCV RNA levels were determined after the binding. In all cases, asterisks indicate significant differences (*P
Figure Legend Snippet: SR-B1, LDLR and VLDLR participate in the binding step of HCV entry. (A) Parental, CD81 KO, CLDN KO, OCLN KO and SR/LD-DKO Huh7 cells were inoculated with HCVcc at an MOI of 1 at 4°C for 1 h and washed three times with PBS, and HCV RNA levels were determined after the binding. (B) SR/LD-DKO Huh7 cells expressing SR-B1, LDLR or VLDLR were infected with HCVcc at an MOI of 1 at 4°C for 1 h and washed three times with PBS, and HCV RNA levels were determined after the binding. In all cases, asterisks indicate significant differences (*P

Techniques Used: Binding Assay, Expressing, Infection

Lipid binding and lipid uptake of lipoprotein receptors participate in HCV entry. Schematics were shown for the SR-B1, LDLR and VLDLR mutants (upper panels of A and B, and left panel of C). (A) S112F- and T175A-SR-B1 were generated to examine the significance of lipid binding ability. (B) Seven or eight repeats in the ligand binding domains of LDLR (left) and VLDLR (right) were deleted (ΔLBD). (C) An asparagine residue in the repeat 5 and in the repeats 2 to 7 of LDLR was substituted with tyrosine (mut5 and mut2-7). The wild-type and mutants of SR-B1, LDLR and VLDLR were expressed in SR/LD-DKO Huh7 cells by lentiviral vectors. Expressions of these receptors were detected by immunoblotting (middle panels in A and B, right upper panel in C). These cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR (lower panels in A and B, right lower panel in C). (D) HCVpp were inoculated into parental, SR/LD-DKO expressing either SR-B1, LDLR or VLDLR and CD81-KO Huh7 cells, and luciferase activities were determined at 48 h post-infection by using a luciferase assay system. In all cases, asterisks indicate significant differences (*P
Figure Legend Snippet: Lipid binding and lipid uptake of lipoprotein receptors participate in HCV entry. Schematics were shown for the SR-B1, LDLR and VLDLR mutants (upper panels of A and B, and left panel of C). (A) S112F- and T175A-SR-B1 were generated to examine the significance of lipid binding ability. (B) Seven or eight repeats in the ligand binding domains of LDLR (left) and VLDLR (right) were deleted (ΔLBD). (C) An asparagine residue in the repeat 5 and in the repeats 2 to 7 of LDLR was substituted with tyrosine (mut5 and mut2-7). The wild-type and mutants of SR-B1, LDLR and VLDLR were expressed in SR/LD-DKO Huh7 cells by lentiviral vectors. Expressions of these receptors were detected by immunoblotting (middle panels in A and B, right upper panel in C). These cells were infected with HCVcc at an MOI of 1, and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR (lower panels in A and B, right lower panel in C). (D) HCVpp were inoculated into parental, SR/LD-DKO expressing either SR-B1, LDLR or VLDLR and CD81-KO Huh7 cells, and luciferase activities were determined at 48 h post-infection by using a luciferase assay system. In all cases, asterisks indicate significant differences (*P

Techniques Used: Binding Assay, Generated, Ligand Binding Assay, Infection, Quantitative RT-PCR, Expressing, Luciferase

Deficiencies of SR-B1 and LDLR impair HCV entry. (A) Expressions of SR-B1, LDLR and CD81 in parental and SR-KO Huh7 cells transfected with siRNAs targeting LDLR or CD81 were determined by immunoblotting analysis at 48 h post-transfection. (B) Parental and SR-KO Huh7 cells were infected with HCVcc at an MOI of 1 at 48 h post-transfection with siRNAs targeting LDLR or CD81, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR.
Figure Legend Snippet: Deficiencies of SR-B1 and LDLR impair HCV entry. (A) Expressions of SR-B1, LDLR and CD81 in parental and SR-KO Huh7 cells transfected with siRNAs targeting LDLR or CD81 were determined by immunoblotting analysis at 48 h post-transfection. (B) Parental and SR-KO Huh7 cells were infected with HCVcc at an MOI of 1 at 48 h post-transfection with siRNAs targeting LDLR or CD81, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR.

Techniques Used: Transfection, Infection, Quantitative RT-PCR

Density-dependent entry of LVPs via lipoprotein receptors. HCV particles in the culture supernatants of Huh7.5.1 cells were harvested at 72 h post-infection with HCVcc and fractionated by using density gradient centrifugation. Infectious titers of each fraction were determined by focus-forming assay and the buoyant density was plotted for each fraction (upper panels). SR/LD-DKO Huh7 cells expressing either SR-B1, LDLR or VLDLR were infected with each fraction and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR (lower panel). Asterisks indicate significant differences (*P
Figure Legend Snippet: Density-dependent entry of LVPs via lipoprotein receptors. HCV particles in the culture supernatants of Huh7.5.1 cells were harvested at 72 h post-infection with HCVcc and fractionated by using density gradient centrifugation. Infectious titers of each fraction were determined by focus-forming assay and the buoyant density was plotted for each fraction (upper panels). SR/LD-DKO Huh7 cells expressing either SR-B1, LDLR or VLDLR were infected with each fraction and intracellular HCV RNA levels at 24 h post-infection were determined by qRT-PCR (lower panel). Asterisks indicate significant differences (*P

Techniques Used: Infection, Gradient Centrifugation, Focus Forming Assay, Expressing, Quantitative RT-PCR

VLDLR has a similar role with SR-B1 and LDLR in HCV entry. (A) Relative mRNA expression of VLDLR in various tissues was determined using the NextBio Body Atlas application. (B) mRNA expression of SR-B1, LDLR, VLDLR and GAPDH in Huh7 cells and primary human hepatocyte (PHH) were determined by qRT-PCR. Relative expression levels of mRNA were calculated based on the expression level of GAPDH. (C) VLDLR-HA was exogenously expressed in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Expressions of VLDLR in these cells were determined by immunoblotting analysis (upper panel). Parental, CD81 KO and SR/LD-DKO Huh7 cells expressing SR-B1, LDLR or VLDLR were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection (lower panel). (D) VLDLR-HA was exogenously expressed in CD81 KO, CLDN1 KO and OCLN KO Huh7 cells by infection with lentiviral vectors. Expressions of VLDLR, CD81, CLDN1 and OCLN in these cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). (E) SR-B1, LDLR and VLDLR were exogenously expressed in SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Cells were infected with Con1-JFH1 or Jc1 at an MOI of 1, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR. (F) Sera (100μl) from chimeric mice infected with HCV were inoculated into SR/LD-DKO Huh7 cells expressing either SR-B1, LDLR or VLDLR in 24 well plate. Intracellular HCV RNA levels were determined at 72 h post-infection. In all cases, asterisks indicate significant differences (*P
Figure Legend Snippet: VLDLR has a similar role with SR-B1 and LDLR in HCV entry. (A) Relative mRNA expression of VLDLR in various tissues was determined using the NextBio Body Atlas application. (B) mRNA expression of SR-B1, LDLR, VLDLR and GAPDH in Huh7 cells and primary human hepatocyte (PHH) were determined by qRT-PCR. Relative expression levels of mRNA were calculated based on the expression level of GAPDH. (C) VLDLR-HA was exogenously expressed in parental, SR-KO, LD-KO and SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Expressions of VLDLR in these cells were determined by immunoblotting analysis (upper panel). Parental, CD81 KO and SR/LD-DKO Huh7 cells expressing SR-B1, LDLR or VLDLR were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection (lower panel). (D) VLDLR-HA was exogenously expressed in CD81 KO, CLDN1 KO and OCLN KO Huh7 cells by infection with lentiviral vectors. Expressions of VLDLR, CD81, CLDN1 and OCLN in these cells were determined by immunoblotting analysis (upper panel). Cells were infected with HCVcc at an MOI of 1 and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR (lower panel). (E) SR-B1, LDLR and VLDLR were exogenously expressed in SR/LD-DKO Huh7 cells by infection with lentiviral vectors. Cells were infected with Con1-JFH1 or Jc1 at an MOI of 1, and intracellular HCV RNA levels were determined at 24 h post-infection by qRT-PCR. (F) Sera (100μl) from chimeric mice infected with HCV were inoculated into SR/LD-DKO Huh7 cells expressing either SR-B1, LDLR or VLDLR in 24 well plate. Intracellular HCV RNA levels were determined at 72 h post-infection. In all cases, asterisks indicate significant differences (*P

Techniques Used: Expressing, Quantitative RT-PCR, Infection, Mouse Assay

6) Product Images from "Sophoraflavenone G Restricts Dengue and Zika Virus Infection via RNA Polymerase Interference"

Article Title: Sophoraflavenone G Restricts Dengue and Zika Virus Infection via RNA Polymerase Interference

Journal: Viruses

doi: 10.3390/v9100287

Sophoraflavenone G (SFG) can specifically inhibit the replication of Flaviviridae viruses. ( A ) The chemical structure of K211 is identical to that of SFG, as determined by the data in provided by in Supplemental Table S1 ; ( B ) SFG inhibits Hepatitis C virus (HCV) replication in Huh7.5-20 cells. Huh7.5-20 cells were plated, then treated with various concentrations of SFG. ( i ) HCV NS3 protein expression and ( ii ) RNA transcription were monitored at 48 h post treatment (10 µM SFG). ( n = 3); ( C ) SFG has no inhibitory effect on SeV and vesicular stomatitis virus (VSV) infection. A549 cells were plated, treated with 20 µM SFG for 8 h, then infected with ( i ) Sendai virus (SeV) for 48 h. Cell lysates were analyzed via western blot. ( ii ) As before, but infected with VSV-GFP at an MOI of 0.5 for 48 h. Cells were analyzed for GFP expression via flow cytometry. ( n = 2); ( D ) pre-treatment with SFG can inhibit Dengue virus (DENV) infection. A549 cells were plated as before and treated with various doses of SFG. Eight hours later, the cells were infected with DENV at 0.01 MOI for 24 h. Cell were analyzed via flow cytometry for DENV envelope protein expression. ( n = 3); ( E ) SFG can inhibit Zika virus (ZIKV) infection. Trophoblasts were seeded for 24 h, then simultaneously treated with various amounts of SFG and infected with ZIKV at an MOI of 0.1. Cells were collected for qPCR analysis at 24 h. ( n = 2).
Figure Legend Snippet: Sophoraflavenone G (SFG) can specifically inhibit the replication of Flaviviridae viruses. ( A ) The chemical structure of K211 is identical to that of SFG, as determined by the data in provided by in Supplemental Table S1 ; ( B ) SFG inhibits Hepatitis C virus (HCV) replication in Huh7.5-20 cells. Huh7.5-20 cells were plated, then treated with various concentrations of SFG. ( i ) HCV NS3 protein expression and ( ii ) RNA transcription were monitored at 48 h post treatment (10 µM SFG). ( n = 3); ( C ) SFG has no inhibitory effect on SeV and vesicular stomatitis virus (VSV) infection. A549 cells were plated, treated with 20 µM SFG for 8 h, then infected with ( i ) Sendai virus (SeV) for 48 h. Cell lysates were analyzed via western blot. ( ii ) As before, but infected with VSV-GFP at an MOI of 0.5 for 48 h. Cells were analyzed for GFP expression via flow cytometry. ( n = 2); ( D ) pre-treatment with SFG can inhibit Dengue virus (DENV) infection. A549 cells were plated as before and treated with various doses of SFG. Eight hours later, the cells were infected with DENV at 0.01 MOI for 24 h. Cell were analyzed via flow cytometry for DENV envelope protein expression. ( n = 3); ( E ) SFG can inhibit Zika virus (ZIKV) infection. Trophoblasts were seeded for 24 h, then simultaneously treated with various amounts of SFG and infected with ZIKV at an MOI of 0.1. Cells were collected for qPCR analysis at 24 h. ( n = 2).

Techniques Used: Expressing, Infection, Western Blot, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction

7) Product Images from "NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon"

Article Title: NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00310-06

Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

8) Product Images from "Quantitative Detection of Hepatitis C Virus (HCV) RNA in Saliva and Gingival Crevicular Fluid of HCV-Infected Patients"

Article Title: Quantitative Detection of Hepatitis C Virus (HCV) RNA in Saliva and Gingival Crevicular Fluid of HCV-Infected Patients

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.43.9.4413-4417.2005

(A) Correlation between anti-HCV antibody levels and HCV RNA levels in serum. The Spearman rank test was used for testing the correlation between variables. There is a significant positive correlation ( r = 0.80, P
Figure Legend Snippet: (A) Correlation between anti-HCV antibody levels and HCV RNA levels in serum. The Spearman rank test was used for testing the correlation between variables. There is a significant positive correlation ( r = 0.80, P

Techniques Used:

9) Product Images from "HCV RNA decline in the first 24 hours exhibits high negative predictive value of sustained virologic response in HIV/HCV genotype 1 co-infected patients treated with peginterferon and ribavirin"

Article Title: HCV RNA decline in the first 24 hours exhibits high negative predictive value of sustained virologic response in HIV/HCV genotype 1 co-infected patients treated with peginterferon and ribavirin

Journal: Antiviral research

doi: 10.1016/j.antiviral.2011.02.013

Area under the receiver operating characteristic curve, to evaluate the performance of HCV-RNA log 10 decay at 24h with sustained virological response as the state variable.
Figure Legend Snippet: Area under the receiver operating characteristic curve, to evaluate the performance of HCV-RNA log 10 decay at 24h with sustained virological response as the state variable.

Techniques Used:

10) Product Images from "Base Pairing between Hepatitis C Virus RNA and MicroRNA 122 3? of Its Seed Sequence Is Essential for Genome Stabilization and Production of Infectious Virus"

Article Title: Base Pairing between Hepatitis C Virus RNA and MicroRNA 122 3? of Its Seed Sequence Is Essential for Genome Stabilization and Production of Infectious Virus

Journal: Journal of Virology

doi: 10.1128/JVI.00513-12

Functional rescue of miR-122 mutants by complementary substitutions in HCV RNA. (A) Complementary substitutions at nt 2 and 3 and nt 30 to 33 of HCV RNA rescue promotion of its amplification by miR-122p6 mutants with substitutions at nt 13 and 14 and/or
Figure Legend Snippet: Functional rescue of miR-122 mutants by complementary substitutions in HCV RNA. (A) Complementary substitutions at nt 2 and 3 and nt 30 to 33 of HCV RNA rescue promotion of its amplification by miR-122p6 mutants with substitutions at nt 13 and 14 and/or

Techniques Used: Functional Assay, Amplification

Capacity of various miR-122 mutants to support HCV RNA replication. HJ3-5 RNAs bearing either single or double S1 and S2 p6m mutations, as indicated, were cotransfected into cells with the indicated wt or mutant duplex miR-122s, using the same protocol
Figure Legend Snippet: Capacity of various miR-122 mutants to support HCV RNA replication. HJ3-5 RNAs bearing either single or double S1 and S2 p6m mutations, as indicated, were cotransfected into cells with the indicated wt or mutant duplex miR-122s, using the same protocol

Techniques Used: Mutagenesis

Conserved complementary sequences near the 5′ end of the HCV genome suggest supplementary binding of miR-122 to HCV RNA 3′ of the miR-122 seed sequences at both S1 and S2. (A) (Top) Alignment of the terminal 5′UTR sequences in
Figure Legend Snippet: Conserved complementary sequences near the 5′ end of the HCV genome suggest supplementary binding of miR-122 to HCV RNA 3′ of the miR-122 seed sequences at both S1 and S2. (A) (Top) Alignment of the terminal 5′UTR sequences in

Techniques Used: Binding Assay

Influence of HCV nt 4 on the interaction with miR-122. (A) The adenine present at nt 4 of H77S (genotype 1a) (top) RNA provides an opportunity for an additional base pair to form with U14 of miR-122. This is not possible with HJ3-5 (genotype 2a) (middle)
Figure Legend Snippet: Influence of HCV nt 4 on the interaction with miR-122. (A) The adenine present at nt 4 of H77S (genotype 1a) (top) RNA provides an opportunity for an additional base pair to form with U14 of miR-122. This is not possible with HJ3-5 (genotype 2a) (middle)

Techniques Used:

miR-122 nt 13 to 16 are essential for support of HCV RNA replication and production of infectious virus in cell culture. (Top) FT3-7 cells were transfected with HJ3-5 RNA and related p6m mutants 24 h after transfection with the indicated duplex oligoribonucleotides
Figure Legend Snippet: miR-122 nt 13 to 16 are essential for support of HCV RNA replication and production of infectious virus in cell culture. (Top) FT3-7 cells were transfected with HJ3-5 RNA and related p6m mutants 24 h after transfection with the indicated duplex oligoribonucleotides

Techniques Used: Cell Culture, Transfection

3′ supplementary interactions involving nt 13 to 16 contribute to stabilization of HCV RNA by miR-122. (A) GLuc expression from replication-incompetent, genotype 1a H77S/GLuc2A-AAG and related p6m S1 and S2 mutant RNAs that were coelectroporated
Figure Legend Snippet: 3′ supplementary interactions involving nt 13 to 16 contribute to stabilization of HCV RNA by miR-122. (A) GLuc expression from replication-incompetent, genotype 1a H77S/GLuc2A-AAG and related p6m S1 and S2 mutant RNAs that were coelectroporated

Techniques Used: Expressing, Mutagenesis

11) Product Images from "Tricistronic hepatitis C virus subgenomic replicon expressing double transgenes"

Article Title: Tricistronic hepatitis C virus subgenomic replicon expressing double transgenes

Journal: World Journal of Gastroenterology : WJG

doi: 10.3748/wjg.v20.i48.18284

Replication and transgene expression of hepatitis C virus replicons. A: Structure of hepatitis C virus (HCV) replicons. I: The parental replicon, pUC19-HCV, was a subgenomic replicon in which core, E1, E2, p7 and NS2 were replaced by neomycin phosphotransferase ( NeoR ) gene and encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES); II: The bicistronic replicon, pUC19-HCV-hRLuc, was derived from pUC19-HCV by replacing NeoR with humanized Renilla luciferase (hRLuc) gene; III: The novel tricistronic replicon, pHCV-rep-NeoR-hRLuc, was derived from pUC19-HCV by replacing EMCV IRES with two sequential Rbm3 IRES and the hRLuc gene for simultaneous expression of NeoR and hRLuc.; IV: The tricistronic replicon with double EMCV IRESes, Tri-JFH1, was previously reported; V: The replication defective vector, pHCV-Δ5B-NeoR- hRLuc, was generated by truncating the active site of NS5B; B: Replication of HCV RNA in Huh-7 cells transiently transfected by replicons. Huh-7 cells were co-transfected with in vitro transcribed replicon RNA (I-IV) and replication-defective RNA from pHCV-Δ5B-NeoR-hRLuc as control (white columns). The replication of tricistronic HCV replicon was comparable to that derived from pUC19-HCV and pUC19-HCV-hRLuc and higher than that derived from Tri-JFH1; C: Transgene expression 4 h after replicon RNA transfection. The transgene of hRLuc was expressed at a significantly higher level in cells transfected with Rbm3 IRES tricistronic replicon than in cells transfected with pUC19-HCV-hRLuc and Tri-JFH1; D: Transgene expression 72 h after replicon RNA transfection; E: Fold changes of hRLuc activity between the time points of 4 and 72 h after transfection. a P
Figure Legend Snippet: Replication and transgene expression of hepatitis C virus replicons. A: Structure of hepatitis C virus (HCV) replicons. I: The parental replicon, pUC19-HCV, was a subgenomic replicon in which core, E1, E2, p7 and NS2 were replaced by neomycin phosphotransferase ( NeoR ) gene and encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES); II: The bicistronic replicon, pUC19-HCV-hRLuc, was derived from pUC19-HCV by replacing NeoR with humanized Renilla luciferase (hRLuc) gene; III: The novel tricistronic replicon, pHCV-rep-NeoR-hRLuc, was derived from pUC19-HCV by replacing EMCV IRES with two sequential Rbm3 IRES and the hRLuc gene for simultaneous expression of NeoR and hRLuc.; IV: The tricistronic replicon with double EMCV IRESes, Tri-JFH1, was previously reported; V: The replication defective vector, pHCV-Δ5B-NeoR- hRLuc, was generated by truncating the active site of NS5B; B: Replication of HCV RNA in Huh-7 cells transiently transfected by replicons. Huh-7 cells were co-transfected with in vitro transcribed replicon RNA (I-IV) and replication-defective RNA from pHCV-Δ5B-NeoR-hRLuc as control (white columns). The replication of tricistronic HCV replicon was comparable to that derived from pUC19-HCV and pUC19-HCV-hRLuc and higher than that derived from Tri-JFH1; C: Transgene expression 4 h after replicon RNA transfection. The transgene of hRLuc was expressed at a significantly higher level in cells transfected with Rbm3 IRES tricistronic replicon than in cells transfected with pUC19-HCV-hRLuc and Tri-JFH1; D: Transgene expression 72 h after replicon RNA transfection; E: Fold changes of hRLuc activity between the time points of 4 and 72 h after transfection. a P

Techniques Used: Expressing, Derivative Assay, Luciferase, Plasmid Preparation, Generated, Transfection, In Vitro, Activity Assay

Characterization of the tricistronic hepatitis C virus replicon. A: Transgene expression in cells stably transfected with tricistronic hepatitis C virus (HCV) replicon. Fifty stable cell clones were screened with G418 from Huh-7 cells transfected with the purified tricistronic HCV replicon RNA. The humanized Renilla luciferase (hRLuc) activity in sH7 cells was the highest among all of the surviving cell clones; B: HCV RNA in cells stably transfected with tricistronic HCV replicon. HCV RNA in four strains with the highest level of hRLuc activity was quantified by real-time PCR. Huh-7 cells were also transfected with pUC19-HCV and screened to form stable clones as a reference, namely esH8 after the encephalomyocarditis virus internal ribosome entry site (IRES). HCV RNA was amplified from all the tricistronic replicons strains, especially in sH7 clones, in which HCV RNA copy number was higher than any other strains and parental Huh-7 cells. HCV RNA levels in sH7 cells was even more than that in esH8, the pUC19-HCV stably transfected cells; C: Replication of HCV replicons in cells stably transfected with tricistronic HCV replicon. RNA replication was seen in all the tricistronic replicons strains, especially in sH7 clones, in which HCV RNA level was significantly higher than that of parental Huh-7 cells and even higher than that of esH8. The esH8 cells harboring pUC19-HCV replicon with NeoR gene directed by HCV IRES were also used as a reference; D: HCV non-structural gene expression in cells stably transfected with tricistronic HCV replicon. NS5B was probed in four strains with the highest level of hRLuc activity and esH8 cells by Western blot. HCV NS5B protein was found in four tricistronic replicon clones, especially in sH7 clones with the highest NS5B level. NS5B in sH7 cells was comparable to that in esH8 cells.
Figure Legend Snippet: Characterization of the tricistronic hepatitis C virus replicon. A: Transgene expression in cells stably transfected with tricistronic hepatitis C virus (HCV) replicon. Fifty stable cell clones were screened with G418 from Huh-7 cells transfected with the purified tricistronic HCV replicon RNA. The humanized Renilla luciferase (hRLuc) activity in sH7 cells was the highest among all of the surviving cell clones; B: HCV RNA in cells stably transfected with tricistronic HCV replicon. HCV RNA in four strains with the highest level of hRLuc activity was quantified by real-time PCR. Huh-7 cells were also transfected with pUC19-HCV and screened to form stable clones as a reference, namely esH8 after the encephalomyocarditis virus internal ribosome entry site (IRES). HCV RNA was amplified from all the tricistronic replicons strains, especially in sH7 clones, in which HCV RNA copy number was higher than any other strains and parental Huh-7 cells. HCV RNA levels in sH7 cells was even more than that in esH8, the pUC19-HCV stably transfected cells; C: Replication of HCV replicons in cells stably transfected with tricistronic HCV replicon. RNA replication was seen in all the tricistronic replicons strains, especially in sH7 clones, in which HCV RNA level was significantly higher than that of parental Huh-7 cells and even higher than that of esH8. The esH8 cells harboring pUC19-HCV replicon with NeoR gene directed by HCV IRES were also used as a reference; D: HCV non-structural gene expression in cells stably transfected with tricistronic HCV replicon. NS5B was probed in four strains with the highest level of hRLuc activity and esH8 cells by Western blot. HCV NS5B protein was found in four tricistronic replicon clones, especially in sH7 clones with the highest NS5B level. NS5B in sH7 cells was comparable to that in esH8 cells.

Techniques Used: Expressing, Stable Transfection, Transfection, Clone Assay, Purification, Luciferase, Activity Assay, Real-time Polymerase Chain Reaction, Amplification, Western Blot

12) Product Images from "Involvement of the 3’ Untranslated Region in Encapsidation of the Hepatitis C Virus"

Article Title: Involvement of the 3’ Untranslated Region in Encapsidation of the Hepatitis C Virus

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005441

Effect of mutations in 3’ UTR on Core-binding and HCVtcp production. ( A ) Schematic representation of designed mutants in replication-defective subgenomic replicon SGR-JFH1/Gluc/GND. Colored shadows and dashed lines were used to depict the deletion boundaries. ( B ) Production of HCVtcp by using the mutant subgenomic replicons. HCVtcp production (upper) and expression of subgenome (Gluc) and Core in the producer cells (middle and lower) were shown. ( C ) Predicted structures of SLI and II of 3’ UTR are depicted along with the substitution mutations introduced. The resultant mutants were named STIM, STIIM, LIM, LIIM and LI IIM. ( D ) The interactions of Core with 3’ UTR mutants shown in ( C ). ( E ) Production of HCVtcp by replication-defective subgenomic replicons with 3’ UTR mutations shown in ( C ). HCVtcp production (upper), expression of subgenome and Core in the producer cells (middle and lower) are shown. HCVtcp production was determined as in Fig 2 . Results shown represent the mean of three independent experiments ± SEM. HCV RNA copies are indicated as numbers per μg of total RNA for each assay, and Gluc activities are indicated as RLU per μl. VSL: variable region and poly (U/UC) tract, 3’X: the 3’ X tail, ×: GND mutants in NS5B.
Figure Legend Snippet: Effect of mutations in 3’ UTR on Core-binding and HCVtcp production. ( A ) Schematic representation of designed mutants in replication-defective subgenomic replicon SGR-JFH1/Gluc/GND. Colored shadows and dashed lines were used to depict the deletion boundaries. ( B ) Production of HCVtcp by using the mutant subgenomic replicons. HCVtcp production (upper) and expression of subgenome (Gluc) and Core in the producer cells (middle and lower) were shown. ( C ) Predicted structures of SLI and II of 3’ UTR are depicted along with the substitution mutations introduced. The resultant mutants were named STIM, STIIM, LIM, LIIM and LI IIM. ( D ) The interactions of Core with 3’ UTR mutants shown in ( C ). ( E ) Production of HCVtcp by replication-defective subgenomic replicons with 3’ UTR mutations shown in ( C ). HCVtcp production (upper), expression of subgenome and Core in the producer cells (middle and lower) are shown. HCVtcp production was determined as in Fig 2 . Results shown represent the mean of three independent experiments ± SEM. HCV RNA copies are indicated as numbers per μg of total RNA for each assay, and Gluc activities are indicated as RLU per μl. VSL: variable region and poly (U/UC) tract, 3’X: the 3’ X tail, ×: GND mutants in NS5B.

Techniques Used: Binding Assay, Mutagenesis, Expressing

Trans -packaging system based on a replication-defective subgenomic replicon. ( A ) Schematic representation of the HCV trans -packaging system. ( B ) Production of HCVtcp from replication-competent or replication-defective subgenomic replicon (WT or GND, respectively). Transfection with an empty vector pCAG-Neo and pHHSGR-JFH1/Gluc/GND was used to determine the background control (nc), unless described elsewhere. HCVtcp production was determined by quantification of the viral RNA in the transduced cells at 12 hr post-inoculation. The lower panel showed Gaussia luciferase (Gluc) activity released from producer cells. Core expression in producer cells was assessed by immunoblotting. (C) Blocking of HCVtcp entry by anti-CD81 antibody (left), and inoculation of Huh7-25 cells (right). Huh7.5.1 cells were pre-incubated with 20 μg/ml of anti-CD81 antibody (α-CD81) or mouse IgG (IgG) for 1 hr, followed by inoculation with GND HCVtcp. HCV RNA levels in the transduced cells (upper) and Gluc activity released from producer cells (lower) are shown. ( D ) Deletion of UTR impaired production of HCVtcp. Upper graph: Production of HCVtcp from GND and UTR deletion mutants. HCV RNA level in the transduced cells (upper graph) and producer cells (middle graph) were determined by qRT-PCR targeting NS5B region as shown in S1 Fig . Northern blot analysis of HCV RNA in Huh7.5.1 cells transfected with GND, Δ5’ UTR or Δ3’ UTR constructs (lower graph), Huh 7.5.1 cells were transfected with the mutant constructs and subjected to RNA extraction 72 hr post-transfection. 10 μg of total RNA was loaded to formaldehyde denaturing agarose gel electrophoresis and followed by Northern hybridization; a DIG-labeled RNA probe targeting to NS5B was used. 28S rRNA was used to demonstrate equal loading. Comparable Core expression in the producer cells was determined by western blotting. ( B, C, D ) Results of HCV RNA in transduced and producer cells, and reporter activity in producer cells represent the means of three independent experiments ± SEM. HCV RNA copies are indicated as numbers per μg of total RNA for each assay, and Gluc activities are indicated as RLU per μl.
Figure Legend Snippet: Trans -packaging system based on a replication-defective subgenomic replicon. ( A ) Schematic representation of the HCV trans -packaging system. ( B ) Production of HCVtcp from replication-competent or replication-defective subgenomic replicon (WT or GND, respectively). Transfection with an empty vector pCAG-Neo and pHHSGR-JFH1/Gluc/GND was used to determine the background control (nc), unless described elsewhere. HCVtcp production was determined by quantification of the viral RNA in the transduced cells at 12 hr post-inoculation. The lower panel showed Gaussia luciferase (Gluc) activity released from producer cells. Core expression in producer cells was assessed by immunoblotting. (C) Blocking of HCVtcp entry by anti-CD81 antibody (left), and inoculation of Huh7-25 cells (right). Huh7.5.1 cells were pre-incubated with 20 μg/ml of anti-CD81 antibody (α-CD81) or mouse IgG (IgG) for 1 hr, followed by inoculation with GND HCVtcp. HCV RNA levels in the transduced cells (upper) and Gluc activity released from producer cells (lower) are shown. ( D ) Deletion of UTR impaired production of HCVtcp. Upper graph: Production of HCVtcp from GND and UTR deletion mutants. HCV RNA level in the transduced cells (upper graph) and producer cells (middle graph) were determined by qRT-PCR targeting NS5B region as shown in S1 Fig . Northern blot analysis of HCV RNA in Huh7.5.1 cells transfected with GND, Δ5’ UTR or Δ3’ UTR constructs (lower graph), Huh 7.5.1 cells were transfected with the mutant constructs and subjected to RNA extraction 72 hr post-transfection. 10 μg of total RNA was loaded to formaldehyde denaturing agarose gel electrophoresis and followed by Northern hybridization; a DIG-labeled RNA probe targeting to NS5B was used. 28S rRNA was used to demonstrate equal loading. Comparable Core expression in the producer cells was determined by western blotting. ( B, C, D ) Results of HCV RNA in transduced and producer cells, and reporter activity in producer cells represent the means of three independent experiments ± SEM. HCV RNA copies are indicated as numbers per μg of total RNA for each assay, and Gluc activities are indicated as RLU per μl.

Techniques Used: Transfection, Plasmid Preparation, Luciferase, Activity Assay, Expressing, Blocking Assay, Incubation, Quantitative RT-PCR, Northern Blot, Construct, Mutagenesis, RNA Extraction, Agarose Gel Electrophoresis, Hybridization, Labeling, Western Blot

Entire 3’ UTR is required for Core-binding to produce HCVtcp. ( A ) Schematic representation of HCV genome and the regions used for the Core-RNA interaction assay. Stem-loops and colored lines depict in vitro synthesized and folded RNA fragments used. ( B ) In vitro interactions of RNA fragments with Core determined by AlphaScreen. Results for comparison among structure clusters across HCV genome (left) and among 3’ UTR and the fragments within the region (right) were obtained from two independent assays. ( C ) Trans -packaging of EmGFP RNA into HCV particles indicated by transduced RNA level in the inoculated cells (upper). Transduction of EmGFP RNA was determined at 12 hr post-inoculation. EmGFP RNA level in the co-transfected producer cells (lower) is shown. N: pCAG/NS3-5B, G: p/EmGFP, G3H: p/EmGFP-H3’UTR, encoding EmGFP followed with 3’ UTR of H77. G3J: p/EmGFP-J3’UTR, encoding EmGFP followed with 3’ UTR of JFH-1. cont; control with cells co-transfected with a pCAG-Neo empty vector, p/EmGFP-J3’UTR and pCAG/NS3-5B. ( D ) Entry of HCVtcp was blocked by anti-CD81 antibody (α-CD81), carried out as described in Fig 3C. Data were present as mean ± SEM, n = 4. ( E ) Comparison of tran -packaging of EmGFP RNAs, directed by 3’- or 5’ UTR. 5G3J: p/5’UTR-EmGFP-J3’UTR, encoding EmGFP flanked by 5’ UTR and 3’ UTR of JFH-1. 5G: p/5’UTR-EmGFP, addition of 5’ UTR at upstream of EmGFP. ( C, D, E ) Results shown represent the means of three independent experiments ± SEM. RNA copies are indicated as numbers per μg of total RNA.
Figure Legend Snippet: Entire 3’ UTR is required for Core-binding to produce HCVtcp. ( A ) Schematic representation of HCV genome and the regions used for the Core-RNA interaction assay. Stem-loops and colored lines depict in vitro synthesized and folded RNA fragments used. ( B ) In vitro interactions of RNA fragments with Core determined by AlphaScreen. Results for comparison among structure clusters across HCV genome (left) and among 3’ UTR and the fragments within the region (right) were obtained from two independent assays. ( C ) Trans -packaging of EmGFP RNA into HCV particles indicated by transduced RNA level in the inoculated cells (upper). Transduction of EmGFP RNA was determined at 12 hr post-inoculation. EmGFP RNA level in the co-transfected producer cells (lower) is shown. N: pCAG/NS3-5B, G: p/EmGFP, G3H: p/EmGFP-H3’UTR, encoding EmGFP followed with 3’ UTR of H77. G3J: p/EmGFP-J3’UTR, encoding EmGFP followed with 3’ UTR of JFH-1. cont; control with cells co-transfected with a pCAG-Neo empty vector, p/EmGFP-J3’UTR and pCAG/NS3-5B. ( D ) Entry of HCVtcp was blocked by anti-CD81 antibody (α-CD81), carried out as described in Fig 3C. Data were present as mean ± SEM, n = 4. ( E ) Comparison of tran -packaging of EmGFP RNAs, directed by 3’- or 5’ UTR. 5G3J: p/5’UTR-EmGFP-J3’UTR, encoding EmGFP flanked by 5’ UTR and 3’ UTR of JFH-1. 5G: p/5’UTR-EmGFP, addition of 5’ UTR at upstream of EmGFP. ( C, D, E ) Results shown represent the means of three independent experiments ± SEM. RNA copies are indicated as numbers per μg of total RNA.

Techniques Used: Binding Assay, In Vitro, Synthesized, Amplified Luminescent Proximity Homogenous Assay, Transduction, Transfection, Plasmid Preparation

Characteristics of HCV RNAs in infected cells and culture supernatant. ( A ) Normalized 3’:5’-end ratios of HCV RNA from cells (whole cell), supernatants (whole sup) and fractions with the highest infectivity (Top Inf. fraction) of cultures infected with HCVcc JFH-1 or J6/JFH-1. The ratio values calculated from NS5B (3’ end) and 5’ UTR (5’ end) qRT-PCR were normalized by the reference ratio (0.459; S1D Fig ). The reference ratio was arbitrarily set to 1 (Rr) and the normalized 3’:5’-end ratios were shown. ( B ) Distribution of HCV RNA (5’ end, 3’ end) in fractions from culture supernatants and lysates of cells infected with HCVcc JFH-1, and the infectivity of each fraction. The y-axis indicates number of HCV RNA copies/ml (left) and infectivity in terms of viral RNA copies per μg of total RNA (right) from cells inoculated with equal aliquots of each fraction. Infectivity was measured by quantification of HCV RNA in the infected cells, 2 days post-infection. Blue, red and black lines represent quantity of 5’ end, 3’ end and infectivity, respectively. ( C ) Correlation of 3’:5’-end ratios with infectivity of the fractions obtained from supernatant and cells following HCVcc (JFH-1) infection as shown in ( B ). Correlations were estimated by way of linear regression and statistical significance was set at P = 0.01. ( D ) Comparison of 3’:5’-end ratios of high infectious (HI) and low infectious (LI) fractions. The median value of the infectivity of the fractions was used to split the fractions into HI and LI groups. Fractions derived from JFH-1, as shown in Fig 1B were used. Values are the mean ± SEM (n = 4 for whole cell and whole sup; n = 2 for Top Inf. fraction, n = 5 for supernatant HI and LI fraction groups and n = 7 for intracellular HI and LI fraction groups); ** P
Figure Legend Snippet: Characteristics of HCV RNAs in infected cells and culture supernatant. ( A ) Normalized 3’:5’-end ratios of HCV RNA from cells (whole cell), supernatants (whole sup) and fractions with the highest infectivity (Top Inf. fraction) of cultures infected with HCVcc JFH-1 or J6/JFH-1. The ratio values calculated from NS5B (3’ end) and 5’ UTR (5’ end) qRT-PCR were normalized by the reference ratio (0.459; S1D Fig ). The reference ratio was arbitrarily set to 1 (Rr) and the normalized 3’:5’-end ratios were shown. ( B ) Distribution of HCV RNA (5’ end, 3’ end) in fractions from culture supernatants and lysates of cells infected with HCVcc JFH-1, and the infectivity of each fraction. The y-axis indicates number of HCV RNA copies/ml (left) and infectivity in terms of viral RNA copies per μg of total RNA (right) from cells inoculated with equal aliquots of each fraction. Infectivity was measured by quantification of HCV RNA in the infected cells, 2 days post-infection. Blue, red and black lines represent quantity of 5’ end, 3’ end and infectivity, respectively. ( C ) Correlation of 3’:5’-end ratios with infectivity of the fractions obtained from supernatant and cells following HCVcc (JFH-1) infection as shown in ( B ). Correlations were estimated by way of linear regression and statistical significance was set at P = 0.01. ( D ) Comparison of 3’:5’-end ratios of high infectious (HI) and low infectious (LI) fractions. The median value of the infectivity of the fractions was used to split the fractions into HI and LI groups. Fractions derived from JFH-1, as shown in Fig 1B were used. Values are the mean ± SEM (n = 4 for whole cell and whole sup; n = 2 for Top Inf. fraction, n = 5 for supernatant HI and LI fraction groups and n = 7 for intracellular HI and LI fraction groups); ** P

Techniques Used: Infection, Quantitative RT-PCR, Derivative Assay

13) Product Images from "Characterization of miR-122-independent propagation of HCV"

Article Title: Characterization of miR-122-independent propagation of HCV

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1006374

Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Infection, Immunoprecipitation, Quantitative RT-PCR, Standard Deviation

Polysome analysis of lysates from HCV- or HCV 122KO -infected cells. Huh7 cells (5x10 5 cells) were infected with HCV or HCV 122KO and harvested at 72 hpi for polysome analysis. A254 absorbance (top), distribution of HCV-RNA (middle) and β-actin mRNA levels (bottom) were determined.
Figure Legend Snippet: Polysome analysis of lysates from HCV- or HCV 122KO -infected cells. Huh7 cells (5x10 5 cells) were infected with HCV or HCV 122KO and harvested at 72 hpi for polysome analysis. A254 absorbance (top), distribution of HCV-RNA (middle) and β-actin mRNA levels (bottom) were determined.

Techniques Used: Infection

Identification of adaptive mutation in HCV 122KO . (A) Mutation of G28A in the 5’UTR of HCV was identified in all independently isolated HCV propagated in the three 751-122KO cell clones (751-122KO#1~#3). Arrows indicate the position of nt28 in the 5’UTR of HCV. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. (B) Frequency and distribution of SNV in HCV independently cultured in Huh7.5.1 (JFH-P5; top) and 751-122KO cell clones (bottom). Six independently isolated HCV 122KO viruses were obtained from three wells for each of two 751-122KO cell clones (751-122KO#1 and #2). Each sequence read was mapped to pHH-JFH1-E2p7NS2mt. Arrows indicate the detected substitutions.
Figure Legend Snippet: Identification of adaptive mutation in HCV 122KO . (A) Mutation of G28A in the 5’UTR of HCV was identified in all independently isolated HCV propagated in the three 751-122KO cell clones (751-122KO#1~#3). Arrows indicate the position of nt28 in the 5’UTR of HCV. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. (B) Frequency and distribution of SNV in HCV independently cultured in Huh7.5.1 (JFH-P5; top) and 751-122KO cell clones (bottom). Six independently isolated HCV 122KO viruses were obtained from three wells for each of two 751-122KO cell clones (751-122KO#1 and #2). Each sequence read was mapped to pHH-JFH1-E2p7NS2mt. Arrows indicate the detected substitutions.

Techniques Used: Mutagenesis, Isolation, Clone Assay, Cell Culture, Sequencing

Propagation of Con1C3/JFH 122KO in 751-122KO cells. (A) Infectious titer in the culture medium on serial passage of 751-122KO#1 or Huh7.5.1 cells. Red circles indicate the passage in 751-122KO cells, and the other circles indicate the passage in Huh7.5.1 cells. Three independent passages (#4–6, #4–8, #7–8) are shown. (B) Nuclear translocation of IPS-GFP (arrows) in Huh7.5.1 and 751-122KO cells upon infection with Con1C3/JFH and Con1C3/JFH 122KO . (C) Con1C3/JFH and Con1C3/JFH 122KO were inoculated into 751-122KO#1 and Huh7.5.1 cells, and the levels of intracellular HCV-RNA replication were determined. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (**P
Figure Legend Snippet: Propagation of Con1C3/JFH 122KO in 751-122KO cells. (A) Infectious titer in the culture medium on serial passage of 751-122KO#1 or Huh7.5.1 cells. Red circles indicate the passage in 751-122KO cells, and the other circles indicate the passage in Huh7.5.1 cells. Three independent passages (#4–6, #4–8, #7–8) are shown. (B) Nuclear translocation of IPS-GFP (arrows) in Huh7.5.1 and 751-122KO cells upon infection with Con1C3/JFH and Con1C3/JFH 122KO . (C) Con1C3/JFH and Con1C3/JFH 122KO were inoculated into 751-122KO#1 and Huh7.5.1 cells, and the levels of intracellular HCV-RNA replication were determined. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (**P

Techniques Used: Translocation Assay, Infection, Standard Deviation

Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Derivative Assay, Staining, Transduction, Expressing, Electroporation, Quantitative RT-PCR, Clone Assay, Immunoprecipitation, Standard Deviation

Detection of G28A mutation in HCV-RNA from the serum or PBMCs of gt2 patients. (A) Characterization of the nucleotide at nt28 from the serum and PBMCs of HCV gt2a patients. An asterisk indicates the samples from patients whose cases were complicated with hypothyroidism. (B) The ratio of samples between the WT and G28A from serum (left) or PBMCs (right). (C) Direct sequencing analysis. Viral RNA was purified from each PBMC or serum sample and subjected to sequencing analysis. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. Samples that included G28A (#13. #21, #29, #31) or G28U (#16) in either PBMCs or serum are shown.
Figure Legend Snippet: Detection of G28A mutation in HCV-RNA from the serum or PBMCs of gt2 patients. (A) Characterization of the nucleotide at nt28 from the serum and PBMCs of HCV gt2a patients. An asterisk indicates the samples from patients whose cases were complicated with hypothyroidism. (B) The ratio of samples between the WT and G28A from serum (left) or PBMCs (right). (C) Direct sequencing analysis. Viral RNA was purified from each PBMC or serum sample and subjected to sequencing analysis. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. Samples that included G28A (#13. #21, #29, #31) or G28U (#16) in either PBMCs or serum are shown.

Techniques Used: Mutagenesis, Sequencing, Purification

miR-122-independent propagation of HCV 122KO . (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Hep3B cells infected with HCV or HCV 122KO were determined. (B) Hec1B cells with or without exogenous expression of miR-122 were infected with HCV or HCV 122KO and the levels of intracellular HCV-RNA were determined. (C) Immunoblotting of 293T-CLDN cells with exogenous expression of miR-122 and ApoE. (D) 293T-CLDN cells were infected with either HCV or HCV 122KO and the levels of intracellular HCV-RNA (upper) and infectious titers in the culture supernatants (lower) were determined at 12, 36 and 72 hpi (horizontal). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: miR-122-independent propagation of HCV 122KO . (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Hep3B cells infected with HCV or HCV 122KO were determined. (B) Hec1B cells with or without exogenous expression of miR-122 were infected with HCV or HCV 122KO and the levels of intracellular HCV-RNA were determined. (C) Immunoblotting of 293T-CLDN cells with exogenous expression of miR-122 and ApoE. (D) 293T-CLDN cells were infected with either HCV or HCV 122KO and the levels of intracellular HCV-RNA (upper) and infectious titers in the culture supernatants (lower) were determined at 12, 36 and 72 hpi (horizontal). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Infection, Expressing, Standard Deviation

Effects of G28A mutation in the 5’UTR on the propagation of HCV. (A) Infectious titers in the culture media upon serial passage of three clones each of 751-122KO-shlacZ, 751-122KO-shXrn1 or 751-122KO-shXrn1/Xrn2 cells (#1~#3). (B) Colony formation in Huh7-122KO and Huh7-122KOR cells upon electroporation with the wild type and G28A-mutated JFH-SGR RNA (upper). The numbers of colonies of each cell type were quantified (bottom). Culture supernatants of 751-122KO and Huh7.5.1 cells co-electroporated with the wild type and G28A-mutated JFH1 HCV-RNA were harvested at each passage, and the infectious titers (C) and the sequences of viral RNA (D) were determined. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. Variations in the wild type and G28A mutant at passages 1 and 4 are shown (D, bottom). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: Effects of G28A mutation in the 5’UTR on the propagation of HCV. (A) Infectious titers in the culture media upon serial passage of three clones each of 751-122KO-shlacZ, 751-122KO-shXrn1 or 751-122KO-shXrn1/Xrn2 cells (#1~#3). (B) Colony formation in Huh7-122KO and Huh7-122KOR cells upon electroporation with the wild type and G28A-mutated JFH-SGR RNA (upper). The numbers of colonies of each cell type were quantified (bottom). Culture supernatants of 751-122KO and Huh7.5.1 cells co-electroporated with the wild type and G28A-mutated JFH1 HCV-RNA were harvested at each passage, and the infectious titers (C) and the sequences of viral RNA (D) were determined. Each RNA base is represented as a colored peak: A, green; U, red; G, black; and C, blue. Variations in the wild type and G28A mutant at passages 1 and 4 are shown (D, bottom). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Mutagenesis, Clone Assay, Electroporation, Standard Deviation

miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

14) Product Images from "Lipoprotein Lipase Inhibits Hepatitis C Virus (HCV) Infection by Blocking Virus Cell Entry"

Article Title: Lipoprotein Lipase Inhibits Hepatitis C Virus (HCV) Infection by Blocking Virus Cell Entry

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026637

The inhibitory effect of LPL on HCVcc infection is only partly related to its catalytic activity. (A) Huh7.5 cells were pre-incubated with 1 µg/ml LPL at 4°C in the presence or absence of 50 µg/ml THL before infection with JFH1. The infected cells were grown for 24 h and HCV RNA was then extracted and quantified by RT-qPCR. (B) THL does not influence HCV replication. Huh7.5 cells were pre-incubated with indicated concentrations of THL before cell infection with JFH-1, as for experiments with LPL. THL was maintained in the medium for 24 h post infection. HCV RNA was then extracted and quantified by RT-qPCR. Results are expressed as a percent of RNA as compared with control cells infected in the absence of LPL and THL.
Figure Legend Snippet: The inhibitory effect of LPL on HCVcc infection is only partly related to its catalytic activity. (A) Huh7.5 cells were pre-incubated with 1 µg/ml LPL at 4°C in the presence or absence of 50 µg/ml THL before infection with JFH1. The infected cells were grown for 24 h and HCV RNA was then extracted and quantified by RT-qPCR. (B) THL does not influence HCV replication. Huh7.5 cells were pre-incubated with indicated concentrations of THL before cell infection with JFH-1, as for experiments with LPL. THL was maintained in the medium for 24 h post infection. HCV RNA was then extracted and quantified by RT-qPCR. Results are expressed as a percent of RNA as compared with control cells infected in the absence of LPL and THL.

Techniques Used: Infection, Activity Assay, Incubation, Quantitative RT-PCR

LPL inhibits cell infection by the JFH-1 and J6/JFH-1 strains produced in vitro and in vivo in a chimeric uPA-SCID mouse model. The HCVcc strains JFH-1 (A) and J6/JFH-1 (B) were produced in the Huh7.5 hepatoma cell line. Cells were incubated with (or without) LPL for 30 min at 4°C and then with virus preparations for 2 h at 37°C to allow infection. RNA was extracted from cells 24 h post infection and HCV RNA was quantified by RT-qPCR. The data obtained were normalized with respect to levels of GADPH. The mJFH-1 (A) and mJ6/JFH-1 (B) correspond to HCVcc strains produced in chimeric uPA-SCID mice into which we transplanted human hepatocytes. Serum samples collected from infected mice were pooled and their capacity to infect Huh7.5 cells was assessed in the presence and absence of LPL, as outlined above. Cells infected in the absence (black bar) and in the presence of LPL (gray bar). The data are expressed as the amount of HCV RNA detected in cells infected in the presence of LPL as compared with the amount of HCV RNA in cells infected in the absence of LPL, expressed as a percentage.
Figure Legend Snippet: LPL inhibits cell infection by the JFH-1 and J6/JFH-1 strains produced in vitro and in vivo in a chimeric uPA-SCID mouse model. The HCVcc strains JFH-1 (A) and J6/JFH-1 (B) were produced in the Huh7.5 hepatoma cell line. Cells were incubated with (or without) LPL for 30 min at 4°C and then with virus preparations for 2 h at 37°C to allow infection. RNA was extracted from cells 24 h post infection and HCV RNA was quantified by RT-qPCR. The data obtained were normalized with respect to levels of GADPH. The mJFH-1 (A) and mJ6/JFH-1 (B) correspond to HCVcc strains produced in chimeric uPA-SCID mice into which we transplanted human hepatocytes. Serum samples collected from infected mice were pooled and their capacity to infect Huh7.5 cells was assessed in the presence and absence of LPL, as outlined above. Cells infected in the absence (black bar) and in the presence of LPL (gray bar). The data are expressed as the amount of HCV RNA detected in cells infected in the presence of LPL as compared with the amount of HCV RNA in cells infected in the absence of LPL, expressed as a percentage.

Techniques Used: Infection, Produced, In Vitro, In Vivo, Incubation, Quantitative RT-PCR, Mouse Assay

LPL affects HCV attachment and early stages of the virus cell cycle. (A) Effect of LPL on virus attachment to Huh7.5 cells. Huh7.5 cells were pre-incubated with various concentrations of LPL (1–9 µg/ml) for 30 min at 4°C. An aliquot of cell culture supernatant containing JFH-1 was incubated with LPL-pretreated Huh7.5 cells for 30 min at 4°C. The cells were washed and the RNA associated with them was extracted. HCV RNA was quantified by RT-qPCR. (B) Effect of LPL on early steps of HCV infection. JFH-1 was first adsorbed onto Huh7.5 cells by incubation for 45 min at 4°C. Cells were washed with cold medium to remove any unbound virus. Complete medium, warmed to 37°C, was then added and incubated with the cells at 37°C. LPL was added to a concentration of 1 µg/ml at various time points (0, 5, 10, 15 or 20 min) after the transfer of cells to 37°C, with or without the addition of 50 µg/ml THL to block its enzymatic activity. Cells were grown for 24 h. RNA was then extracted and HCV RNA was quantified by RT-qPCR. Results are expressed as a percent of RNA as compared with control cells infected in the absence of LPL.
Figure Legend Snippet: LPL affects HCV attachment and early stages of the virus cell cycle. (A) Effect of LPL on virus attachment to Huh7.5 cells. Huh7.5 cells were pre-incubated with various concentrations of LPL (1–9 µg/ml) for 30 min at 4°C. An aliquot of cell culture supernatant containing JFH-1 was incubated with LPL-pretreated Huh7.5 cells for 30 min at 4°C. The cells were washed and the RNA associated with them was extracted. HCV RNA was quantified by RT-qPCR. (B) Effect of LPL on early steps of HCV infection. JFH-1 was first adsorbed onto Huh7.5 cells by incubation for 45 min at 4°C. Cells were washed with cold medium to remove any unbound virus. Complete medium, warmed to 37°C, was then added and incubated with the cells at 37°C. LPL was added to a concentration of 1 µg/ml at various time points (0, 5, 10, 15 or 20 min) after the transfer of cells to 37°C, with or without the addition of 50 µg/ml THL to block its enzymatic activity. Cells were grown for 24 h. RNA was then extracted and HCV RNA was quantified by RT-qPCR. Results are expressed as a percent of RNA as compared with control cells infected in the absence of LPL.

Techniques Used: Incubation, Cell Culture, Quantitative RT-PCR, Infection, Concentration Assay, Blocking Assay, Activity Assay

Cell infection with low- and high-density virus populations from iodixanol gradients in the presence or absence of LPL. The pooled peak fractions of the low- and high-density virus populations obtained after centrifugation through iodixanol gradients of JFH1 grown in cell culture (A) and serum samples from the m-JFH1 chimeric mouse model (B) (both gradients are shown in Figure 2 ) were used to infect cells in the presence or absence of 1 µg/ml LPL, as described in the Materials and Methods section. Cells were grown for 48 h at 37°C and HCV RNA was extracted and quantified by RT-qPCR. The results were normalized with respect to the cellular gene GAPDH, with the GAPDH Control Kit. The data are expressed as the amount of HCV RNA detected in cells infected with the pooled fractions from the two major virus populations in the presence of LPL as compared with the amount of HCV RNA in cells infected with the same fractions in the absence of LPL, expressed as a percentage.
Figure Legend Snippet: Cell infection with low- and high-density virus populations from iodixanol gradients in the presence or absence of LPL. The pooled peak fractions of the low- and high-density virus populations obtained after centrifugation through iodixanol gradients of JFH1 grown in cell culture (A) and serum samples from the m-JFH1 chimeric mouse model (B) (both gradients are shown in Figure 2 ) were used to infect cells in the presence or absence of 1 µg/ml LPL, as described in the Materials and Methods section. Cells were grown for 48 h at 37°C and HCV RNA was extracted and quantified by RT-qPCR. The results were normalized with respect to the cellular gene GAPDH, with the GAPDH Control Kit. The data are expressed as the amount of HCV RNA detected in cells infected with the pooled fractions from the two major virus populations in the presence of LPL as compared with the amount of HCV RNA in cells infected with the same fractions in the absence of LPL, expressed as a percentage.

Techniques Used: Infection, Centrifugation, Cell Culture, Quantitative RT-PCR

Iodixanol gradient analysis of the JFH-1 and J6/JFH-1 strains produced in vitro and in vivo . The supernatants from infected Huh7.5 cells producing JFH-1 (JFH-1, shown in A and B) and J6/JFH-1 (shown in E) were subjected to isopycnic centrifugation through iodixanol gradients, as described in Materials and Methods . Pooled serum samples from the chimeric uPA-SCID mice were also subjected to centrifugation on the same type of gradient. Representative profiles are shown in C and D for mice inoculated with JFH-1 (mJFH-1) and in F for mice inoculated with J6/JFH-1 (mJ6/JFH-1). HCV core antigen in gradient fractions was quantified by ELISA, HCV RNA was quantified by RT-qPCR, and ApoB and cholesterol were determined by ELISA. Infectivity for fractionated J6/JFH-1 (representative for both strains) grown in Huh7.5 cells is shown in E and that for the corresponding mouse serum (mJ6/JFH-1) is shown in F. The fractions (25 µl) were used to infect Huh7.5 cells. Cells were incubated for 48 h at 37°C; total RNA was then extracted and HCV-RNA levels were quantified by RT-qPCR. The results were normalized, taking into account the initial HCV-RNA content in each sample analyzed, as determined by RT-qPCR, and are expressed as a ratio of these two values.
Figure Legend Snippet: Iodixanol gradient analysis of the JFH-1 and J6/JFH-1 strains produced in vitro and in vivo . The supernatants from infected Huh7.5 cells producing JFH-1 (JFH-1, shown in A and B) and J6/JFH-1 (shown in E) were subjected to isopycnic centrifugation through iodixanol gradients, as described in Materials and Methods . Pooled serum samples from the chimeric uPA-SCID mice were also subjected to centrifugation on the same type of gradient. Representative profiles are shown in C and D for mice inoculated with JFH-1 (mJFH-1) and in F for mice inoculated with J6/JFH-1 (mJ6/JFH-1). HCV core antigen in gradient fractions was quantified by ELISA, HCV RNA was quantified by RT-qPCR, and ApoB and cholesterol were determined by ELISA. Infectivity for fractionated J6/JFH-1 (representative for both strains) grown in Huh7.5 cells is shown in E and that for the corresponding mouse serum (mJ6/JFH-1) is shown in F. The fractions (25 µl) were used to infect Huh7.5 cells. Cells were incubated for 48 h at 37°C; total RNA was then extracted and HCV-RNA levels were quantified by RT-qPCR. The results were normalized, taking into account the initial HCV-RNA content in each sample analyzed, as determined by RT-qPCR, and are expressed as a ratio of these two values.

Techniques Used: Produced, In Vitro, In Vivo, Infection, Centrifugation, Mouse Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Incubation

15) Product Images from "Establishment of infectious HCV virion-producing cells with newly designed full-genome replicon RNA"

Article Title: Establishment of infectious HCV virion-producing cells with newly designed full-genome replicon RNA

Journal: Archives of Virology

doi: 10.1007/s00705-010-0859-x

Northern blot analysis of colonies formed after infection. 10 7 , 10 9 : amounts of in vitro-generated subgenomic replicon RNA loaded. Numbers below the lanes are the HCV copy number per μg of total RNA (A). Huh-7 cells, subgenomic replicon cells, dORF replicon cell #2, dORF bla replicon cell #2, subgenomic replicon sup: colony from cells transduced with subgenomic replicon supernatant, colony No.1, 2 of dORF replicon #2 sup: colonies from cells infected with dORF replicon #2 supernatant, colony No.1, 2, and 3 of dORF bla replicon #2 sup: colonies from cells infected with dORF bla replicon #2 supernatant. Western blot analysis of colonies formed after infection (B). The order of the lanes is identical to that for the northern blot, except for the dORF and dORF bla replicons, which represent two clones in this figure
Figure Legend Snippet: Northern blot analysis of colonies formed after infection. 10 7 , 10 9 : amounts of in vitro-generated subgenomic replicon RNA loaded. Numbers below the lanes are the HCV copy number per μg of total RNA (A). Huh-7 cells, subgenomic replicon cells, dORF replicon cell #2, dORF bla replicon cell #2, subgenomic replicon sup: colony from cells transduced with subgenomic replicon supernatant, colony No.1, 2 of dORF replicon #2 sup: colonies from cells infected with dORF replicon #2 supernatant, colony No.1, 2, and 3 of dORF bla replicon #2 sup: colonies from cells infected with dORF bla replicon #2 supernatant. Western blot analysis of colonies formed after infection (B). The order of the lanes is identical to that for the northern blot, except for the dORF and dORF bla replicons, which represent two clones in this figure

Techniques Used: Northern Blot, Infection, In Vitro, Generated, Transduction, Western Blot, Clone Assay

Confirmation of “divided open reading frame carrying” (dORF) replicon cells. (A) Schematic representations of replicon RNAs used in this study. All the replicon constructs contained inserts just after the T7 promotor. UTR, untranslated region; NS, non-structural protein; neo, neomycin phosphotransferase II; EMCV, encephalomyocarditis virus; IRES, internal ribosomal entry site; FMDV, foot-and-mouth disease virus; bla, beta-lactamase. (B) Northern blot analysis. A 10-μg amount of total RNA from each cell sample was loaded. Subgenomic replicon RNA: 10 8 copies of in vitro-generated subgenomic RNA. Numbers below the lanes are the HCV copy number per microgram of total RNA. Huh-7 cell, subgenomic replicon cell, dORF replicon cell #1, #2, dORF bla replicon cell #1, #2. (C) Western blot analysis. A 10-μg amount of each cell lysate was loaded. Huh-7 cell, Huh-7-JFH1: Huh-7 cell transfected with JFH1 viral RNA, subgenomic replicon cell, full-genome replicon cell, dORF replicon cell #1, #2, dORF bla replicon cell #1, #2
Figure Legend Snippet: Confirmation of “divided open reading frame carrying” (dORF) replicon cells. (A) Schematic representations of replicon RNAs used in this study. All the replicon constructs contained inserts just after the T7 promotor. UTR, untranslated region; NS, non-structural protein; neo, neomycin phosphotransferase II; EMCV, encephalomyocarditis virus; IRES, internal ribosomal entry site; FMDV, foot-and-mouth disease virus; bla, beta-lactamase. (B) Northern blot analysis. A 10-μg amount of total RNA from each cell sample was loaded. Subgenomic replicon RNA: 10 8 copies of in vitro-generated subgenomic RNA. Numbers below the lanes are the HCV copy number per microgram of total RNA. Huh-7 cell, subgenomic replicon cell, dORF replicon cell #1, #2, dORF bla replicon cell #1, #2. (C) Western blot analysis. A 10-μg amount of each cell lysate was loaded. Huh-7 cell, Huh-7-JFH1: Huh-7 cell transfected with JFH1 viral RNA, subgenomic replicon cell, full-genome replicon cell, dORF replicon cell #1, #2, dORF bla replicon cell #1, #2

Techniques Used: Construct, Northern Blot, In Vitro, Generated, Western Blot, Transfection

Density gradient analysis of supernatants. Culture supernatants were treated with RNaseA and loaded directly onto a sucrose density gradient without treatment (open square) or after NP-40 treatment (filled triangle). Quantification of HCV RNA in each fraction of supernatant from the subgenomic replicon (A) and dORF replicon (B). Analysis of concentrated culture supernatant from the subgenomic replicon (C) and dORF replicon (D). Concentrated culture supernatant from the full-genome replicon NNC#2 was also analyzed (E). Quantification of HCV core protein in each fraction of supernatant from the dORF replicon (F)
Figure Legend Snippet: Density gradient analysis of supernatants. Culture supernatants were treated with RNaseA and loaded directly onto a sucrose density gradient without treatment (open square) or after NP-40 treatment (filled triangle). Quantification of HCV RNA in each fraction of supernatant from the subgenomic replicon (A) and dORF replicon (B). Analysis of concentrated culture supernatant from the subgenomic replicon (C) and dORF replicon (D). Concentrated culture supernatant from the full-genome replicon NNC#2 was also analyzed (E). Quantification of HCV core protein in each fraction of supernatant from the dORF replicon (F)

Techniques Used:

16) Product Images from "Hepatitis C Virus Increases Free Fatty Acids Absorption and Promotes its Replication Via Down-Regulating GADD45α Expression"

Article Title: Hepatitis C Virus Increases Free Fatty Acids Absorption and Promotes its Replication Via Down-Regulating GADD45α Expression

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.899591

GADD45α plays a vital role in regulating FFA-mediated HCV replication. Huh7 cells were transfected with GADD45α siRNA, a negative control siRNA (scramble), or GADD45α over-expressed plasmid. Forty-eight hours later, GADD45α expression was identified ( A ), and cells were then infected with HCV and simultaneously treated with FFA (0.8 mM). After 72 h, the relative HCV-NS3 protein and RNA expression were detected by Western blotting and RT-PCR ( A ); intracellular lipid accumulation was detected by Bodipy-493/503 staining and visualized after 400× amplification ( B ). Results are shown as mean ±SD of three independent experiments.
Figure Legend Snippet: GADD45α plays a vital role in regulating FFA-mediated HCV replication. Huh7 cells were transfected with GADD45α siRNA, a negative control siRNA (scramble), or GADD45α over-expressed plasmid. Forty-eight hours later, GADD45α expression was identified ( A ), and cells were then infected with HCV and simultaneously treated with FFA (0.8 mM). After 72 h, the relative HCV-NS3 protein and RNA expression were detected by Western blotting and RT-PCR ( A ); intracellular lipid accumulation was detected by Bodipy-493/503 staining and visualized after 400× amplification ( B ). Results are shown as mean ±SD of three independent experiments.

Techniques Used: Transfection, Negative Control, Plasmid Preparation, Expressing, Infection, RNA Expression, Western Blot, Reverse Transcription Polymerase Chain Reaction, Staining, Amplification

FFA promotes HCV replication in Huh7 cells. Huh7 cells (2×10 5 ) were cultured in a 24-well plate to 80%–85% confluence and then co-cultured with different concentrations of FFA with or without HCV (MOI of 1.5) for 72 hours. ( A ) HCV RNA copies were quantified by RT-PCR, and NS3 protein level was detected by Western blotting. ( B ) Quantification of the GADD45α protein levels and mRNA levels in Huh7 cells. Results are shown as mean ± SD of three independent experiments.
Figure Legend Snippet: FFA promotes HCV replication in Huh7 cells. Huh7 cells (2×10 5 ) were cultured in a 24-well plate to 80%–85% confluence and then co-cultured with different concentrations of FFA with or without HCV (MOI of 1.5) for 72 hours. ( A ) HCV RNA copies were quantified by RT-PCR, and NS3 protein level was detected by Western blotting. ( B ) Quantification of the GADD45α protein levels and mRNA levels in Huh7 cells. Results are shown as mean ± SD of three independent experiments.

Techniques Used: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot

17) Product Images from "Hepatitis C virus-induced furin and thrombospondin-1 activate TGF-?1: Role of TGF-?1 in HCV replication"

Article Title: Hepatitis C virus-induced furin and thrombospondin-1 activate TGF-?1: Role of TGF-?1 in HCV replication

Journal: Virology

doi: 10.1016/j.virol.2010.12.051

(A). Effect of Furin, TSP-1 and TGF-β1 siRNAs on HCV replication. Mock-infected and HCV-infected Huh-7 cells were transfected with furin, TSP-1, and TGF-β1 siRNAs as described above. Total cellular RNA was extracted and the levels of HCV RNA was determined by quantitative RT-PCR. The data shown here represent the means ± standard deviations of at least three independent experiments performed in triplicate. * denotes p
Figure Legend Snippet: (A). Effect of Furin, TSP-1 and TGF-β1 siRNAs on HCV replication. Mock-infected and HCV-infected Huh-7 cells were transfected with furin, TSP-1, and TGF-β1 siRNAs as described above. Total cellular RNA was extracted and the levels of HCV RNA was determined by quantitative RT-PCR. The data shown here represent the means ± standard deviations of at least three independent experiments performed in triplicate. * denotes p

Techniques Used: Infection, Transfection, Quantitative RT-PCR

(A). HCV-infection induces proprotein convertases. Total cellular RNA was extracted from mock-infected and HCV-infected Huh-7 cells, followed by cDNA synthesis and quantitative RT-PCR analysis using furin, MMP-9, calpain, and TSP-1 specific primers. The data shown here represent the means ± standard deviations of at least three independent experiments performed in triplicate. * denotes p
Figure Legend Snippet: (A). HCV-infection induces proprotein convertases. Total cellular RNA was extracted from mock-infected and HCV-infected Huh-7 cells, followed by cDNA synthesis and quantitative RT-PCR analysis using furin, MMP-9, calpain, and TSP-1 specific primers. The data shown here represent the means ± standard deviations of at least three independent experiments performed in triplicate. * denotes p

Techniques Used: Infection, Quantitative RT-PCR

(A) HCV-infection induces TGF-β1. Total cellular RNA was extracted at various time points and the levels of HCV RNA was determined by quantitative RT-PCR. The data shown here represent the means ± sd of at least three independent experiments performed in triplicate. * denotes p
Figure Legend Snippet: (A) HCV-infection induces TGF-β1. Total cellular RNA was extracted at various time points and the levels of HCV RNA was determined by quantitative RT-PCR. The data shown here represent the means ± sd of at least three independent experiments performed in triplicate. * denotes p

Techniques Used: Infection, Quantitative RT-PCR

18) Product Images from "Differential hepatitis C virus RNA target site selection and host factor activities of naturally occurring miR-122 3΄ variants"

Article Title: Differential hepatitis C virus RNA target site selection and host factor activities of naturally occurring miR-122 3΄ variants

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkw1332

Natural variation in the 3΄ terminal bases of the HCV host factor, miR-122. ( A ) Base-pair interactions between miR-122 (red font) and the extreme 5΄ end of the positive-strand HCV RNA genome (black font) established in previous mutational analyses. (S1) and (S2) represent seed-match sites, SL1 indicates stem-loop 1 in the HCV 5΄UTR. Note the absence of base pairs involving the 3΄ terminal 6 nucleotides of miR-122. ( B ) The 19 most abundant miR-122-5p (guide strand) variants identified in non-malignant liver tissue from HCV-infected and non-infected human subjects ( n = 4 each). Sequences are listed according to their abundance (percent of all small RNAs sharing the core 5΄ miR-122 sequence ‘UGGAGUGUGACAAUGGUGUU’). Underlined bases represent non-templated additions and deletions. The pre-miR-122 sequence is shown at the top for comparison. Error bars represent the SEM. ( C ) Relative abundance of all miR-122 reads as the percentage of all miRNAs in HCV-infected (HCV) and non-infected (N) liver tissue. ( D ) Expanded view of the five most abundant miR-122 variants in HCV-infected versus non-infected human liver. Each symbol represents the result from an individual sample. Error bars represent SD, n = 4. ** P
Figure Legend Snippet: Natural variation in the 3΄ terminal bases of the HCV host factor, miR-122. ( A ) Base-pair interactions between miR-122 (red font) and the extreme 5΄ end of the positive-strand HCV RNA genome (black font) established in previous mutational analyses. (S1) and (S2) represent seed-match sites, SL1 indicates stem-loop 1 in the HCV 5΄UTR. Note the absence of base pairs involving the 3΄ terminal 6 nucleotides of miR-122. ( B ) The 19 most abundant miR-122-5p (guide strand) variants identified in non-malignant liver tissue from HCV-infected and non-infected human subjects ( n = 4 each). Sequences are listed according to their abundance (percent of all small RNAs sharing the core 5΄ miR-122 sequence ‘UGGAGUGUGACAAUGGUGUU’). Underlined bases represent non-templated additions and deletions. The pre-miR-122 sequence is shown at the top for comparison. Error bars represent the SEM. ( C ) Relative abundance of all miR-122 reads as the percentage of all miRNAs in HCV-infected (HCV) and non-infected (N) liver tissue. ( D ) Expanded view of the five most abundant miR-122 variants in HCV-infected versus non-infected human liver. Each symbol represents the result from an individual sample. Error bars represent SD, n = 4. ** P

Techniques Used: Infection, Sequencing

Capacity of natural miR-122 variants to promote stabilization and amplification of the HCV genome. ( A ) PH5CH8 cells were co-transfected with the replication competent, genome-length JFH1-QL/GLuc reporter virus RNA, which contains the wild-type HCV 5΄UTR sequence and the indicated wild-type 3΄ miR-122 variants. Supernatant fluids were collected at 5 h, and then 24 h intervals thereafter and assayed for GLuc activity. Results are presented as the fold-increase in GLuc relative to that in cells co-transfected with the control miRNA, miR-124. **** P
Figure Legend Snippet: Capacity of natural miR-122 variants to promote stabilization and amplification of the HCV genome. ( A ) PH5CH8 cells were co-transfected with the replication competent, genome-length JFH1-QL/GLuc reporter virus RNA, which contains the wild-type HCV 5΄UTR sequence and the indicated wild-type 3΄ miR-122 variants. Supernatant fluids were collected at 5 h, and then 24 h intervals thereafter and assayed for GLuc activity. Results are presented as the fold-increase in GLuc relative to that in cells co-transfected with the control miRNA, miR-124. **** P

Techniques Used: Amplification, Transfection, Sequencing, Activity Assay

Capacity of miR-122 variants to suppress translation of RLuc expressed by a capped reporter mRNA containing ( A ) the natural SLC7A1 (CAT1) 3΄UTR miR-122 target or ( B ) nts 1–45 of the HCV RNA genome in its 3΄UTR. Experiments were carried out in MEFs (left panels) or PH5CH8 cells (right). Results are shown as percent suppression for each miR-122 variant relative to 23–3΄Up6 that was included as a negative control. Error bars represent SEM from three independent experiments (2 for SLC7A1 tested in MEFs), each with 3–4 technical replicates. * P
Figure Legend Snippet: Capacity of miR-122 variants to suppress translation of RLuc expressed by a capped reporter mRNA containing ( A ) the natural SLC7A1 (CAT1) 3΄UTR miR-122 target or ( B ) nts 1–45 of the HCV RNA genome in its 3΄UTR. Experiments were carried out in MEFs (left panels) or PH5CH8 cells (right). Results are shown as percent suppression for each miR-122 variant relative to 23–3΄Up6 that was included as a negative control. Error bars represent SEM from three independent experiments (2 for SLC7A1 tested in MEFs), each with 3–4 technical replicates. * P

Techniques Used: Variant Assay, Negative Control

The capacity of miR-122 variants to promote HCV genome amplification correlates with their ability to bind HCV RNA as a complex with Ago2. ( A ) Schematic of the HCV GLuc reporter genome, showing insertion of GLuc2A sequence between the p7 and NS2 coding regions (see ‘Materials and Methods’ section). ( B ) Base-pair interactions between HCV RNA carrying p6m mutations in the miR-122 seed match sequences (black font, with red nucleotide substitution) and two copies of Ago2-associated miR-122p6 with complementary base substitutions (red font with black nucleotide substitution). (S1) and (S2) indicate seed-sequence interaction sites; SL1 = stem-loop 1. ( C ) H77S.3/GLuc RNA containing double S1 and S2 p6m mutations were co-transfected into Huh-7.5 cells with the indicated wild-type or mutant duplex miR-122s or the control miRNA, miR-124. Data shown represent the GLuc activity secreted into media between 48 and 72 h post-transfection. 22–3΄Gp6 is representative of the most abundant miR-122 variant (22–3΄G, see Figure 1 ), and is shaded in red here and in subsequent figures. Selected pair-wise comparisons are shown: * P
Figure Legend Snippet: The capacity of miR-122 variants to promote HCV genome amplification correlates with their ability to bind HCV RNA as a complex with Ago2. ( A ) Schematic of the HCV GLuc reporter genome, showing insertion of GLuc2A sequence between the p7 and NS2 coding regions (see ‘Materials and Methods’ section). ( B ) Base-pair interactions between HCV RNA carrying p6m mutations in the miR-122 seed match sequences (black font, with red nucleotide substitution) and two copies of Ago2-associated miR-122p6 with complementary base substitutions (red font with black nucleotide substitution). (S1) and (S2) indicate seed-sequence interaction sites; SL1 = stem-loop 1. ( C ) H77S.3/GLuc RNA containing double S1 and S2 p6m mutations were co-transfected into Huh-7.5 cells with the indicated wild-type or mutant duplex miR-122s or the control miRNA, miR-124. Data shown represent the GLuc activity secreted into media between 48 and 72 h post-transfection. 22–3΄Gp6 is representative of the most abundant miR-122 variant (22–3΄G, see Figure 1 ), and is shaded in red here and in subsequent figures. Selected pair-wise comparisons are shown: * P

Techniques Used: Amplification, Sequencing, Transfection, Mutagenesis, Activity Assay, Variant Assay

Length and composition of miR-122 3΄ terminal nucleotides are important for recruiting an Ago2 complex to the S1 site in the HCV 5΄UTR. ( A ) Ago2 complexed with the 21–3΄U miR-122 binds S2 but not S1. Lysates were prepared from wild-type MEFs co-electroporated with (left) H77S/S1p6m/AAG or (right) H77S/S2p6m/AAG RNA mixed with miR-122p6 variants, and immunoprecipitated with anti-Ago2 antibody. Ago2-associated HCV RNA was quantified with quantitative RT-PCR. Error is the SEM of triplicate experiments. Immunoblots of immunoprecipitated Ago2 are shown below. Results versus miR-124: ** P
Figure Legend Snippet: Length and composition of miR-122 3΄ terminal nucleotides are important for recruiting an Ago2 complex to the S1 site in the HCV 5΄UTR. ( A ) Ago2 complexed with the 21–3΄U miR-122 binds S2 but not S1. Lysates were prepared from wild-type MEFs co-electroporated with (left) H77S/S1p6m/AAG or (right) H77S/S2p6m/AAG RNA mixed with miR-122p6 variants, and immunoprecipitated with anti-Ago2 antibody. Ago2-associated HCV RNA was quantified with quantitative RT-PCR. Error is the SEM of triplicate experiments. Immunoblots of immunoprecipitated Ago2 are shown below. Results versus miR-124: ** P

Techniques Used: Immunoprecipitation, Quantitative RT-PCR, Western Blot

19) Product Images from "Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs"

Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

Journal: Journal of Virology

doi: 10.1128/JVI.00503-18

Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Transduction, shRNA, Transfection, Plasmid Preparation, Expressing, Infection, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, In Vitro, Synthesized, Construct, Positive Control

Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P

Techniques Used: shRNA, Sequencing, Expressing, Plasmid Preparation, CRISPR, Clone Assay, Isolation, Knock-Out, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Transduction

Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Infection, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Activity Assay

Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Transduction, shRNA, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Clone Assay, Derivative Assay, Plasmid Preparation, Transfection

miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Infection, Transfection, Expressing, Western Blot, Real-time Polymerase Chain Reaction

20) Product Images from "Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs"

Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

Journal: Journal of Virology

doi: 10.1128/JVI.00503-18

Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Transduction, shRNA, Transfection, Plasmid Preparation, Expressing, Infection, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, In Vitro, Synthesized, Construct, Positive Control

Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P

Techniques Used: shRNA, Sequencing, Expressing, Plasmid Preparation, CRISPR, Clone Assay, Isolation, Knock-Out, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Transduction

Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Infection, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Activity Assay

Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Transduction, shRNA, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Clone Assay, Derivative Assay, Plasmid Preparation, Transfection

miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P
Figure Legend Snippet: miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P

Techniques Used: Infection, Transfection, Expressing, Western Blot, Real-time Polymerase Chain Reaction

21) Product Images from "Cas9-mediated targeting of viral RNA in eukaryotic cells"

Article Title: Cas9-mediated targeting of viral RNA in eukaryotic cells

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1422340112

FnCas9 targets and associates with HCV RNA. Huh-7.5 cells producing an HA epitope-tagged FnCas9 alone, or with either the 5′ UTR targeting rgRNA or the control rgRNA, were infected with HCV. At 72 h postinfection, lysates were immunoprecipitated with anti-HA. Coprecipitating RNA was purified and analyzed by quantitative real-time PCR to detect the relative enrichment of the ( A ) 5′ UTR rgRNA, ( B ) HCV RNA, or ( C ) control rgRNA, normalizing to gapdh mRNA levels ( n = 4; bars represent the SEM; data are representative of three experiments).
Figure Legend Snippet: FnCas9 targets and associates with HCV RNA. Huh-7.5 cells producing an HA epitope-tagged FnCas9 alone, or with either the 5′ UTR targeting rgRNA or the control rgRNA, were infected with HCV. At 72 h postinfection, lysates were immunoprecipitated with anti-HA. Coprecipitating RNA was purified and analyzed by quantitative real-time PCR to detect the relative enrichment of the ( A ) 5′ UTR rgRNA, ( B ) HCV RNA, or ( C ) control rgRNA, normalizing to gapdh mRNA levels ( n = 4; bars represent the SEM; data are representative of three experiments).

Techniques Used: Infection, Immunoprecipitation, Purification, Real-time Polymerase Chain Reaction

FnCas9 can be reprogrammed to inhibit viral protein production in eukaryotic cells. ( A ) rgRNA schematic with targeting sequences (gray highlight) against the 5′ or 3′ UTR of HCV genomic RNA. ( B ) Huh-7.5 cells were transfected with the indicated combinations of FnCas9 and rgRNA and infected 48 h later with HCV encoding Renilla luciferase. At 72 h, cells were fixed and stained with anti-E2 antibody and imaged. ( C ) E2-positive foci from B were quantified and plotted as percent inhibition compared with the vector control. ( D ) Quantification of viral luciferase production displayed as percent inhibition compared with the vector control ( n = 3; bars represent the SEM; data are representative of at least six experiments).
Figure Legend Snippet: FnCas9 can be reprogrammed to inhibit viral protein production in eukaryotic cells. ( A ) rgRNA schematic with targeting sequences (gray highlight) against the 5′ or 3′ UTR of HCV genomic RNA. ( B ) Huh-7.5 cells were transfected with the indicated combinations of FnCas9 and rgRNA and infected 48 h later with HCV encoding Renilla luciferase. At 72 h, cells were fixed and stained with anti-E2 antibody and imaged. ( C ) E2-positive foci from B were quantified and plotted as percent inhibition compared with the vector control. ( D ) Quantification of viral luciferase production displayed as percent inhibition compared with the vector control ( n = 3; bars represent the SEM; data are representative of at least six experiments).

Techniques Used: Transfection, Infection, Luciferase, Staining, Inhibition, Plasmid Preparation

RNA sequence requirements for FnCas9 inhibition of HCV. ( A ) Huh-7.5 cells were transfected with FnCas9 using the rgRNA mutants in the indicated shifted alignments. At 72 h, viral luciferase was quantified and the percent inhibition compared with the nontargeting rgRNA is displayed ( n = 12; data are compiled from three independent experiments). ( B ) Experiments were performed as above, using the mutants in the 3′ region indicated in the alignment below the figure ( n = 12; bars represent the SEM; data are compiled from three independent experiments). ( C ) Experiments were performed as above, using the mutants in the 5′ region indicated in the alignment below the figure ( n = 12; bars represent the SEM; data are compiled from three independent experiments).
Figure Legend Snippet: RNA sequence requirements for FnCas9 inhibition of HCV. ( A ) Huh-7.5 cells were transfected with FnCas9 using the rgRNA mutants in the indicated shifted alignments. At 72 h, viral luciferase was quantified and the percent inhibition compared with the nontargeting rgRNA is displayed ( n = 12; data are compiled from three independent experiments). ( B ) Experiments were performed as above, using the mutants in the 3′ region indicated in the alignment below the figure ( n = 12; bars represent the SEM; data are compiled from three independent experiments). ( C ) Experiments were performed as above, using the mutants in the 5′ region indicated in the alignment below the figure ( n = 12; bars represent the SEM; data are compiled from three independent experiments).

Techniques Used: Sequencing, Inhibition, Transfection, Luciferase

22) Product Images from "Modulation of Hepatitis C Virus RNA Abundance and Virus Release by Dispersion of Processing Bodies and Enrichment of Stress Granules"

Article Title: Modulation of Hepatitis C Virus RNA Abundance and Virus Release by Dispersion of Processing Bodies and Enrichment of Stress Granules

Journal: Virology

doi: 10.1016/j.virol.2012.10.027

Effects of depletion of P-body proteins on JFH-1 protein and RNA abundances Huh7 cells were depleted of P-body proteins and infected with JFH-1 virus. (A) Abundances of HCV NS5A and core proteins, and P-body proteins RCK/p54, Lsm1, Dcp2, Ge-1, Xrn1, Ago2, GW182, Upf1 and Exo10 during JFH-1 infection were examined by western blot analysis. Transfection reagent alone (no siRNA) and the transfection of a RISC-free siRNA were included as controls. (B) Abundances of HCV RNA and miR-122. Representative northern blots are shown. Actin mRNA and U6 snRNA were used as RNA loading controls. (C) Quantitation of HCV RNA. HCV RNA abundances were normalized to actin mRNA and to control RISC-free siRNA. Mean values and standard deviations from three independent experiments are shown.
Figure Legend Snippet: Effects of depletion of P-body proteins on JFH-1 protein and RNA abundances Huh7 cells were depleted of P-body proteins and infected with JFH-1 virus. (A) Abundances of HCV NS5A and core proteins, and P-body proteins RCK/p54, Lsm1, Dcp2, Ge-1, Xrn1, Ago2, GW182, Upf1 and Exo10 during JFH-1 infection were examined by western blot analysis. Transfection reagent alone (no siRNA) and the transfection of a RISC-free siRNA were included as controls. (B) Abundances of HCV RNA and miR-122. Representative northern blots are shown. Actin mRNA and U6 snRNA were used as RNA loading controls. (C) Quantitation of HCV RNA. HCV RNA abundances were normalized to actin mRNA and to control RISC-free siRNA. Mean values and standard deviations from three independent experiments are shown.

Techniques Used: Infection, Western Blot, Transfection, Northern Blot, Quantitation Assay

Effects of depletion of stress granule proteins on JFH-1 protein and RNA abundances (A) Abundances of stress granule proteins TIA-1, G3BP1, HuR, Ataxin2, USP10 and OGFOD1, and viral NS5A and core after siRNA-mediated depletion of stress granule proteins and JFH-1 infection. Western blots are shown. Transfection reagent alone (no siRNA) and the transfection of a RISC-free siRNA were included as controls. The abundance of GAPDH serves as a loading control. (B) Abundances of HCV RNA and miR-122 during depletion of stress granule proteins. Representative northern blots are shown. Actin mRNA and U6 snRNA were used as RNA loading controls. (C) Quantitation of HCV RNA. HCV RNA abundances were normalized to actin mRNA and to RISC-free siRNA. Mean values and standard deviations from three independent experiments are shown.
Figure Legend Snippet: Effects of depletion of stress granule proteins on JFH-1 protein and RNA abundances (A) Abundances of stress granule proteins TIA-1, G3BP1, HuR, Ataxin2, USP10 and OGFOD1, and viral NS5A and core after siRNA-mediated depletion of stress granule proteins and JFH-1 infection. Western blots are shown. Transfection reagent alone (no siRNA) and the transfection of a RISC-free siRNA were included as controls. The abundance of GAPDH serves as a loading control. (B) Abundances of HCV RNA and miR-122 during depletion of stress granule proteins. Representative northern blots are shown. Actin mRNA and U6 snRNA were used as RNA loading controls. (C) Quantitation of HCV RNA. HCV RNA abundances were normalized to actin mRNA and to RISC-free siRNA. Mean values and standard deviations from three independent experiments are shown.

Techniques Used: Infection, Western Blot, Transfection, Northern Blot, Quantitation Assay

23) Product Images from "Regulation of Hepatitis C Virus Translation and Infectious Virus Production by the MicroRNA miR-122 ▿"

Article Title: Regulation of Hepatitis C Virus Translation and Infectious Virus Production by the MicroRNA miR-122 ▿

Journal: Journal of Virology

doi: 10.1128/JVI.00417-10

The replication of infectious HCV is dependent on direct interaction of miR-122 with the RNA genome. (A) Schematic representation of the two miR-122-binding sites, S1 and S2, located between stem-loop (SL) I and II in the 5′UTR of the HJ3-5 genome.
Figure Legend Snippet: The replication of infectious HCV is dependent on direct interaction of miR-122 with the RNA genome. (A) Schematic representation of the two miR-122-binding sites, S1 and S2, located between stem-loop (SL) I and II in the 5′UTR of the HJ3-5 genome.

Techniques Used: Binding Assay

24) Product Images from "HCV RNA decline in the first 24 hours exhibits high negative predictive value of sustained virologic response in HIV/HCV genotype 1 co-infected patients treated with peginterferon and ribavirin"

Article Title: HCV RNA decline in the first 24 hours exhibits high negative predictive value of sustained virologic response in HIV/HCV genotype 1 co-infected patients treated with peginterferon and ribavirin

Journal: Antiviral research

doi: 10.1016/j.antiviral.2011.02.013

Area under the receiver operating characteristic curve, to evaluate the performance of HCV-RNA log 10 decay at 24h with sustained virological response as the state variable.
Figure Legend Snippet: Area under the receiver operating characteristic curve, to evaluate the performance of HCV-RNA log 10 decay at 24h with sustained virological response as the state variable.

Techniques Used:

25) Product Images from "Identification of a Functional, CRM-1-Dependent Nuclear Export Signal in Hepatitis C Virus Core Protein"

Article Title: Identification of a Functional, CRM-1-Dependent Nuclear Export Signal in Hepatitis C Virus Core Protein

Journal: PLoS ONE

doi: 10.1371/journal.pone.0025854

LMB treatment influences virus production. (A). Cells were treated with 10 ng/ml LMB for various time periods to determine the incubation time required to affect infection. Cells were infected with HCVcc (JFH1) and the drug was added immediately after infection. Cells were grown in the medium containing LMB, for the time indicated and HCV RNA was then extracted and quantified by RT-qPCR. The values are expressed as a percent of the amount of HCV RNA present in cells grown without LMB. (B). Control experiments carried out to demonstrate that the incubation of cells for 2–8 h with 10 ng/ml LMB (shown in (A) had no toxic effect on cell viability. Cell viability after LMB treatments was determined by counting live and dead cells after trypan blue staining, or by measuring cellular ATP present in culture wells as described in Materials and Methods . Untreated cells and cells treated with 10% DMSO (to induce cell death) were used as negative and positive controls, respectively. The results are expressed as a percent of the value obtained for an untreated control. (C). Treatment with LMB early in infection significantly decreases infection levels. Cells were infected with HCVcc 2 h at 37°C in the presence of 10 ng/ml LMB (T0) or infected with HCVcc and then treated with the drug at the indicated time points after infection (2 h, 4 h, or 6 h) and then incubated for a further 8 h. The treatment of cells with LMB 0–6 h post infection significantly decreases infection levels, whereas the same treatment (for 8 h) applied 24 h after infection has no effect on intracellular HCV RNA levels, as shown by comparison with the untreated control. (D) Control experiments for (C) showing that the application of LMB or its solvent (ethanol) at the same concentrations and for the same time period as used for (C) does not influence cell viability, as demonstrated by comparison with an untreated control. DMSO (at a concentration of 10%) was used as a positive control, to decrease cell viability. Values are expressed as a percent of untreated control.
Figure Legend Snippet: LMB treatment influences virus production. (A). Cells were treated with 10 ng/ml LMB for various time periods to determine the incubation time required to affect infection. Cells were infected with HCVcc (JFH1) and the drug was added immediately after infection. Cells were grown in the medium containing LMB, for the time indicated and HCV RNA was then extracted and quantified by RT-qPCR. The values are expressed as a percent of the amount of HCV RNA present in cells grown without LMB. (B). Control experiments carried out to demonstrate that the incubation of cells for 2–8 h with 10 ng/ml LMB (shown in (A) had no toxic effect on cell viability. Cell viability after LMB treatments was determined by counting live and dead cells after trypan blue staining, or by measuring cellular ATP present in culture wells as described in Materials and Methods . Untreated cells and cells treated with 10% DMSO (to induce cell death) were used as negative and positive controls, respectively. The results are expressed as a percent of the value obtained for an untreated control. (C). Treatment with LMB early in infection significantly decreases infection levels. Cells were infected with HCVcc 2 h at 37°C in the presence of 10 ng/ml LMB (T0) or infected with HCVcc and then treated with the drug at the indicated time points after infection (2 h, 4 h, or 6 h) and then incubated for a further 8 h. The treatment of cells with LMB 0–6 h post infection significantly decreases infection levels, whereas the same treatment (for 8 h) applied 24 h after infection has no effect on intracellular HCV RNA levels, as shown by comparison with the untreated control. (D) Control experiments for (C) showing that the application of LMB or its solvent (ethanol) at the same concentrations and for the same time period as used for (C) does not influence cell viability, as demonstrated by comparison with an untreated control. DMSO (at a concentration of 10%) was used as a positive control, to decrease cell viability. Values are expressed as a percent of untreated control.

Techniques Used: Incubation, Infection, Quantitative RT-PCR, Staining, Concentration Assay, Positive Control

Schematic diagram of structural and functional domains within the HCV core protein. The RNA-binding region aa(1–57), the three nuclear localization signals (NLS), and the classical NES aa(179–187) and the candidate “non classical” NES aa(109–133) identified in this study are shown. Numbers identify the aa positions covered by each domain and functional region.
Figure Legend Snippet: Schematic diagram of structural and functional domains within the HCV core protein. The RNA-binding region aa(1–57), the three nuclear localization signals (NLS), and the classical NES aa(179–187) and the candidate “non classical” NES aa(109–133) identified in this study are shown. Numbers identify the aa positions covered by each domain and functional region.

Techniques Used: Functional Assay, RNA Binding Assay

Cytoplasmic localization of core in HCV-infected cells by immunofluorescence without LMB treatment. (A) Silencing of the proteasome activator PA28γ . Huh 7.5 cells were transfected with an siRNA targeting PA28γ or a control non targeting siRNA 18 h before infection with JFH1. For analysis of the expression of PA28γ by immunofluorescence, cells were stained with rabbit anti-PA28γ antibody, followed by Alexa Fluor 488-conjugated anti-rabbit IgG. Staining for HCV core was carried out 48 h after infection, with the monoclonal anti-core antibody ACAP-27, followed by Alexa Fluor 568-tagged anti-mouse IgG (in red). (a) Non treated HCV (JFH1)-infected Huh 7.5 cells; (b) HCV-infected cells transfected with control, non-targeting siRNA before infection; (c) cells with PA28γ knockdown due to transfection with a specific PA28γ-targeting siRNA. (B) Expression of core in Huh7.5 cells after silencing of the PA28γ proteasome activator. JFH1-infected cells were stained with rabbit anti-lamin B antibody and Alexa Fluor 488-conjugated anti-rabbit IgG as a secondary antibody, to outline the cell nuclei, and with ACAP27 anti-core antibody followed by Alexa Fluor 568-conjugated anti-mouse IgG, for subcellular localization of HCV core. (d) JFH1-infected Huh 7.5 cells without PA28γ silencing, (corresponding to the image shown in (a) panel A); (e) HCV-infected cells transfected with control, non-targeting siRNA before infection (corresponding to the image shown in (b) panel A); and (f) cells with PA28γ knockdown with a PA28γ-specific siRNA before infection with HCV (corresponding to (c) in panel A). Staining of the nuclear membrane with anti-lamin B (green) and with anti-core antibody (red), as described above. No nuclear staining of core was detected, in either siRNA-silenced cells or in cells transfected with a control si-RNA.
Figure Legend Snippet: Cytoplasmic localization of core in HCV-infected cells by immunofluorescence without LMB treatment. (A) Silencing of the proteasome activator PA28γ . Huh 7.5 cells were transfected with an siRNA targeting PA28γ or a control non targeting siRNA 18 h before infection with JFH1. For analysis of the expression of PA28γ by immunofluorescence, cells were stained with rabbit anti-PA28γ antibody, followed by Alexa Fluor 488-conjugated anti-rabbit IgG. Staining for HCV core was carried out 48 h after infection, with the monoclonal anti-core antibody ACAP-27, followed by Alexa Fluor 568-tagged anti-mouse IgG (in red). (a) Non treated HCV (JFH1)-infected Huh 7.5 cells; (b) HCV-infected cells transfected with control, non-targeting siRNA before infection; (c) cells with PA28γ knockdown due to transfection with a specific PA28γ-targeting siRNA. (B) Expression of core in Huh7.5 cells after silencing of the PA28γ proteasome activator. JFH1-infected cells were stained with rabbit anti-lamin B antibody and Alexa Fluor 488-conjugated anti-rabbit IgG as a secondary antibody, to outline the cell nuclei, and with ACAP27 anti-core antibody followed by Alexa Fluor 568-conjugated anti-mouse IgG, for subcellular localization of HCV core. (d) JFH1-infected Huh 7.5 cells without PA28γ silencing, (corresponding to the image shown in (a) panel A); (e) HCV-infected cells transfected with control, non-targeting siRNA before infection (corresponding to the image shown in (b) panel A); and (f) cells with PA28γ knockdown with a PA28γ-specific siRNA before infection with HCV (corresponding to (c) in panel A). Staining of the nuclear membrane with anti-lamin B (green) and with anti-core antibody (red), as described above. No nuclear staining of core was detected, in either siRNA-silenced cells or in cells transfected with a control si-RNA.

Techniques Used: Infection, Immunofluorescence, Transfection, Expressing, Staining

26) Product Images from "Trace amounts of sporadically reappearing HCV RNA can cause infection"

Article Title: Trace amounts of sporadically reappearing HCV RNA can cause infection

Journal: The Journal of Clinical Investigation

doi: 10.1172/JCI73104

Trace amounts of HCV RNA that sporadically reappear in patients after successful antiviral therapy can transmit HCV infection.
Figure Legend Snippet: Trace amounts of HCV RNA that sporadically reappear in patients after successful antiviral therapy can transmit HCV infection.

Techniques Used: Infection

27) Product Images from "TNF-α Induced by Hepatitis C Virus via TLR7 and TLR8 in Hepatocytes Supports Interferon Signaling via an Autocrine Mechanism"

Article Title: TNF-α Induced by Hepatitis C Virus via TLR7 and TLR8 in Hepatocytes Supports Interferon Signaling via an Autocrine Mechanism

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1004937

Induction analysis of TNF-α by HCV at early time points. (A) The time-course analysis of TNF-α induction by HCV. Huh7 cells were infected with HCV (MOI = 2) for 0, 1, 2, 4, 8, and 24 hours and then lysed for the isolation of total RNA, which was analyzed for TNF-α and actin RNAs by semi-quantitative RT-PCR. (B) The induction of TNF-α by HCV using the MOI of 0.25 and 1 was analyzed by qRT-PCR. (C) Huh7 cells were infected with HCV (MOI = 1) that had been pre-incubated with the isotype control antibody or the anti-E2 antibody at 4°C for 1 hour [ 13 ]. The total cellular RNA was isolated at 2 hours post-infection for qRT-PCR analysis of TNF-α RNA. TNF-α RNA induced by HCV that was treated with the isotype antibody control was arbitrarily defined as 100%. (D) Effect of actinomycin D on TNF-α induction by HCV. Huh7 cells were pretreated with DMSO or actinomycin D (5 μg/ ml) for 1 hour. Cells were then infected with HCV (MOI = 1) for 2 hours. Total cellular RNA was isolated for qRT-PCR analysis to assess TNF-α induction. TNF-α RNA induced by HCV in cells treated with DMSO was arbitrarily defined as 100%. (E) UV-inactivation of HCV. HCV (MOI = 1), with or without UV-irradiation for 5 minutes, was used to infect Huh7 cells. Cells were lysed at 2 hours and 24 hours post-infection for qRT-PCR analysis of TNF-α RNA. TNF-α RNA induced by HCV at 2 hours post-infection without UV treatment was arbitrarily defined as 100%. *, p
Figure Legend Snippet: Induction analysis of TNF-α by HCV at early time points. (A) The time-course analysis of TNF-α induction by HCV. Huh7 cells were infected with HCV (MOI = 2) for 0, 1, 2, 4, 8, and 24 hours and then lysed for the isolation of total RNA, which was analyzed for TNF-α and actin RNAs by semi-quantitative RT-PCR. (B) The induction of TNF-α by HCV using the MOI of 0.25 and 1 was analyzed by qRT-PCR. (C) Huh7 cells were infected with HCV (MOI = 1) that had been pre-incubated with the isotype control antibody or the anti-E2 antibody at 4°C for 1 hour [ 13 ]. The total cellular RNA was isolated at 2 hours post-infection for qRT-PCR analysis of TNF-α RNA. TNF-α RNA induced by HCV that was treated with the isotype antibody control was arbitrarily defined as 100%. (D) Effect of actinomycin D on TNF-α induction by HCV. Huh7 cells were pretreated with DMSO or actinomycin D (5 μg/ ml) for 1 hour. Cells were then infected with HCV (MOI = 1) for 2 hours. Total cellular RNA was isolated for qRT-PCR analysis to assess TNF-α induction. TNF-α RNA induced by HCV in cells treated with DMSO was arbitrarily defined as 100%. (E) UV-inactivation of HCV. HCV (MOI = 1), with or without UV-irradiation for 5 minutes, was used to infect Huh7 cells. Cells were lysed at 2 hours and 24 hours post-infection for qRT-PCR analysis of TNF-α RNA. TNF-α RNA induced by HCV at 2 hours post-infection without UV treatment was arbitrarily defined as 100%. *, p

Techniques Used: Infection, Isolation, Quantitative RT-PCR, Incubation, Irradiation

TNF-α knockdown enhanced HCV replication. (A-B) Huh7 cells were transfected with the negative control (NC) siRNA or TNF-α siRNA. After 48 hours, cells were transfected with the same set of siRNA for the second time for 6 hours before the HCV infection (MOI = 0.25) for 48 hours. The knockdown efficiency of TNF-α is shown in S12 Fig . (A) Real-time RT-PCR analysis of intracellular HCV RNA is shown in the histogram on the top. (Data are represented as mean ± SD). Immunoblot analysis of the HCV core protein and GAPDH are shown in the bottom two panels. (B) Immunofluorescence analysis of HCV titers. Naïve Huh7 cells were incubated for 20 hours with the conditioned media harvested from mock- or HCV-infected cells. Cells were then fixed and immunofluorescence stained for the HCV core protein. DAPI was used to stain nuclei. (C) Loss of TNFR1 in HCV-infected cells. Huh7 cells infected by HCV (MOI = 1) were lysed at the time points indicated and analyzed by immunoblot for TNFR1, HCV core protein and GAPDH. (D) Effect of Bafilomycin A1 (BafA1) on TNFR1. Huh7 cells without (left 3 lanes) or with HCV infection (MOI = 0.25) for 24 hours (right 3 lanes) were either not treated or treated with DMSO (D) or 200 nM Bafilomycin A1 (Baf) for additional 16 hours. Cells were then lysed for immunoblot analysis. GAPDH served as a loading control. (E) Effect of TNFR1 on HCV replication. Huh7 cells transfected with the control siRNA or the TNFR1 siRNA were infected with HCV (MOI = 0.25) and lysed at 48 hours post-infection for real-time RT-PCR analysis of HCV RNA (top panel, data represented as mean ± SD) and immunoblot analysis of TNFR1, the HCV core protein and GAPDH. *, p
Figure Legend Snippet: TNF-α knockdown enhanced HCV replication. (A-B) Huh7 cells were transfected with the negative control (NC) siRNA or TNF-α siRNA. After 48 hours, cells were transfected with the same set of siRNA for the second time for 6 hours before the HCV infection (MOI = 0.25) for 48 hours. The knockdown efficiency of TNF-α is shown in S12 Fig . (A) Real-time RT-PCR analysis of intracellular HCV RNA is shown in the histogram on the top. (Data are represented as mean ± SD). Immunoblot analysis of the HCV core protein and GAPDH are shown in the bottom two panels. (B) Immunofluorescence analysis of HCV titers. Naïve Huh7 cells were incubated for 20 hours with the conditioned media harvested from mock- or HCV-infected cells. Cells were then fixed and immunofluorescence stained for the HCV core protein. DAPI was used to stain nuclei. (C) Loss of TNFR1 in HCV-infected cells. Huh7 cells infected by HCV (MOI = 1) were lysed at the time points indicated and analyzed by immunoblot for TNFR1, HCV core protein and GAPDH. (D) Effect of Bafilomycin A1 (BafA1) on TNFR1. Huh7 cells without (left 3 lanes) or with HCV infection (MOI = 0.25) for 24 hours (right 3 lanes) were either not treated or treated with DMSO (D) or 200 nM Bafilomycin A1 (Baf) for additional 16 hours. Cells were then lysed for immunoblot analysis. GAPDH served as a loading control. (E) Effect of TNFR1 on HCV replication. Huh7 cells transfected with the control siRNA or the TNFR1 siRNA were infected with HCV (MOI = 0.25) and lysed at 48 hours post-infection for real-time RT-PCR analysis of HCV RNA (top panel, data represented as mean ± SD) and immunoblot analysis of TNFR1, the HCV core protein and GAPDH. *, p

Techniques Used: Transfection, Negative Control, Infection, Quantitative RT-PCR, Immunofluorescence, Incubation, Staining

Induction of TNF-α by HCV is dependent on the endocytic pathway. Huh7 cells were pre-treated with 75 μM Dynasore (A), 100 μM Chloroquine (B), or the vehicle DMSO for 1 hour and during HCV infection (MOI = 0.25). Total cellular RNA was isolated at 2 hours post-infection for semi-quantitative RT-PCR analysis.
Figure Legend Snippet: Induction of TNF-α by HCV is dependent on the endocytic pathway. Huh7 cells were pre-treated with 75 μM Dynasore (A), 100 μM Chloroquine (B), or the vehicle DMSO for 1 hour and during HCV infection (MOI = 0.25). Total cellular RNA was isolated at 2 hours post-infection for semi-quantitative RT-PCR analysis.

Techniques Used: Infection, Isolation, Quantitative RT-PCR

TNF-α induction by HCV is dependent on the TLR7 and TLR8 signaling pathway. (A) Huh7 cells were transfected with negative control (NC) siRNA or siRNAs targeting TLR7 and TLR8 for 6 hours, after which the siRNA complex was removed. At 48 hours post transfection, cells were mock-infected (-) or HCV-infected (+) (MOI = 1) for 2 hours. Total cellular RNA was then isolated and subjected to qRT-PCR for the analysis of TNF-α RNA (left panel). The knockdown efficiency of TLR7 and TLR8 was measured by semi-quantitative RT-PCR using actin RNA as a control (right panel). *, p
Figure Legend Snippet: TNF-α induction by HCV is dependent on the TLR7 and TLR8 signaling pathway. (A) Huh7 cells were transfected with negative control (NC) siRNA or siRNAs targeting TLR7 and TLR8 for 6 hours, after which the siRNA complex was removed. At 48 hours post transfection, cells were mock-infected (-) or HCV-infected (+) (MOI = 1) for 2 hours. Total cellular RNA was then isolated and subjected to qRT-PCR for the analysis of TNF-α RNA (left panel). The knockdown efficiency of TLR7 and TLR8 was measured by semi-quantitative RT-PCR using actin RNA as a control (right panel). *, p

Techniques Used: Transfection, Negative Control, Infection, Isolation, Quantitative RT-PCR

Induction of TNF-α by HCV. (A) Quantification of TNF-α in the culture media. Huh7 cells were infected with HCV (MOI = 0.25) and the culture media were collected at 0, 24, 48, and 72 hours post-infection. The level of TNF-α in the media was determined by ELISA and the TNF-α RNA in the cells were quantified by qRT-PCR. Bars indicate standard deviations calculated from three independent experiments. (B) Immunoblot analysis of TNF-α induction by HCV. Huh7 cells were infected with HCV using MOI of 0, 0.1, 0.25, 1 or 2 for 24 hours. Cells were then lysed for immunoblot analysis of TNF-α and the HCV core protein. GAPDH served as the loading control. (C) Induction of TNF-α in primary human hepatocytes (PHHs) by HCV. PHHs with or without HCV infection (MOI = 0.25) for 24 hours were lysed for analysis. Top two panels, semi-quantitative RT-PCR analysis of the TNF-α RNA and the actin RNA; bottom two panels, immunoblot analysis of the HCV core protein and α-actin.
Figure Legend Snippet: Induction of TNF-α by HCV. (A) Quantification of TNF-α in the culture media. Huh7 cells were infected with HCV (MOI = 0.25) and the culture media were collected at 0, 24, 48, and 72 hours post-infection. The level of TNF-α in the media was determined by ELISA and the TNF-α RNA in the cells were quantified by qRT-PCR. Bars indicate standard deviations calculated from three independent experiments. (B) Immunoblot analysis of TNF-α induction by HCV. Huh7 cells were infected with HCV using MOI of 0, 0.1, 0.25, 1 or 2 for 24 hours. Cells were then lysed for immunoblot analysis of TNF-α and the HCV core protein. GAPDH served as the loading control. (C) Induction of TNF-α in primary human hepatocytes (PHHs) by HCV. PHHs with or without HCV infection (MOI = 0.25) for 24 hours were lysed for analysis. Top two panels, semi-quantitative RT-PCR analysis of the TNF-α RNA and the actin RNA; bottom two panels, immunoblot analysis of the HCV core protein and α-actin.

Techniques Used: Infection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

HCV-induced TNF-α by activating NF-κB. (A) Subcellular fractionation analysis of p65 NF-κB. Huh7 cells were mock-infected or HCV-infected (MOI = 1) for 2 hours and then subjected to subcellular fractionation as described in Materials and Methods . The subcellular localization of p65 NF-κB was then analyzed by immunoblot. GAPDH and the nuclear matrix protein p84 were used as markers to monitor the subcellular fractionation efficiency. (B) ChIP analysis for binding of NF-κB to the TNF-α promoter. Huh7 cells were infected with HCV (MOI = 1) for 2 or 24 hours followed by ChIP analysis using the anti-p65 antibody or a control IgG. Input, total TNF-α DNA without the immunoprecipitation. (C) p65 NF-κB knockdown experiment. Huh7 cells were transfected with the negative control (NC) siRNA or siRNA targeting p65 NF-κB followed by infection with HCV (MOI = 1) for 2 hours or 24 hours. Total cellular RNA was subjected to RT-PCR for analysis of TNF-α expression (left panel). The knockdown efficiency of p65 NF-κB was monitored by immunoblot, with GAPDH serving as the loading control (right panel). *, p = 0.0003, **, p = 0.002. (D) Effect of Bay-11-7085 on TNF-α expression. Huh7 cells were pre-treated with DMSO or 8μM Bay-11-7085 for 1 hour prior to infection with HCV (MOI = 1). Cells were then lysed at the time points indicated for semi-quantitative RT-PCR analysis of TNF-α RNA.
Figure Legend Snippet: HCV-induced TNF-α by activating NF-κB. (A) Subcellular fractionation analysis of p65 NF-κB. Huh7 cells were mock-infected or HCV-infected (MOI = 1) for 2 hours and then subjected to subcellular fractionation as described in Materials and Methods . The subcellular localization of p65 NF-κB was then analyzed by immunoblot. GAPDH and the nuclear matrix protein p84 were used as markers to monitor the subcellular fractionation efficiency. (B) ChIP analysis for binding of NF-κB to the TNF-α promoter. Huh7 cells were infected with HCV (MOI = 1) for 2 or 24 hours followed by ChIP analysis using the anti-p65 antibody or a control IgG. Input, total TNF-α DNA without the immunoprecipitation. (C) p65 NF-κB knockdown experiment. Huh7 cells were transfected with the negative control (NC) siRNA or siRNA targeting p65 NF-κB followed by infection with HCV (MOI = 1) for 2 hours or 24 hours. Total cellular RNA was subjected to RT-PCR for analysis of TNF-α expression (left panel). The knockdown efficiency of p65 NF-κB was monitored by immunoblot, with GAPDH serving as the loading control (right panel). *, p = 0.0003, **, p = 0.002. (D) Effect of Bay-11-7085 on TNF-α expression. Huh7 cells were pre-treated with DMSO or 8μM Bay-11-7085 for 1 hour prior to infection with HCV (MOI = 1). Cells were then lysed at the time points indicated for semi-quantitative RT-PCR analysis of TNF-α RNA.

Techniques Used: Fractionation, Infection, Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Transfection, Negative Control, Reverse Transcription Polymerase Chain Reaction, Expressing, Quantitative RT-PCR

28) Product Images from "Osteopontin Regulates Hepatitis C Virus (HCV) Replication and Assembly by Interacting with HCV Proteins and Lipid Droplets and by Binding to Receptors αVβ3 and CD44"

Article Title: Osteopontin Regulates Hepatitis C Virus (HCV) Replication and Assembly by Interacting with HCV Proteins and Lipid Droplets and by Binding to Receptors αVβ3 and CD44

Journal: Journal of Virology

doi: 10.1128/JVI.02116-17

Exogenous recombinant OPN (rOPN) stimulates HCV replication, infectivity, and assembly. (A) HCV-infected Huh7.5 cells (day 4) were transfected with sicontrol, siCD44, and siβ3. At 24 h post-siRNA transfection, cells were incubated with rOPN (50 nM) for another 48 h. Total RNA was extracted and HCV copy number was analyzed using quantitative RT-PCR. Data represent means ± SDs from three independent experiments performed in duplicate. *, P
Figure Legend Snippet: Exogenous recombinant OPN (rOPN) stimulates HCV replication, infectivity, and assembly. (A) HCV-infected Huh7.5 cells (day 4) were transfected with sicontrol, siCD44, and siβ3. At 24 h post-siRNA transfection, cells were incubated with rOPN (50 nM) for another 48 h. Total RNA was extracted and HCV copy number was analyzed using quantitative RT-PCR. Data represent means ± SDs from three independent experiments performed in duplicate. *, P

Techniques Used: Recombinant, Infection, Transfection, Incubation, Quantitative RT-PCR

OPN knockdown reduces HCV assembly/release and infectivity. (A) Uninfected and HCV-infected Huh7.5 cells (day 4) were transfected with sicontrol and siOPN, and the knockdown efficiency was analyzed by calculating the fold change in downregulation of OPN protein at the indicated time points by Western blot assay. (B) The supernatants from panel A collected at 24 h, 48 h, and 72 h were used to infect the naive Huh7.5 cells, followed by immunofluorescence staining for the HCV-NS5A protein to calculate the FFU. (C) The graph shows the log viral infectivity titers, obtained from the supernatants collected at the indicated time points upon OPN knockdown. (D) Quantitative real-time RT-PCR was performed from the supernatants (500 μl) used to infect naive Huh7.5 cells in panel B, to obtain the HCV RNA copy numbers in siOPN compared to sicontrol cells. RT-PCR data represent means ± SDs from experiments performed in duplicate. *, P
Figure Legend Snippet: OPN knockdown reduces HCV assembly/release and infectivity. (A) Uninfected and HCV-infected Huh7.5 cells (day 4) were transfected with sicontrol and siOPN, and the knockdown efficiency was analyzed by calculating the fold change in downregulation of OPN protein at the indicated time points by Western blot assay. (B) The supernatants from panel A collected at 24 h, 48 h, and 72 h were used to infect the naive Huh7.5 cells, followed by immunofluorescence staining for the HCV-NS5A protein to calculate the FFU. (C) The graph shows the log viral infectivity titers, obtained from the supernatants collected at the indicated time points upon OPN knockdown. (D) Quantitative real-time RT-PCR was performed from the supernatants (500 μl) used to infect naive Huh7.5 cells in panel B, to obtain the HCV RNA copy numbers in siOPN compared to sicontrol cells. RT-PCR data represent means ± SDs from experiments performed in duplicate. *, P

Techniques Used: Infection, Transfection, Western Blot, Immunofluorescence, Staining, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction

OPN, CD44, and αVβ3 activate HCV replication. (A) Huh7.5 cells were incubated with HCV (MOI of 1). At day 4 postinfection, cells were transfected with sicontrol, siOPN, siCD44, and siβ3 as described in Materials and Methods. At 72 h post-siRNA transfection, total cellular RNA was extracted and HCV RNA copy number was analyzed by quantitative RT-PCR using HCV gene-specific primers. (B) K2040 (stably expressing HCV subgenomic replicon) cells were transfected with sicontrol and siOPN. At 72 h posttransfection, total cellular RNA was extracted and the HCV RNA copy number was quantified by RT-PCR. The values represent the means ± SDs from three independent experiments performed in triplicate. *, P
Figure Legend Snippet: OPN, CD44, and αVβ3 activate HCV replication. (A) Huh7.5 cells were incubated with HCV (MOI of 1). At day 4 postinfection, cells were transfected with sicontrol, siOPN, siCD44, and siβ3 as described in Materials and Methods. At 72 h post-siRNA transfection, total cellular RNA was extracted and HCV RNA copy number was analyzed by quantitative RT-PCR using HCV gene-specific primers. (B) K2040 (stably expressing HCV subgenomic replicon) cells were transfected with sicontrol and siOPN. At 72 h posttransfection, total cellular RNA was extracted and the HCV RNA copy number was quantified by RT-PCR. The values represent the means ± SDs from three independent experiments performed in triplicate. *, P

Techniques Used: Incubation, Transfection, Quantitative RT-PCR, Stable Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction

29) Product Images from "Spontaneous Clearance of Primary Acute Hepatitis C Virus Infection Correlated with High Initial Viral RNA Level and Rapid HVR1 Evolution"

Article Title: Spontaneous Clearance of Primary Acute Hepatitis C Virus Infection Correlated with High Initial Viral RNA Level and Rapid HVR1 Evolution

Journal: Hepatology (Baltimore, Md.)

doi: 10.1002/hep.25575

Comparison of initial viral RNA levels and viral kinetics in subjects with self-resolving and persistent infections (A) Median viral RNA of each individual during segmented period of time during acute infection. (B) Dynamic change of viral RNA levels in each individual during acute infection. (C) Median viral RNA and ALT curves for clearance and persistence groups. Dashed horizontal lines indicate lower limit of detection for HCV RNA (50 IU/mL).
Figure Legend Snippet: Comparison of initial viral RNA levels and viral kinetics in subjects with self-resolving and persistent infections (A) Median viral RNA of each individual during segmented period of time during acute infection. (B) Dynamic change of viral RNA levels in each individual during acute infection. (C) Median viral RNA and ALT curves for clearance and persistence groups. Dashed horizontal lines indicate lower limit of detection for HCV RNA (50 IU/mL).

Techniques Used: Infection

Initial viral RNA and early viral kinetics in correspondence with IL-28B genotype and infection outcome (A) Initial viral RNA for four outcome/IL-28B groups. Boxes indicate median and inter-quartile ranges of log-transformed HCV RNA, with 5 th and 95 th percentiles indicated. IL-28B genotypes are indicated on X axis (C for C/C and T for C/T or T/T). Significant P values (Rank Sum) are shown. (B) Median viral RNA curves for each outcome/IL-28B group during the first year of infection.
Figure Legend Snippet: Initial viral RNA and early viral kinetics in correspondence with IL-28B genotype and infection outcome (A) Initial viral RNA for four outcome/IL-28B groups. Boxes indicate median and inter-quartile ranges of log-transformed HCV RNA, with 5 th and 95 th percentiles indicated. IL-28B genotypes are indicated on X axis (C for C/C and T for C/T or T/T). Significant P values (Rank Sum) are shown. (B) Median viral RNA curves for each outcome/IL-28B group during the first year of infection.

Techniques Used: Infection, Transformation Assay

30) Product Images from "The 3?-Untranslated Region of Hepatitis C Virus RNA Enhances Translation from an Internal Ribosomal Entry Site"

Article Title: The 3?-Untranslated Region of Hepatitis C Virus RNA Enhances Translation from an Internal Ribosomal Entry Site

Journal: Journal of Virology

doi:

The trans ) was added to rabbit reticulocyte lysate containing CAT-5CL RNA (A) or CAT-5CL-X RNA (B). In vitro translation was carried out at 120 mM KCl. Translation without free HCV-X(+) RNA [(−)] is set at 100%. The columns and bars represent the means and standard deviations of three independent translation reactions.
Figure Legend Snippet: The trans ) was added to rabbit reticulocyte lysate containing CAT-5CL RNA (A) or CAT-5CL-X RNA (B). In vitro translation was carried out at 120 mM KCl. Translation without free HCV-X(+) RNA [(−)] is set at 100%. The columns and bars represent the means and standard deviations of three independent translation reactions.

Techniques Used: In Vitro

Effects of the X region on translation from bicistronic RNAs. (A) Schematic diagrams of plasmids used. pCAT-5CL contains the T7 promoter (large open arrow), the CAT gene (hatched box), the 5′-UTR (single line), and the core protein-encoding region (open box) of HCV fused to a LUC gene (closed box) in the pGL vector. pCAT-5CL-X contains, in addition, the X region at the 3′ end. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate transcripts. (B) In vitro translation products of RNAs with 50 mM KCl (left) or 120 mM KCl (right) after separation by SDS-PAGE on 10% polyacrylamide gels. The core-LUC fusion protein (upper arrow) and CAT (lower arrow) are indicated. (C) Relative LUC expression of RNAs with 50 mM KCl (left) or 120 mM KCl (right). The columns and bars represent the means and standard deviations of two sets of triplicate studies. ∗, P
Figure Legend Snippet: Effects of the X region on translation from bicistronic RNAs. (A) Schematic diagrams of plasmids used. pCAT-5CL contains the T7 promoter (large open arrow), the CAT gene (hatched box), the 5′-UTR (single line), and the core protein-encoding region (open box) of HCV fused to a LUC gene (closed box) in the pGL vector. pCAT-5CL-X contains, in addition, the X region at the 3′ end. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate transcripts. (B) In vitro translation products of RNAs with 50 mM KCl (left) or 120 mM KCl (right) after separation by SDS-PAGE on 10% polyacrylamide gels. The core-LUC fusion protein (upper arrow) and CAT (lower arrow) are indicated. (C) Relative LUC expression of RNAs with 50 mM KCl (left) or 120 mM KCl (right). The columns and bars represent the means and standard deviations of two sets of triplicate studies. ∗, P

Techniques Used: Plasmid Preparation, In Vitro, SDS Page, Expressing

). SL2, stem-loop 2. (C) In vitro translation products of various RNAs separated by SDS-PAGE on 7.5% polyacrylamide gels. In vitro translation was carried out in rabbit reticulocyte lysates at 120 mM KCl. An arrow indicates the core-LUC fusion protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (D) Relative LUC activity of the translation products of various RNAs. The LUC activity of HCV-5CL RNA is artificially set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies. The asterisks indicate that the translational enhancement of these RNAs compared to the translational level of HCV-5CL RNA is significant. ∗, P
Figure Legend Snippet: ). SL2, stem-loop 2. (C) In vitro translation products of various RNAs separated by SDS-PAGE on 7.5% polyacrylamide gels. In vitro translation was carried out in rabbit reticulocyte lysates at 120 mM KCl. An arrow indicates the core-LUC fusion protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (D) Relative LUC activity of the translation products of various RNAs. The LUC activity of HCV-5CL RNA is artificially set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies. The asterisks indicate that the translational enhancement of these RNAs compared to the translational level of HCV-5CL RNA is significant. ∗, P

Techniques Used: In Vitro, SDS Page, Imaging, Generated, Activity Assay

Primer extension study of the HCV RNA constructs. (A) Calibration of the primer extension reactions. Decreasing amounts of HCV-5CL-X RNA were used in the primer extension reactions with a 5′-UTR primer, yielding a 265-nt product (arrow). (B) RNA stability of HCV-5CL (lanes 1 to 3), 5CL-Vec (lanes 4 to 6), and 5CL-X (lanes 7 to 9) RNA in rabbit reticulocyte lysates. Two micrograms of each RNA was used in in vitro translation in rabbit reticulocyte lysates. Reactions were stopped at 0 min (lanes 1, 4, and 7), 30 min (lanes 2, 5, and 8), and 90 min (lanes 3, 6, and 9). RNAs were extracted, and half of the amounts from each time points were used in primer extension experiments as in panel A.
Figure Legend Snippet: Primer extension study of the HCV RNA constructs. (A) Calibration of the primer extension reactions. Decreasing amounts of HCV-5CL-X RNA were used in the primer extension reactions with a 5′-UTR primer, yielding a 265-nt product (arrow). (B) RNA stability of HCV-5CL (lanes 1 to 3), 5CL-Vec (lanes 4 to 6), and 5CL-X (lanes 7 to 9) RNA in rabbit reticulocyte lysates. Two micrograms of each RNA was used in in vitro translation in rabbit reticulocyte lysates. Reactions were stopped at 0 min (lanes 1, 4, and 7), 30 min (lanes 2, 5, and 8), and 90 min (lanes 3, 6, and 9). RNAs were extracted, and half of the amounts from each time points were used in primer extension experiments as in panel A.

Techniques Used: Construct, In Vitro

Effects of the X region on HCV translation in vivo. Linearized plasmids were transfected into Huh7 cells infected with a recombinant vaccinia virus expressing T7 RNA polymerase. Relative LUC activities in the lysates were determined 24 h after transfection. The columns and bars represent the means and standard deviations of three independent transfections. ∗, P
Figure Legend Snippet: Effects of the X region on HCV translation in vivo. Linearized plasmids were transfected into Huh7 cells infected with a recombinant vaccinia virus expressing T7 RNA polymerase. Relative LUC activities in the lysates were determined 24 h after transfection. The columns and bars represent the means and standard deviations of three independent transfections. ∗, P

Techniques Used: In Vivo, Transfection, Infection, Recombinant, Expressing

Effects of the X region on translation from an EMCV IRES. (A) Schematic diagrams of the plasmids used. pGL-EMCV contains the T7 promoter (large open arrow), the 5′-UTR of EMCV (single line), and LUC genes (closed box) in the pGL vector. pGL-EMCV-X contains, in addition, the X region of HCV at the 3′ end. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate transcripts. (B) In vitro translation products of the various RNAs were separated by SDS-PAGE on 7.5% polyacrylamide gels. In vitro translation was performed in rabbit reticulocyte lysates at 120 mM KCl. An arrow indicates the LUC protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (C) Relative levels of LUC expression of the various RNAs. The activity of the EMCV transcripts is set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies. ∗∗, P
Figure Legend Snippet: Effects of the X region on translation from an EMCV IRES. (A) Schematic diagrams of the plasmids used. pGL-EMCV contains the T7 promoter (large open arrow), the 5′-UTR of EMCV (single line), and LUC genes (closed box) in the pGL vector. pGL-EMCV-X contains, in addition, the X region of HCV at the 3′ end. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate transcripts. (B) In vitro translation products of the various RNAs were separated by SDS-PAGE on 7.5% polyacrylamide gels. In vitro translation was performed in rabbit reticulocyte lysates at 120 mM KCl. An arrow indicates the LUC protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (C) Relative levels of LUC expression of the various RNAs. The activity of the EMCV transcripts is set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies. ∗∗, P

Techniques Used: Plasmid Preparation, In Vitro, SDS Page, Imaging, Generated, Expressing, Activity Assay

Effects of the X region on α-globin translation from the 5′-UTR of the α-globin gene. (A) Schematic diagrams of the plasmids used. pGL-αglobin-X contains T7 promoter (large open arrow), the 5′-UTR (single line) and coding region (open box) of α-globin gene fused to LUC genes (closed box), and the X region of HCV in the pGL vector. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate uncapped and capped RNAs. (B) In vitro translation products of uncapped (left) and capped (right) RNAs separated by SDS-PAGE on 7.5% polyacrylamide gels. Translation was performed in rabbit reticulocyte lysates at 70 mM KCl. An arrow indicates the α-globin–LUC fusion protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (C) Relative LUC expression of uncapped (left) and capped (right) RNAs. α-Globin RNA is set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies.
Figure Legend Snippet: Effects of the X region on α-globin translation from the 5′-UTR of the α-globin gene. (A) Schematic diagrams of the plasmids used. pGL-αglobin-X contains T7 promoter (large open arrow), the 5′-UTR (single line) and coding region (open box) of α-globin gene fused to LUC genes (closed box), and the X region of HCV in the pGL vector. The plasmids were linearized with the appropriate restriction enzymes and transcribed with T7 RNA polymerase to generate uncapped and capped RNAs. (B) In vitro translation products of uncapped (left) and capped (right) RNAs separated by SDS-PAGE on 7.5% polyacrylamide gels. Translation was performed in rabbit reticulocyte lysates at 70 mM KCl. An arrow indicates the α-globin–LUC fusion protein. Computer imaging was generated by Adobe Photoshop, version 3.0. (C) Relative LUC expression of uncapped (left) and capped (right) RNAs. α-Globin RNA is set at 100%. The columns and bars represent the means and standard deviations of two sets of triplicate studies.

Techniques Used: Plasmid Preparation, In Vitro, SDS Page, Imaging, Generated, Expressing

31) Product Images from "Permissivity of Primary Human Hepatocytes and Different Hepatoma Cell Lines to Cell Culture Adapted Hepatitis C Virus"

Article Title: Permissivity of Primary Human Hepatocytes and Different Hepatoma Cell Lines to Cell Culture Adapted Hepatitis C Virus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0070809

Identification and characterization of potential adaptive mutations. ( A ) Positions of conserved mutations found in the adapted virus on JFH1 open reading frame schematic diagram. The originally introduced amino acid changes F172C and P173S in Core and A4 MAb epitope in E1 are indicated in underlined gray type. Mutations identified at the end of the selection are indicated in black type. ( B , C , D ) Effect of the potential adaptive mutations on viral genome replication, infectious virus production and HCVcc assembly/secretion. HuH-7-RFP-NLS-IPS cells were transfected with JFH1-CS-A4-RLuc RNA (WT) or mutated HCV genomes (I599V, R1373Q, M1611T, S2364P, C2441S, R2523K, R1373Q/C2441S (DM for double mutant) or R1373Q/M1611T/C2441S (TM for triple mutant)). An assembly-deficient virus (ΔE1E2) and a replication-defective virus (GND) were used as controls. ( B ) Replication was assessed at 4, 24 and 48 h by measuring Renilla Luciferase activities in transfected cells. Results are expressed as relative light units (RLU) normalized at 4 h and are reported as the means ± S.D. of two independent experiments. ( C ) The supernatant of transfected cells were recovered at 24 and 48 h and incubated for 3 h with naive HuH-7-RFP-NLS-IPS cells. Luciferase assays were performed on infected cells at 72 h post-infection. Results are expressed as RLU and are reported as the means ± S.D. of two independent experiments. ( D ) HCV core release was quantified in the supernatants recovered 48 h post-transfection. Results are expressed as Core fmol/L and are reported as the means ± S.D. of two independent experiments.
Figure Legend Snippet: Identification and characterization of potential adaptive mutations. ( A ) Positions of conserved mutations found in the adapted virus on JFH1 open reading frame schematic diagram. The originally introduced amino acid changes F172C and P173S in Core and A4 MAb epitope in E1 are indicated in underlined gray type. Mutations identified at the end of the selection are indicated in black type. ( B , C , D ) Effect of the potential adaptive mutations on viral genome replication, infectious virus production and HCVcc assembly/secretion. HuH-7-RFP-NLS-IPS cells were transfected with JFH1-CS-A4-RLuc RNA (WT) or mutated HCV genomes (I599V, R1373Q, M1611T, S2364P, C2441S, R2523K, R1373Q/C2441S (DM for double mutant) or R1373Q/M1611T/C2441S (TM for triple mutant)). An assembly-deficient virus (ΔE1E2) and a replication-defective virus (GND) were used as controls. ( B ) Replication was assessed at 4, 24 and 48 h by measuring Renilla Luciferase activities in transfected cells. Results are expressed as relative light units (RLU) normalized at 4 h and are reported as the means ± S.D. of two independent experiments. ( C ) The supernatant of transfected cells were recovered at 24 and 48 h and incubated for 3 h with naive HuH-7-RFP-NLS-IPS cells. Luciferase assays were performed on infected cells at 72 h post-infection. Results are expressed as RLU and are reported as the means ± S.D. of two independent experiments. ( D ) HCV core release was quantified in the supernatants recovered 48 h post-transfection. Results are expressed as Core fmol/L and are reported as the means ± S.D. of two independent experiments.

Techniques Used: Selection, Transfection, Mutagenesis, Luciferase, Incubation, Infection

Infection of PHHs with cell culture adapted HCV. PHHs from one representative donor were inoculated for 6 h with non-adapted HCV (i0; MOI = 0.01 HuH-7 infectious units per cell) or i24 (MOI = 1000 HuH-7 infectious units per cell), in the presence or absence of 2′CMC (10 µM) or py6 (500 nM). After inoculation, cells were washed three times with PBS and new media containing the drugs were added and replaced every day. ( A ) Infection of PHHs that had previously been transduced with lentivirus expressing RFP-NLS-IPS, was visualized 48 h post-infection by translocation of the cleavage product RFP-NLS to the nucleus (“Infection” panel). The supernatants of inoculated cells were recovered 48 h post-infection, centrifuged and used to inoculate naive HuH-7-RFP-NLS-IPS in the absence or presence of py6 (“Re-infection” and “Re-infection with py6” panels, respectively) to check the production of progeny virus. Infected HuH-7 cells were visualized 48 h post-infection. ( B ) Intracellular HCV RNA was quantified by RT-qPCR, after inoculation of non-transduced PHHs. Results are expressed as means ± S.D. of duplicates. ( C ) Expression of the viral proteins E1 and E2 was analyzed 48 h post-infection in cell lysates by Western blotting using specific MAbs (A4 [anti-E1], 3/11 [anti-E2] , and C4 [anti-β-actin]). HuH-7 cells infected in the same conditions were used as control. ( D , E , F ) IFN-β, IL-28A/B and IL-29 expression in infected PHHs was determined in duplicate by RT-qPCR. The results are normalized to GAPDH endogenous control and presented as fold-increase over pre-infection levels, using the ΔΔCt method.
Figure Legend Snippet: Infection of PHHs with cell culture adapted HCV. PHHs from one representative donor were inoculated for 6 h with non-adapted HCV (i0; MOI = 0.01 HuH-7 infectious units per cell) or i24 (MOI = 1000 HuH-7 infectious units per cell), in the presence or absence of 2′CMC (10 µM) or py6 (500 nM). After inoculation, cells were washed three times with PBS and new media containing the drugs were added and replaced every day. ( A ) Infection of PHHs that had previously been transduced with lentivirus expressing RFP-NLS-IPS, was visualized 48 h post-infection by translocation of the cleavage product RFP-NLS to the nucleus (“Infection” panel). The supernatants of inoculated cells were recovered 48 h post-infection, centrifuged and used to inoculate naive HuH-7-RFP-NLS-IPS in the absence or presence of py6 (“Re-infection” and “Re-infection with py6” panels, respectively) to check the production of progeny virus. Infected HuH-7 cells were visualized 48 h post-infection. ( B ) Intracellular HCV RNA was quantified by RT-qPCR, after inoculation of non-transduced PHHs. Results are expressed as means ± S.D. of duplicates. ( C ) Expression of the viral proteins E1 and E2 was analyzed 48 h post-infection in cell lysates by Western blotting using specific MAbs (A4 [anti-E1], 3/11 [anti-E2] , and C4 [anti-β-actin]). HuH-7 cells infected in the same conditions were used as control. ( D , E , F ) IFN-β, IL-28A/B and IL-29 expression in infected PHHs was determined in duplicate by RT-qPCR. The results are normalized to GAPDH endogenous control and presented as fold-increase over pre-infection levels, using the ΔΔCt method.

Techniques Used: Infection, Cell Culture, Transduction, Expressing, Translocation Assay, Quantitative RT-PCR, Western Blot

Viral entry of cell culture adapted HCV. ( A , B , C ) Neutralization of cell culture adapted HCV with 3/11 and JS-81 MAbs. HuH-7-RFP-NLS-IPS cells were infected with i0 or i24 in the absence (Mock) or the presence of 3/11 anti-E2 or JS-81 anti-CD81 MAbs, at the indicated concentration. ( A ) Images taken 48 h after infection with i24 are representative of three independent experiments. ( B , C ) Intracellular HCV RNA was quantified 48 h after infection. Results are expressed as percentages of infectivity relative to infectivity in the absence of antibodies and are reported as the means ± S.D. of two independent experiments. ( D ) Cell-to-cell transmission of cell culture adapted HCV. Naive HuH-7-RFP-NLS-IPS cells (acceptor cells) were seeded with HuH-7-EGFP-IPS cells, infected with either i0 or i24 (donor cells). Cultures were treated with 50 µg/mL of the 3/11 anti-E2 neutralizing MAb to prevent cell-free infection. The results are expressed as the mean number of HCV infected acceptor cells/focus ± S.D., determined in 140 separate foci, 24 h post-seeding.
Figure Legend Snippet: Viral entry of cell culture adapted HCV. ( A , B , C ) Neutralization of cell culture adapted HCV with 3/11 and JS-81 MAbs. HuH-7-RFP-NLS-IPS cells were infected with i0 or i24 in the absence (Mock) or the presence of 3/11 anti-E2 or JS-81 anti-CD81 MAbs, at the indicated concentration. ( A ) Images taken 48 h after infection with i24 are representative of three independent experiments. ( B , C ) Intracellular HCV RNA was quantified 48 h after infection. Results are expressed as percentages of infectivity relative to infectivity in the absence of antibodies and are reported as the means ± S.D. of two independent experiments. ( D ) Cell-to-cell transmission of cell culture adapted HCV. Naive HuH-7-RFP-NLS-IPS cells (acceptor cells) were seeded with HuH-7-EGFP-IPS cells, infected with either i0 or i24 (donor cells). Cultures were treated with 50 µg/mL of the 3/11 anti-E2 neutralizing MAb to prevent cell-free infection. The results are expressed as the mean number of HCV infected acceptor cells/focus ± S.D., determined in 140 separate foci, 24 h post-seeding.

Techniques Used: Cell Culture, Neutralization, Infection, Concentration Assay, Transmission Assay

Profiles of density of HCV produced in different hepatoma cell lines. HuH-7 ( A ), Hep3B ( B ), HepG2-CD81 ( C ) and PLC/PRF/5 ( D ) were electroporated with in vitro transcribed RNA of the JFH1-CS-A4-RLuc genome containing mutations R1373Q/C2441S. The supernatants of each electroporated cell lines were recovered six days post-electroporation and overlaid on 10 to 50% (weight/volume) iodixanol gradients. After a 24 h ultracentrifugation, sixteen fractions were collected and analyzed for HCV RNA quantity and infectivity on naive HuH-7 cells (assessed by measuring Renilla Luciferase activities). The results are expressed as percentages of total infectivity or HCV RNA and are reported as means of two independent experiments.
Figure Legend Snippet: Profiles of density of HCV produced in different hepatoma cell lines. HuH-7 ( A ), Hep3B ( B ), HepG2-CD81 ( C ) and PLC/PRF/5 ( D ) were electroporated with in vitro transcribed RNA of the JFH1-CS-A4-RLuc genome containing mutations R1373Q/C2441S. The supernatants of each electroporated cell lines were recovered six days post-electroporation and overlaid on 10 to 50% (weight/volume) iodixanol gradients. After a 24 h ultracentrifugation, sixteen fractions were collected and analyzed for HCV RNA quantity and infectivity on naive HuH-7 cells (assessed by measuring Renilla Luciferase activities). The results are expressed as percentages of total infectivity or HCV RNA and are reported as means of two independent experiments.

Techniques Used: Produced, Planar Chromatography, In Vitro, Electroporation, Infection, Luciferase

Increase of HCV titers after successive infections. HuH-7 cells were electroporated in the presence of JFH1-CS-A4 RNA. Ten days later, the supernatant of electroporated cells was recovered (denoted supernatant i0) and used to perform successive infections in HuH-7-RFP-NLS-IPS. Each time the cells were 100% infected, the supernatant was recovered (supernatants recovered after “n” infection, denoted i1 to i24) and used to infect naive HuH-7-RFP-NLS-IPS cells. ( A , B ) The amount of HCV RNA ( A ) and Core protein ( B ) were quantified in these supernatants by RT-qPCR and fully automated chemiluminescent microparticle immunoassay, respectively. Results are expressed as HCV RNA copies/mL and fmol/L of HCV Core protein, respectively, and are reported as the mean ± S.D. of duplicate and triplicate measurements, respectively. ( C ) Viral titers were determined by ffu assay for i0, i6, i9, i12 and i24. Results are expressed as ffu/mL and are reported as the mean ± S.D. of three independent experiments. ( D ) HuH-7-RFP-NLS-IPS cells were inoculated with the different supernatants at low MOI. Foci of infected cells, identified by translocation of the cleavage product RFP-NLS to the nucleus, were visualized at 24 and 48 h. Images are representative of three independent experiments.
Figure Legend Snippet: Increase of HCV titers after successive infections. HuH-7 cells were electroporated in the presence of JFH1-CS-A4 RNA. Ten days later, the supernatant of electroporated cells was recovered (denoted supernatant i0) and used to perform successive infections in HuH-7-RFP-NLS-IPS. Each time the cells were 100% infected, the supernatant was recovered (supernatants recovered after “n” infection, denoted i1 to i24) and used to infect naive HuH-7-RFP-NLS-IPS cells. ( A , B ) The amount of HCV RNA ( A ) and Core protein ( B ) were quantified in these supernatants by RT-qPCR and fully automated chemiluminescent microparticle immunoassay, respectively. Results are expressed as HCV RNA copies/mL and fmol/L of HCV Core protein, respectively, and are reported as the mean ± S.D. of duplicate and triplicate measurements, respectively. ( C ) Viral titers were determined by ffu assay for i0, i6, i9, i12 and i24. Results are expressed as ffu/mL and are reported as the mean ± S.D. of three independent experiments. ( D ) HuH-7-RFP-NLS-IPS cells were inoculated with the different supernatants at low MOI. Foci of infected cells, identified by translocation of the cleavage product RFP-NLS to the nucleus, were visualized at 24 and 48 h. Images are representative of three independent experiments.

Techniques Used: Infection, Quantitative RT-PCR, Translocation Assay

32) Product Images from "The Clearance of Hepatitis C Virus Infection in Chimpanzees May Not Necessarily Correlate with the Appearance of Acquired Immunity"

Article Title: The Clearance of Hepatitis C Virus Infection in Chimpanzees May Not Necessarily Correlate with the Appearance of Acquired Immunity

Journal: Journal of Virology

doi: 10.1128/JVI.77.2.862-870.2003

Inoculation history and follow-up of chimpanzee X0190. (A) X0190 was inoculated intravenously with a 10 4 dilution of serum from X0234 (HCV RNA titer = 5 × 10 4 genomes/ml), followed 5 weeks later by a 10 3 dilution of this serum, shown on the chart as week 0. Solid bars indicate the HCV RNA titers in serum; the shaded area indicates the ALT level in serum. Above the chart are shown the histology results from the four biopsies, denoted by arrows at weeks 4, 7, 10 and 13; intrahepatic IFN-α, IFN-γ, and IL-4 levels relative to GAPDH RNA as determined by TaqMan assay; qualitative HCV RT-PCR results (sensitivity = 100 genomes/ml); and anti-HCV EIA 2.0 data. (B) T helper proliferation data for several HCV antigens. An SI of > 4.0 (dotted line) was considered positive. (C) IFN-γ ELISpot assay of peripheral blood T-cell responses. SFU, spot-forming units. The number of spot-forming units for each antigen or peptide is shown after subtraction of the number of spots in the absence of antigen or peptide. A finding of more than 10 spot-forming units (dotted line) was considered positive.
Figure Legend Snippet: Inoculation history and follow-up of chimpanzee X0190. (A) X0190 was inoculated intravenously with a 10 4 dilution of serum from X0234 (HCV RNA titer = 5 × 10 4 genomes/ml), followed 5 weeks later by a 10 3 dilution of this serum, shown on the chart as week 0. Solid bars indicate the HCV RNA titers in serum; the shaded area indicates the ALT level in serum. Above the chart are shown the histology results from the four biopsies, denoted by arrows at weeks 4, 7, 10 and 13; intrahepatic IFN-α, IFN-γ, and IL-4 levels relative to GAPDH RNA as determined by TaqMan assay; qualitative HCV RT-PCR results (sensitivity = 100 genomes/ml); and anti-HCV EIA 2.0 data. (B) T helper proliferation data for several HCV antigens. An SI of > 4.0 (dotted line) was considered positive. (C) IFN-γ ELISpot assay of peripheral blood T-cell responses. SFU, spot-forming units. The number of spot-forming units for each antigen or peptide is shown after subtraction of the number of spots in the absence of antigen or peptide. A finding of more than 10 spot-forming units (dotted line) was considered positive.

Techniques Used: TaqMan Assay, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot

33) Product Images from "NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon"

Article Title: NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00310-06

Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

34) Product Images from "NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon"

Article Title: NIM811, a Cyclophilin Inhibitor, Exhibits Potent In Vitro Activity against Hepatitis C Virus Alone or in Combination with Alpha Interferon

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00310-06

Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Combination of NIM811 with IFN-α facilitated multilog HCV RNA reduction. HCV replicon cells were treated with various concentrations of NIM811 alone, IFN-α alone, or the two in combination for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.
Figure Legend Snippet: Multilog reduction of HCV RNA in the replicon cells over 9 days of treatment with NIM811. HCV replicon cells (clone A) were treated with four different concentrations of NIM811 for 3, 6, or 9 days. Medium and compounds were refreshed every 3 days. At the end of each treatment, the quantity of HCV RNA was determined by QRT-PCR and was normalized against the amount of total RNA extracted for each sample. Each data point represents the average for five replicates in cell culture. The level of remaining HCV RNA in compound-treated cells was compared to that in untreated cells at the same time point to calculate the log reduction of HCV RNA.

Techniques Used: Quantitative RT-PCR, Cell Culture

35) Product Images from "Hepatitis C Virus-Encoded Enzymatic Activities and Conserved RNA Elements in the 3? Nontranslated Region Are Essential for Virus Replication In Vivo"

Article Title: Hepatitis C Virus-Encoded Enzymatic Activities and Conserved RNA Elements in the 3? Nontranslated Region Are Essential for Virus Replication In Vivo

Journal: Journal of Virology

doi:

). For each RNA, approximately 150 μg of RNA in phosphate-buffered saline (PBS) was injected into two separate sites, and 1 μg of an RNA-Lipofectin-PBS mixture was also injected at two separate sites. Ch1552 was challenged at week 32 with infectious HCV FL RNA transcripts using nonsurgical procedures. One hundred micrograms of RNA in 1 ml of PBS was injected into the liver percutaneously through a biopsy needle. Three additional intrahepatic injections of 100 μg of RNA in 1 ml of PBS per injection were administered with a lumbar puncture needle. A fifth lumbar puncture needle injection was performed with 3 μg of RNA mixed with 30 μl of Lipofectin and PBS in a total volume of 0.5 ml. (A) Serum ALT, HCV RNA (molecules per milliliter), and HCV-specific antibodies (Ab; as measured by HCV ELISA 3.0). (B) Detection of HCV-specific antibodies by Ortho HCV version 3.0 ELISA and by Chiron RIBA 2.0. For the RIBA 2.0, the open box indicates HCV-seronegative serum samples and the solid bar (beginning at week 41) indicates positive samples. OD 490 , optical density at 490 nm.
Figure Legend Snippet: ). For each RNA, approximately 150 μg of RNA in phosphate-buffered saline (PBS) was injected into two separate sites, and 1 μg of an RNA-Lipofectin-PBS mixture was also injected at two separate sites. Ch1552 was challenged at week 32 with infectious HCV FL RNA transcripts using nonsurgical procedures. One hundred micrograms of RNA in 1 ml of PBS was injected into the liver percutaneously through a biopsy needle. Three additional intrahepatic injections of 100 μg of RNA in 1 ml of PBS per injection were administered with a lumbar puncture needle. A fifth lumbar puncture needle injection was performed with 3 μg of RNA mixed with 30 μl of Lipofectin and PBS in a total volume of 0.5 ml. (A) Serum ALT, HCV RNA (molecules per milliliter), and HCV-specific antibodies (Ab; as measured by HCV ELISA 3.0). (B) Detection of HCV-specific antibodies by Ortho HCV version 3.0 ELISA and by Chiron RIBA 2.0. For the RIBA 2.0, the open box indicates HCV-seronegative serum samples and the solid bar (beginning at week 41) indicates positive samples. OD 490 , optical density at 490 nm.

Techniques Used: Injection, Enzyme-linked Immunosorbent Assay

); sequences of the oligonucleotides used for mutagenesis, plasmid manipulations, and complete sequence files are available upon request. (A) The HCV genome organization is shown at the top with 5′ and 3′ NTRs (solid lines), and the ORF (open box) and the polyprotein cleavage products are indicated. Mutant full-length clones are shown below, highlighting the regions encoding the four enzymatic activities (shadowed), the positions of the mutations (asterisks), and the construct names (at the left). HCV FL(2-3pro − ) contains the amino acid substitutions H952A (3195 to 3200; gcgtTa) and C993A (3318 to 3319; gc). HCV FL(3pro − ) contains the substitutions D1107A (3660 to 3664; gcctt) and S1165A (3831 to 3836; agCgCt). HCV FL(hel − ) contains the substitutions D1316A (4286 to 4289; cGca) and E1317A (4291 to 4292; ca). HCV FL(pol − ) contains the substitutions G2737A (8551 to 8552; cg), D2738A (8554; c), and D2739G (8557 to 8559; gCc). (B) Organization of the 3′ portion of HCV genome RNA showing (5′ to 3′) the C-terminal part of the ORF (open box), the polyprotein translation termination codon (UGA), the variable part of the 3′ NTR (solid straight line), the poly(U/UC) tract, the highly conserved 52-base sequence (curved line), and the 3′ terminal 46-base stem-loop structure (SL I). Mutant clones are shown below with their corresponding names to the right. HCV FL(3′Δ52) is identical to HCV FL, except for an internal deletion encompassing the 5′ 52 bases of the 3′ terminal 98-base sequence. For HCV FL(3′Δ98), the entire 3′ 98-base sequence was deleted. A novel restriction site ( Nsi I) distinguishing HCV FL(3′Δ52) from HCV FL(3′Δ98) is indicated. nucl., nucleotides.
Figure Legend Snippet: ); sequences of the oligonucleotides used for mutagenesis, plasmid manipulations, and complete sequence files are available upon request. (A) The HCV genome organization is shown at the top with 5′ and 3′ NTRs (solid lines), and the ORF (open box) and the polyprotein cleavage products are indicated. Mutant full-length clones are shown below, highlighting the regions encoding the four enzymatic activities (shadowed), the positions of the mutations (asterisks), and the construct names (at the left). HCV FL(2-3pro − ) contains the amino acid substitutions H952A (3195 to 3200; gcgtTa) and C993A (3318 to 3319; gc). HCV FL(3pro − ) contains the substitutions D1107A (3660 to 3664; gcctt) and S1165A (3831 to 3836; agCgCt). HCV FL(hel − ) contains the substitutions D1316A (4286 to 4289; cGca) and E1317A (4291 to 4292; ca). HCV FL(pol − ) contains the substitutions G2737A (8551 to 8552; cg), D2738A (8554; c), and D2739G (8557 to 8559; gCc). (B) Organization of the 3′ portion of HCV genome RNA showing (5′ to 3′) the C-terminal part of the ORF (open box), the polyprotein translation termination codon (UGA), the variable part of the 3′ NTR (solid straight line), the poly(U/UC) tract, the highly conserved 52-base sequence (curved line), and the 3′ terminal 46-base stem-loop structure (SL I). Mutant clones are shown below with their corresponding names to the right. HCV FL(3′Δ52) is identical to HCV FL, except for an internal deletion encompassing the 5′ 52 bases of the 3′ terminal 98-base sequence. For HCV FL(3′Δ98), the entire 3′ 98-base sequence was deleted. A novel restriction site ( Nsi I) distinguishing HCV FL(3′Δ52) from HCV FL(3′Δ98) is indicated. nucl., nucleotides.

Techniques Used: Mutagenesis, Plasmid Preparation, Sequencing, Clone Assay, Construct

36) Product Images from "A Randomized, Double-Blind, Placebo-Controlled Assessment of BMS-936558, a Fully Human Monoclonal Antibody to Programmed Death-1 (PD-1), in Patients with Chronic Hepatitis C Virus Infection"

Article Title: A Randomized, Double-Blind, Placebo-Controlled Assessment of BMS-936558, a Fully Human Monoclonal Antibody to Programmed Death-1 (PD-1), in Patients with Chronic Hepatitis C Virus Infection

Journal: PLoS ONE

doi: 10.1371/journal.pone.0063818

HCV RNA and ALT changes in patients with clinical response.
Figure Legend Snippet: HCV RNA and ALT changes in patients with clinical response.

Techniques Used:

37) Product Images from "Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones"

Article Title: Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

Journal: ACS Nano

doi: 10.1021/acsnano.5b07338

Predicted values and experimental validation of the first step of the ratiometric approach. (a) Measured spectral transmittance (%) in the range of visible light (400–700 nm) for positive (solid blue line) and negative (solid purple line) RT-LAMP reaction solutions, each containing 0.7 mM of eriochrome black T (EBT) as the amplification indicator dye. Dashed lines correspond to normalized spectral responses for red (R), green (G), and blue (B) channels of an Exmor R CMOS sensor, a common sensor in cell phone cameras. (b–e) Analysis of the three possible RGB ratiometric combinations for positive and negative RT-LAMP reaction solutions. (b) The predicted RGB values and corresponding colors for positive and negative LAMP amplification reactions obtained by convoluting the transmittance spectrum and Exmor R spectral responses described in panel a. (c) The cropped and enlarged color images collected with an Apple iPhone 4S for positive and negative RT-LAMP reaction solutions containing 90 μM of EBT dye. (d) Predicted images and ratiometric values for positive and negative amplification reactions processed for each ratiometric combination, G/R, B/R, and G/B. (e) Experimental images and ratiometric values for positive and negative amplification reactions for each combination: G/R, B/R, and G/B. All experiments were performed with HCV RNA as template.
Figure Legend Snippet: Predicted values and experimental validation of the first step of the ratiometric approach. (a) Measured spectral transmittance (%) in the range of visible light (400–700 nm) for positive (solid blue line) and negative (solid purple line) RT-LAMP reaction solutions, each containing 0.7 mM of eriochrome black T (EBT) as the amplification indicator dye. Dashed lines correspond to normalized spectral responses for red (R), green (G), and blue (B) channels of an Exmor R CMOS sensor, a common sensor in cell phone cameras. (b–e) Analysis of the three possible RGB ratiometric combinations for positive and negative RT-LAMP reaction solutions. (b) The predicted RGB values and corresponding colors for positive and negative LAMP amplification reactions obtained by convoluting the transmittance spectrum and Exmor R spectral responses described in panel a. (c) The cropped and enlarged color images collected with an Apple iPhone 4S for positive and negative RT-LAMP reaction solutions containing 90 μM of EBT dye. (d) Predicted images and ratiometric values for positive and negative amplification reactions processed for each ratiometric combination, G/R, B/R, and G/B. (e) Experimental images and ratiometric values for positive and negative amplification reactions for each combination: G/R, B/R, and G/B. All experiments were performed with HCV RNA as template.

Techniques Used: Amplification

Validation of the robustness of the G/R ratiometric approach to different hardware (cell phone cameras) and lighting conditions. (a–g) Enlarged and cropped color images (top two rows of each individual panel) captured by an unmodified cell phone camera from positive (+) and negative (−) RT-LAMP reactions at 2-fold increases in EBT concentration from 10.9 μM to 1.4 mM (1 = 0.011 mM; 2 = 0.022 mM; 3 = 0.044 mM, 4 = 0.088 mM, 5 = 0.175 mM; 6 = 0.35 mM; 7 = 0.7 mM; 8 = 1.4 mM). Positive wells are blue and negative wells are purple. After G/R ratiometric processing (bottom two rows of each individual panel), negative wells are black. Regions I, II, III in each panel indicate the effect of dye concentration: (II) acceptable concentration range for visualization (green regions); (I) concentrations too low for visualization (white regions); and (III) concentrations too high for visualization (red regions). (a–d) Images captured by four common cell phones under fluorescent light: (a) Apple iPhone 4S, (b) HTC inspire 4G, (c) Motorola Moto G, and (d) Nokia 808 PureView. (e–g) Images captured by an Apple iPhone 4S under three additional light conditions: (e) incandescent light, (f) direct sunlight, and (g) indirect sunlight. All experiments were performed with HCV RNA as a clinically relevant target. All images were acquired with unmodified cell phone cameras. Detailed information for the G/R ratiometric process (Figure S2) and additional cell phone camera images (Figure S3) are provided in the Supporting Information .
Figure Legend Snippet: Validation of the robustness of the G/R ratiometric approach to different hardware (cell phone cameras) and lighting conditions. (a–g) Enlarged and cropped color images (top two rows of each individual panel) captured by an unmodified cell phone camera from positive (+) and negative (−) RT-LAMP reactions at 2-fold increases in EBT concentration from 10.9 μM to 1.4 mM (1 = 0.011 mM; 2 = 0.022 mM; 3 = 0.044 mM, 4 = 0.088 mM, 5 = 0.175 mM; 6 = 0.35 mM; 7 = 0.7 mM; 8 = 1.4 mM). Positive wells are blue and negative wells are purple. After G/R ratiometric processing (bottom two rows of each individual panel), negative wells are black. Regions I, II, III in each panel indicate the effect of dye concentration: (II) acceptable concentration range for visualization (green regions); (I) concentrations too low for visualization (white regions); and (III) concentrations too high for visualization (red regions). (a–d) Images captured by four common cell phones under fluorescent light: (a) Apple iPhone 4S, (b) HTC inspire 4G, (c) Motorola Moto G, and (d) Nokia 808 PureView. (e–g) Images captured by an Apple iPhone 4S under three additional light conditions: (e) incandescent light, (f) direct sunlight, and (g) indirect sunlight. All experiments were performed with HCV RNA as a clinically relevant target. All images were acquired with unmodified cell phone cameras. Detailed information for the G/R ratiometric process (Figure S2) and additional cell phone camera images (Figure S3) are provided in the Supporting Information .

Techniques Used: Concentration Assay

Experimental validation of two-step SlipChip devices for single molecule counting with an unmodified cell phone camera. (a) A flow-chart of detection of single molecules in two-step SlipChip: (i) 5 nL amplification wells are loaded with amplification reaction solution (RXN) and 9.5 nL detection wells are loaded with indicator dye (DYE). (ii) After amplification, a slip is performed and the RXN and DYE wells are combined. (iii) Immediately after mixing, positive reaction solutions become blue, while negative reactions remain purple. The readout is imaged by an unmodified cell phone camera. (iv) Ratiometric image processing (G/R process) provides a single binary result (positive or negative). (b) Stereoscope image of the device before the amplification and readout wells are merged (arrow designates direction of slip). (c) Stereoscope, (d) cell phone camera and (e) fluorescent images after the device is slipped and the wells are merged. (f) Stereoscope and (g) cell phone camera images after G/R image processing. (h) Correlation between fluorescence counts and cell phone (G/R processed) counts. Colors were enhanced in figure panels b–d, and f for clarity of publication; raw images were used in all ratiometric analyses. In these experiments, HCV RNA was amplified by dRT-LAMP.
Figure Legend Snippet: Experimental validation of two-step SlipChip devices for single molecule counting with an unmodified cell phone camera. (a) A flow-chart of detection of single molecules in two-step SlipChip: (i) 5 nL amplification wells are loaded with amplification reaction solution (RXN) and 9.5 nL detection wells are loaded with indicator dye (DYE). (ii) After amplification, a slip is performed and the RXN and DYE wells are combined. (iii) Immediately after mixing, positive reaction solutions become blue, while negative reactions remain purple. The readout is imaged by an unmodified cell phone camera. (iv) Ratiometric image processing (G/R process) provides a single binary result (positive or negative). (b) Stereoscope image of the device before the amplification and readout wells are merged (arrow designates direction of slip). (c) Stereoscope, (d) cell phone camera and (e) fluorescent images after the device is slipped and the wells are merged. (f) Stereoscope and (g) cell phone camera images after G/R image processing. (h) Correlation between fluorescence counts and cell phone (G/R processed) counts. Colors were enhanced in figure panels b–d, and f for clarity of publication; raw images were used in all ratiometric analyses. In these experiments, HCV RNA was amplified by dRT-LAMP.

Techniques Used: Single Molecule Counting, Flow Cytometry, Amplification, Fluorescence

38) Product Images from "Hepatitis C Virus RNA Replication Depends on Specific Cis- and Trans-Acting Activities of Viral Nonstructural Proteins"

Article Title: Hepatitis C Virus RNA Replication Depends on Specific Cis- and Trans-Acting Activities of Viral Nonstructural Proteins

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1004817

HCV NS5B can be complemented in trans . ( A ) Overview of the HCV genome, SGR-Gluc, and the recoded NS3–5B region; CRE, cis-responsive element; E•I, encephalomyocarditis virus IRES. ( B ) Model of HCV genome translation, polyprotein processing, and recruitment of the genome out of translation and into a proto-replication complex. ( C ) Model of an active, membrane-bound HCV replication complex; red line, negative-strand RNA ( D ) HCV replication-dependent expression of Gluc activity. Media were collected at the indicated times post-transfection and assayed as described in Materials and Methods. Values represent mean ± SD from transfections done in triplicate and normalized to untransfected controls; ***, p
Figure Legend Snippet: HCV NS5B can be complemented in trans . ( A ) Overview of the HCV genome, SGR-Gluc, and the recoded NS3–5B region; CRE, cis-responsive element; E•I, encephalomyocarditis virus IRES. ( B ) Model of HCV genome translation, polyprotein processing, and recruitment of the genome out of translation and into a proto-replication complex. ( C ) Model of an active, membrane-bound HCV replication complex; red line, negative-strand RNA ( D ) HCV replication-dependent expression of Gluc activity. Media were collected at the indicated times post-transfection and assayed as described in Materials and Methods. Values represent mean ± SD from transfections done in triplicate and normalized to untransfected controls; ***, p

Techniques Used: Expressing, Activity Assay, Transfection

Models of viral cis -activities and HCV replicase structure and function. ( A ) Ribosome-induced change in RNA structure. ( B ) Nascent cis -acting polypeptide (orange) recruiting the viral RNA-ribosome complex to a site of replication via an interaction partner (yellow). ( C ) A cis -acting protein (orange) recruiting the viral RNA to site of replication. ( D ) NS5B trans -complementation via protein transfer. ( E ) NS5B trans -complementation via RNA transfer. ( F ) NS5B trans -complementation requires NS3–5B expression. ( G ) Translation of NS5B is required in cis . ( H ) Potential NS3-NS4A interactions of the 3m6 and 4Am1 mutants. NS3-4A can form homodimers where each monomer contributes either NS3 or NS4A (left); alternatively, NS3-NS4A may dissociate and reassociate to form separate active and inactive monomers (right).
Figure Legend Snippet: Models of viral cis -activities and HCV replicase structure and function. ( A ) Ribosome-induced change in RNA structure. ( B ) Nascent cis -acting polypeptide (orange) recruiting the viral RNA-ribosome complex to a site of replication via an interaction partner (yellow). ( C ) A cis -acting protein (orange) recruiting the viral RNA to site of replication. ( D ) NS5B trans -complementation via protein transfer. ( E ) NS5B trans -complementation via RNA transfer. ( F ) NS5B trans -complementation requires NS3–5B expression. ( G ) Translation of NS5B is required in cis . ( H ) Potential NS3-NS4A interactions of the 3m6 and 4Am1 mutants. NS3-4A can form homodimers where each monomer contributes either NS3 or NS4A (left); alternatively, NS3-NS4A may dissociate and reassociate to form separate active and inactive monomers (right).

Techniques Used: Expressing

39) Product Images from "Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo"

Article Title: Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo

Journal: Journal of Negative Results in Biomedicine

doi: 10.1186/1477-5751-8-8

Recombinant Dicer binds and cleaves HCV IRES in vitro . (A-B) Electrophoretic mobility shift assays (EMSA) 32 P-labeled HCV RNA nt 1-341 (A) or nt 1-515 (B) was incubated in the absence or presence of recombinant human Dicer (200 ng) and/or BSA (2 μg), and complex formation visualized by non-denaturing PAGE and autoradiography. (C-D) Dicer RNase activity assays. (C) 32 P-labeled HCV RNA nt 1-341 (left panel) or nt 1-515 (right panel) was incubated in the absence (-) or presence (+) of recombinant human Dicer (200 ng), and HCV RNA processing monitored by denaturing PAGE and autoradiography. Lanes 4, 5, 6 and 7 represent higher numerical exposition of lanes 2, 3, 8 and 9 respectively. M, indicates a 10-nt RNA size marker.
Figure Legend Snippet: Recombinant Dicer binds and cleaves HCV IRES in vitro . (A-B) Electrophoretic mobility shift assays (EMSA) 32 P-labeled HCV RNA nt 1-341 (A) or nt 1-515 (B) was incubated in the absence or presence of recombinant human Dicer (200 ng) and/or BSA (2 μg), and complex formation visualized by non-denaturing PAGE and autoradiography. (C-D) Dicer RNase activity assays. (C) 32 P-labeled HCV RNA nt 1-341 (left panel) or nt 1-515 (right panel) was incubated in the absence (-) or presence (+) of recombinant human Dicer (200 ng), and HCV RNA processing monitored by denaturing PAGE and autoradiography. Lanes 4, 5, 6 and 7 represent higher numerical exposition of lanes 2, 3, 8 and 9 respectively. M, indicates a 10-nt RNA size marker.

Techniques Used: Recombinant, In Vitro, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Polyacrylamide Gel Electrophoresis, Autoradiography, Activity Assay, Marker

miRNA-guided RNA silencing is not perturbed in cells harboring a subgenomic HCV replicon . (A) Schematic representation of the experimental strategy and reporter gene constructs. (B) HCV RNA expression in Huh-7 or 9–13 cells harbouring a subgenomic HCV replicon, treated or not with 100 IU/ml of interferon α-2B (IFNα-2B), was documented by Northern blot using a DNA probe complementary to HCV Internal ribosome entry site (nt 1 to 341). GAPDH was used as a loading control. (C) HCV NS3 and NS5B protein expression Huh-7 or 9–13 cells, treated or not with 100 IU/ml of IFNα-2B, was documented by Western blot using anti-NS3 1B6 (first panel) and anti-NS5B 5B-3B1 (third panel) antibodies, respectively. Actin was used as a loading control (second and fourth panels). (D) Huh-7 or 9–13 cells, treated or not with 100 IU/ml of IFNα-2B, were cotransfected using Lipofectamine 2000 with a Rluc:miRNA binding site construct, in which the Rluc reporter gene is coupled with 1 or 3 copies of perfectly complementary (PC) or natural wild-type (WT) binding sites (BS) for miR-328 (250 ng DNA), and a psiSTRIKE-based, pre-miR-328 expression construct (250 ng DNA). psiSTRIKE-Neg, which encodes a shRNA directed against a sequence deleted in the Rluc reporter mRNA, was used as a control. Results of Rluc activity were normalized with Fluc activity and expressed as a percentage of Rluc activity obtained with psiSTRIKE-Neg. Results are expressed as mean ± s.e.m. (n = 3 experiments, in duplicate).
Figure Legend Snippet: miRNA-guided RNA silencing is not perturbed in cells harboring a subgenomic HCV replicon . (A) Schematic representation of the experimental strategy and reporter gene constructs. (B) HCV RNA expression in Huh-7 or 9–13 cells harbouring a subgenomic HCV replicon, treated or not with 100 IU/ml of interferon α-2B (IFNα-2B), was documented by Northern blot using a DNA probe complementary to HCV Internal ribosome entry site (nt 1 to 341). GAPDH was used as a loading control. (C) HCV NS3 and NS5B protein expression Huh-7 or 9–13 cells, treated or not with 100 IU/ml of IFNα-2B, was documented by Western blot using anti-NS3 1B6 (first panel) and anti-NS5B 5B-3B1 (third panel) antibodies, respectively. Actin was used as a loading control (second and fourth panels). (D) Huh-7 or 9–13 cells, treated or not with 100 IU/ml of IFNα-2B, were cotransfected using Lipofectamine 2000 with a Rluc:miRNA binding site construct, in which the Rluc reporter gene is coupled with 1 or 3 copies of perfectly complementary (PC) or natural wild-type (WT) binding sites (BS) for miR-328 (250 ng DNA), and a psiSTRIKE-based, pre-miR-328 expression construct (250 ng DNA). psiSTRIKE-Neg, which encodes a shRNA directed against a sequence deleted in the Rluc reporter mRNA, was used as a control. Results of Rluc activity were normalized with Fluc activity and expressed as a percentage of Rluc activity obtained with psiSTRIKE-Neg. Results are expressed as mean ± s.e.m. (n = 3 experiments, in duplicate).

Techniques Used: Construct, RNA Expression, Northern Blot, Expressing, Western Blot, Binding Assay, shRNA, Sequencing, Activity Assay

HCV domains II, III and VI are processed into ~21 to 23-nt RNA species by recombinant human Dicer in vitro . (A) Predicted secondary structure of nt 1 to 515 of the HCV RNA genome. (B) Dicer RNase activity assays. 32 P-labeled HCV RNA domain II (left panel), domain VI (center panel) or domain III (right panel) was incubated in the absence (-) or presence (+) of recombinant human Dicer (65 ng) with MgCl 2 . The samples were analyzed by denaturing PAGE and autoradiography. M, indicates a 10-nt RNA size marker.
Figure Legend Snippet: HCV domains II, III and VI are processed into ~21 to 23-nt RNA species by recombinant human Dicer in vitro . (A) Predicted secondary structure of nt 1 to 515 of the HCV RNA genome. (B) Dicer RNase activity assays. 32 P-labeled HCV RNA domain II (left panel), domain VI (center panel) or domain III (right panel) was incubated in the absence (-) or presence (+) of recombinant human Dicer (65 ng) with MgCl 2 . The samples were analyzed by denaturing PAGE and autoradiography. M, indicates a 10-nt RNA size marker.

Techniques Used: Recombinant, In Vitro, Activity Assay, Labeling, Incubation, Polyacrylamide Gel Electrophoresis, Autoradiography, Marker

Dicer does not bind HCV IRES in vivo . HCV IRES nt 1-341 was amplified by RT-PCR from RNA extracted from Dicer immunoprecipitates (IPs) prepared from Huh-7 or 9–13 cells by ribonucleoprotein immunoprecipitation (RIP) assay. The amplified DNA products were analyzed by 1.5% agarose gel electrophoresis and stained with ethidium bromide (lower panel). Proteins (100 μg) were analyzed by 10% SDS-PAGE to visualize Dicer protein expression or immunoprecipitation in Huh-7 and 9–13 cells (upper panel).
Figure Legend Snippet: Dicer does not bind HCV IRES in vivo . HCV IRES nt 1-341 was amplified by RT-PCR from RNA extracted from Dicer immunoprecipitates (IPs) prepared from Huh-7 or 9–13 cells by ribonucleoprotein immunoprecipitation (RIP) assay. The amplified DNA products were analyzed by 1.5% agarose gel electrophoresis and stained with ethidium bromide (lower panel). Proteins (100 μg) were analyzed by 10% SDS-PAGE to visualize Dicer protein expression or immunoprecipitation in Huh-7 and 9–13 cells (upper panel).

Techniques Used: In Vivo, Amplification, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Agarose Gel Electrophoresis, Staining, SDS Page, Expressing

40) Product Images from "Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release"

Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release

Journal: World Journal of Gastroenterology

doi: 10.3748/wjg.v24.i12.1299

Colocalization analysis of lipid droplets and hepatitis C virus NS5A. JFH1 and mJFH1 RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 48 h after transfection, the cells were fixed. Lipid droplets were stained with LipidTOXRed (Red). The HCV NS5A was stained with anti-NS5A antibody (Green). The nucleus was stained with DAPI (Blue). Each triplicate sample of 25 cells was analyzed using Image J software. The degree of co-localization was quantified and compared using Pearson’s correlation coefficients.
Figure Legend Snippet: Colocalization analysis of lipid droplets and hepatitis C virus NS5A. JFH1 and mJFH1 RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 48 h after transfection, the cells were fixed. Lipid droplets were stained with LipidTOXRed (Red). The HCV NS5A was stained with anti-NS5A antibody (Green). The nucleus was stained with DAPI (Blue). Each triplicate sample of 25 cells was analyzed using Image J software. The degree of co-localization was quantified and compared using Pearson’s correlation coefficients.

Techniques Used: Transfection, Staining, Software

Generation of high titer cell culture-adaptive JFH1 virus. Hepatitis C virus RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus in cell culture. The transfected cells were passaged every three days. The infectivity titers of the culture supernatants at day 3 (P1) and day 9 (P3) were measured. Viral titers are expressed as focus-forming units per milliliter (FFUs/mL). The data are presented as mean ± SD ( n = 3). HCV: Hepatitis C virus. a P
Figure Legend Snippet: Generation of high titer cell culture-adaptive JFH1 virus. Hepatitis C virus RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus in cell culture. The transfected cells were passaged every three days. The infectivity titers of the culture supernatants at day 3 (P1) and day 9 (P3) were measured. Viral titers are expressed as focus-forming units per milliliter (FFUs/mL). The data are presented as mean ± SD ( n = 3). HCV: Hepatitis C virus. a P

Techniques Used: Cell Culture, Transfection, Infection

Effects of the adaptive mutations on the hepatitis C virus RNA replication. A: Hepatitis C virus (HCV) RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. The transfected cells were passaged every 3 d. Cells were fixed 48 h after passage and infected cells were identified by fluorescence immunostaining and microscopy. Nuclear DNA was stained with DAPI (blue); B: HCV RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus in cell culture. The transfected cells were passaged every 3 d. Cells were lysed at 72 h after passage. The HCV NS3 protein levels were analysis by Western blot. b P
Figure Legend Snippet: Effects of the adaptive mutations on the hepatitis C virus RNA replication. A: Hepatitis C virus (HCV) RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. The transfected cells were passaged every 3 d. Cells were fixed 48 h after passage and infected cells were identified by fluorescence immunostaining and microscopy. Nuclear DNA was stained with DAPI (blue); B: HCV RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus in cell culture. The transfected cells were passaged every 3 d. Cells were lysed at 72 h after passage. The HCV NS3 protein levels were analysis by Western blot. b P

Techniques Used: Transfection, Infection, Fluorescence, Immunostaining, Microscopy, Staining, Cell Culture, Western Blot

Effect of the adaptive mutations on the virion release. A: Hepatitis C virus (HCV) RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 72 h after transfection, the infectivity titers of the culture supernatants and cell lysates were measured. Viral titers are expressed as FFUs/mL. The data are presented as mean ± SD ( n = 3); B: HCV RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 72 h after transfection, the infectivity titers of the culture media and cell lysates were measured. The extracellular and intracellular viral titers were measured. The relative ratios of infectious virions are shown. The results were from three independent experiments; C: The naive Huh7.5 cells were infected with the culture media and cell lysates. At 72 h after infection, cells were lysed with RIPA buffer, and analyzed by Western blot.
Figure Legend Snippet: Effect of the adaptive mutations on the virion release. A: Hepatitis C virus (HCV) RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 72 h after transfection, the infectivity titers of the culture supernatants and cell lysates were measured. Viral titers are expressed as FFUs/mL. The data are presented as mean ± SD ( n = 3); B: HCV RNA was electroporated into Huh7.5 cells to produce the recombinants of adapted virus. At 72 h after transfection, the infectivity titers of the culture media and cell lysates were measured. The extracellular and intracellular viral titers were measured. The relative ratios of infectious virions are shown. The results were from three independent experiments; C: The naive Huh7.5 cells were infected with the culture media and cell lysates. At 72 h after infection, cells were lysed with RIPA buffer, and analyzed by Western blot.

Techniques Used: Transfection, Infection, Western Blot

Schematic representation of adaptive mutations used in this study (A) and the electrophoresis results of each mutant virus RNA (B). A: Both nucleotide substitutions (2310, 2681, 6132, 7160, 7359, and 7658) and amino acid substitutions (D657G, H781Y, N1931S, C2274R, I2340T, and V2440L) are shown; B: HCV RNA (500 ng) was analyzed using formaldehyde agarose gel electrophoresis. Lane 1: JFH1; Lane 2: JFH1-mE2; Lane 3: JFH1-mP7; Lane 4: JFH1-mNS4B; Lane 5: JFH1-mNS5A; Lane 6: JFH1-mE2/NS5A; Lane 7: JFH1-mp7/NS5A; Lane 8: JFH1-mNS4B/NS5A; Lane 9: mJFH1; Lane 10: JFH1-mE2/p7/NS5A; M: RNA marker. HCV: hepatitis C virus.
Figure Legend Snippet: Schematic representation of adaptive mutations used in this study (A) and the electrophoresis results of each mutant virus RNA (B). A: Both nucleotide substitutions (2310, 2681, 6132, 7160, 7359, and 7658) and amino acid substitutions (D657G, H781Y, N1931S, C2274R, I2340T, and V2440L) are shown; B: HCV RNA (500 ng) was analyzed using formaldehyde agarose gel electrophoresis. Lane 1: JFH1; Lane 2: JFH1-mE2; Lane 3: JFH1-mP7; Lane 4: JFH1-mNS4B; Lane 5: JFH1-mNS5A; Lane 6: JFH1-mE2/NS5A; Lane 7: JFH1-mp7/NS5A; Lane 8: JFH1-mNS4B/NS5A; Lane 9: mJFH1; Lane 10: JFH1-mE2/p7/NS5A; M: RNA marker. HCV: hepatitis C virus.

Techniques Used: Electrophoresis, Mutagenesis, Agarose Gel Electrophoresis, Marker

Related Articles

Polymerase Chain Reaction:

Article Title: Automated Extraction of Viral-Pathogen RNA and DNA for High-Throughput Quantitative Real-Time PCR
Article Snippet: .. In the first part of the study, the linearity and accuracy of the in-house real-time HCV and HBV PCR with the automated sample preparation protocol was determined with dilutions of commercially available HCV and HBV controls (NAP-HCV007 and NAP-HBV006; Acrometrix) and the samples of the HCV and HBV 2004 QCMD proficiency program panels. .. In the second part, the intrarun and interrun variations for the HCV and HBV assays with automated sample preparation were determined using three different dilutions of a positive sample for both assays.

Sample Prep:

Article Title: Automated Extraction of Viral-Pathogen RNA and DNA for High-Throughput Quantitative Real-Time PCR
Article Snippet: .. In the first part of the study, the linearity and accuracy of the in-house real-time HCV and HBV PCR with the automated sample preparation protocol was determined with dilutions of commercially available HCV and HBV controls (NAP-HCV007 and NAP-HBV006; Acrometrix) and the samples of the HCV and HBV 2004 QCMD proficiency program panels. .. In the second part, the intrarun and interrun variations for the HCV and HBV assays with automated sample preparation were determined using three different dilutions of a positive sample for both assays.

Purification:

Article Title: Multiplexed quantification of nucleic acids with large dynamic range using multivolume digital RT-PCR on a rotational SlipChip tested with HIV and Hepatitis C viral load
Article Snippet: .. HIV viral RNA was purified from an archived sample of plasma containing HIV (viral RNA estimated to be ∼1.5×106 molecules/mL) from a deidentified patient sample, and HCV control viral RNA was purified from a commercial sample containing control HCV virus (25 million IU/ml, OptiQuant-S HCV Quantification Panel, Acrometrix) using the iPrep purification instrument (see Experimental Section in ). .. As the final elution volume of purified nucleic acid is generally smaller than the starting volume of plasma, there is a concentrating effect on viral RNA after sample purification.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher genomic hcv rna
    Disruption in the 5′UTR nt95–110:NS5B nt8528–8543 duplex reduces intracellular <t>HCV</t> <t>RNA</t> levels. ( A ) Huh-7.5 cells transfected with HCV genomic RNA (WT) or HCV genomic RNA containing mutations at 5′UTR nt 95–110 and NS5B nt 8528–8543 express NS5B antigen 24 h post-transfection. Scale bar = 50 µm. ( B ) Plots represent the average number of HCV RNA genome copies ± SE in 1 μg of cellular RNA at 48 h post-transfection. p -values ≤ 0.05 (*) or ≤ 0.01 (**) were determined by the Student’s t -test and represent four or more independent experiments.
    Genomic Hcv Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic hcv rna/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    genomic hcv rna - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    90
    Thermo Fisher in vitro transcription hcv jfh1 rna
    HuR‐driven EV‐mediated export of mi <t>RNA</t> let‐7a in MDA ‐ MB ‐231 cells controls cell proliferation and senescence Effect of siRNA‐mediated HuR depletion on cellular and EV‐associated let‐7a level. Control siRNA (SiCon)‐treated cells were used as reference. miRNA levels were analyzed by qRT–PCR (mean ± s.e.m., n = 5). U6 snRNA levels were used for normalization of cellular miRNA content. Effect of GW4869 treatment on senescence status of MDA‐MB‐231 cells. Representative pictures of senescence status of MDA‐MB‐231 are shown in (B), while the quantification (left panel) and expression status of few senescence‐related proteins (right panel) are shown in (C) (mean ± s.e.m., n = 3). Effect of inactivation of let‐7a on senescence status of MDA‐MB‐231. Growth‐retarded MDA‐MB‐231 cells were treated with either anti‐let‐7a or anti‐miR‐122 oligonucleotides (control) and senescence status was measured (mean ± s.e.m., n = 5). Effect of let‐7a expression on proliferation status of MDA‐MB‐231 cells treated or untreated with exosomal export blocker GW4869. Nuclei were stained for PCNA and percentage of cells with PCNA‐positive nuclei were calculated and plotted (mean ± s.e.m., n = 3). Effect of HuR depletion on the let‐7a‐induced senescence. Senescence levels of siControl‐ or siHuR‐treated MDA‐MB‐231 cells pre‐transfected with pre‐let‐7a RNA were measured and plotted (mean ± s.e.m., n = 3). Effect of Myc‐HuR expression on the <t>HCV</t> replicon RNA level and cellular miR‐122 content in Huh7 cells. A possible model of HCV replication regulation by miR‐122 and HuR (H). Relative change in expression level of miR‐122 (I) and HCV replicon RNA (J) upon co‐transfection with Myc‐HuR. The expression of Myc‐HuR was confirmed by Western blot for HuR in (J) and marked by arrow. Data information: Positions of size markers in protein gels used for respective Western blot analysis are shown against each panel. * P
    In Vitro Transcription Hcv Jfh1 Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in vitro transcription hcv jfh1 rna/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    in vitro transcription hcv jfh1 rna - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    92
    Thermo Fisher hcv rna transfected donor cells
    . (B) Levels of NS2 in lysates of cells <t>transfected</t> with the plasmids indicated and blotted with anti-GLuc and anti-actin antibodies. (C) Interactions of WT or mutant NS2 with AP-1A, AP-1B, and AP-4 by PCAs. Plotted are NLRs relative to WT NS2-AP binding. (D) Cells were electroporated with WT or mutated NS2 bicistronic J6/H77NS2/JFH <t>HCV</t> <t>RNA.</t> HCV RNA replication measured via luciferase assays 8 and 72 h after HCV RNA electroporation. RLU, relative light units. (E) HCV infectivity measured via luciferase assays by inoculating naive cells with lysates (intracellular) and supernatants (extracellular) from electroporated cells. (F) Intra- and extracellular infectivity titers measured by limiting-dilution assays (top) and percentages of intracellular infectivity per total (intra- and extracellular) infectivity for the dish (bottom). Viral RNA (G) and HCV core protein (H) release into culture supernatant at 72 h postelectroporation measured by qRT-PCR and ELISA, respectively. GNN is a replication-incompetent HCV strain. ΔE1-E2 is an assembly-defective mutant. Results in panels C to H represent data pooled from at least two independent experiments each with 3 to 10 biological replicates. Shown are the mean ± SD. *, P
    Hcv Rna Transfected Donor Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hcv rna transfected donor cells/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hcv rna transfected donor cells - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    93
    Thermo Fisher hcv rna
    Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with <t>HCV</t> at an MOI of 2. Intracellular HCV <t>RNA</t> was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P
    Hcv Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hcv rna/product/Thermo Fisher
    Average 93 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    hcv rna - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    Disruption in the 5′UTR nt95–110:NS5B nt8528–8543 duplex reduces intracellular HCV RNA levels. ( A ) Huh-7.5 cells transfected with HCV genomic RNA (WT) or HCV genomic RNA containing mutations at 5′UTR nt 95–110 and NS5B nt 8528–8543 express NS5B antigen 24 h post-transfection. Scale bar = 50 µm. ( B ) Plots represent the average number of HCV RNA genome copies ± SE in 1 μg of cellular RNA at 48 h post-transfection. p -values ≤ 0.05 (*) or ≤ 0.01 (**) were determined by the Student’s t -test and represent four or more independent experiments.

    Journal: Viruses

    Article Title: Genomic-Scale Interaction Involving Complementary Sequences in the Hepatitis C Virus 5′UTR Domain IIa and the RNA-Dependent RNA Polymerase Coding Region Promotes Efficient Virus Replication

    doi: 10.3390/v11010017

    Figure Lengend Snippet: Disruption in the 5′UTR nt95–110:NS5B nt8528–8543 duplex reduces intracellular HCV RNA levels. ( A ) Huh-7.5 cells transfected with HCV genomic RNA (WT) or HCV genomic RNA containing mutations at 5′UTR nt 95–110 and NS5B nt 8528–8543 express NS5B antigen 24 h post-transfection. Scale bar = 50 µm. ( B ) Plots represent the average number of HCV RNA genome copies ± SE in 1 μg of cellular RNA at 48 h post-transfection. p -values ≤ 0.05 (*) or ≤ 0.01 (**) were determined by the Student’s t -test and represent four or more independent experiments.

    Article Snippet: Genomic HCV RNA was synthesized using the MEGAscript T7 kit (Thermo Fisher Scientific) with 1 µg of Xba I-linearized, mung bean nuclease-treated pER-1b or pER-1b containing 5′UTR or NS5B mutations (Thermo Fisher Scientific).

    Techniques: Transfection

    Disruption in the 5′UTR nt 95–110:NS5B nt 8528–8543 duplex reduced progeny virus titers. Huh-7.5 cells were infected with HCV parental virus (WT) or HCV containing mutations at 5′UTR nt 95–110 and NS5B nt 8528–8543. Plots represent the average number of infectious virus titers as focus-forming units (FFU)/mL or HCV RNA genome copies ± SE in 1 μg of cellular RNA taken at 48 h post-infection. p -values ≤ 0.05 (*) or ≤ 0.01 (**) were determined by the Student’s t -test and represent six independent experiments.

    Journal: Viruses

    Article Title: Genomic-Scale Interaction Involving Complementary Sequences in the Hepatitis C Virus 5′UTR Domain IIa and the RNA-Dependent RNA Polymerase Coding Region Promotes Efficient Virus Replication

    doi: 10.3390/v11010017

    Figure Lengend Snippet: Disruption in the 5′UTR nt 95–110:NS5B nt 8528–8543 duplex reduced progeny virus titers. Huh-7.5 cells were infected with HCV parental virus (WT) or HCV containing mutations at 5′UTR nt 95–110 and NS5B nt 8528–8543. Plots represent the average number of infectious virus titers as focus-forming units (FFU)/mL or HCV RNA genome copies ± SE in 1 μg of cellular RNA taken at 48 h post-infection. p -values ≤ 0.05 (*) or ≤ 0.01 (**) were determined by the Student’s t -test and represent six independent experiments.

    Article Snippet: Genomic HCV RNA was synthesized using the MEGAscript T7 kit (Thermo Fisher Scientific) with 1 µg of Xba I-linearized, mung bean nuclease-treated pER-1b or pER-1b containing 5′UTR or NS5B mutations (Thermo Fisher Scientific).

    Techniques: Infection

    HuR‐driven EV‐mediated export of mi RNA let‐7a in MDA ‐ MB ‐231 cells controls cell proliferation and senescence Effect of siRNA‐mediated HuR depletion on cellular and EV‐associated let‐7a level. Control siRNA (SiCon)‐treated cells were used as reference. miRNA levels were analyzed by qRT–PCR (mean ± s.e.m., n = 5). U6 snRNA levels were used for normalization of cellular miRNA content. Effect of GW4869 treatment on senescence status of MDA‐MB‐231 cells. Representative pictures of senescence status of MDA‐MB‐231 are shown in (B), while the quantification (left panel) and expression status of few senescence‐related proteins (right panel) are shown in (C) (mean ± s.e.m., n = 3). Effect of inactivation of let‐7a on senescence status of MDA‐MB‐231. Growth‐retarded MDA‐MB‐231 cells were treated with either anti‐let‐7a or anti‐miR‐122 oligonucleotides (control) and senescence status was measured (mean ± s.e.m., n = 5). Effect of let‐7a expression on proliferation status of MDA‐MB‐231 cells treated or untreated with exosomal export blocker GW4869. Nuclei were stained for PCNA and percentage of cells with PCNA‐positive nuclei were calculated and plotted (mean ± s.e.m., n = 3). Effect of HuR depletion on the let‐7a‐induced senescence. Senescence levels of siControl‐ or siHuR‐treated MDA‐MB‐231 cells pre‐transfected with pre‐let‐7a RNA were measured and plotted (mean ± s.e.m., n = 3). Effect of Myc‐HuR expression on the HCV replicon RNA level and cellular miR‐122 content in Huh7 cells. A possible model of HCV replication regulation by miR‐122 and HuR (H). Relative change in expression level of miR‐122 (I) and HCV replicon RNA (J) upon co‐transfection with Myc‐HuR. The expression of Myc‐HuR was confirmed by Western blot for HuR in (J) and marked by arrow. Data information: Positions of size markers in protein gels used for respective Western blot analysis are shown against each panel. * P

    Journal: EMBO Reports

    Article Title: Reversible HuR‐micro RNA binding controls extracellular export of miR‐122 and augments stress response

    doi: 10.15252/embr.201541930

    Figure Lengend Snippet: HuR‐driven EV‐mediated export of mi RNA let‐7a in MDA ‐ MB ‐231 cells controls cell proliferation and senescence Effect of siRNA‐mediated HuR depletion on cellular and EV‐associated let‐7a level. Control siRNA (SiCon)‐treated cells were used as reference. miRNA levels were analyzed by qRT–PCR (mean ± s.e.m., n = 5). U6 snRNA levels were used for normalization of cellular miRNA content. Effect of GW4869 treatment on senescence status of MDA‐MB‐231 cells. Representative pictures of senescence status of MDA‐MB‐231 are shown in (B), while the quantification (left panel) and expression status of few senescence‐related proteins (right panel) are shown in (C) (mean ± s.e.m., n = 3). Effect of inactivation of let‐7a on senescence status of MDA‐MB‐231. Growth‐retarded MDA‐MB‐231 cells were treated with either anti‐let‐7a or anti‐miR‐122 oligonucleotides (control) and senescence status was measured (mean ± s.e.m., n = 5). Effect of let‐7a expression on proliferation status of MDA‐MB‐231 cells treated or untreated with exosomal export blocker GW4869. Nuclei were stained for PCNA and percentage of cells with PCNA‐positive nuclei were calculated and plotted (mean ± s.e.m., n = 3). Effect of HuR depletion on the let‐7a‐induced senescence. Senescence levels of siControl‐ or siHuR‐treated MDA‐MB‐231 cells pre‐transfected with pre‐let‐7a RNA were measured and plotted (mean ± s.e.m., n = 3). Effect of Myc‐HuR expression on the HCV replicon RNA level and cellular miR‐122 content in Huh7 cells. A possible model of HCV replication regulation by miR‐122 and HuR (H). Relative change in expression level of miR‐122 (I) and HCV replicon RNA (J) upon co‐transfection with Myc‐HuR. The expression of Myc‐HuR was confirmed by Western blot for HuR in (J) and marked by arrow. Data information: Positions of size markers in protein gels used for respective Western blot analysis are shown against each panel. * P

    Article Snippet: In vitro transcription HCV‐JFH1 RNA was transcribed in vitro from the XbaI linearized HCV‐JFH1 plasmid DNA construct using T7 RNA polymerase (Thermo Scientific).

    Techniques: Multiple Displacement Amplification, Quantitative RT-PCR, Expressing, Staining, Transfection, Cotransfection, Western Blot

    . (B) Levels of NS2 in lysates of cells transfected with the plasmids indicated and blotted with anti-GLuc and anti-actin antibodies. (C) Interactions of WT or mutant NS2 with AP-1A, AP-1B, and AP-4 by PCAs. Plotted are NLRs relative to WT NS2-AP binding. (D) Cells were electroporated with WT or mutated NS2 bicistronic J6/H77NS2/JFH HCV RNA. HCV RNA replication measured via luciferase assays 8 and 72 h after HCV RNA electroporation. RLU, relative light units. (E) HCV infectivity measured via luciferase assays by inoculating naive cells with lysates (intracellular) and supernatants (extracellular) from electroporated cells. (F) Intra- and extracellular infectivity titers measured by limiting-dilution assays (top) and percentages of intracellular infectivity per total (intra- and extracellular) infectivity for the dish (bottom). Viral RNA (G) and HCV core protein (H) release into culture supernatant at 72 h postelectroporation measured by qRT-PCR and ELISA, respectively. GNN is a replication-incompetent HCV strain. ΔE1-E2 is an assembly-defective mutant. Results in panels C to H represent data pooled from at least two independent experiments each with 3 to 10 biological replicates. Shown are the mean ± SD. *, P

    Journal: mBio

    Article Title: Interactions between the Hepatitis C Virus Nonstructural 2 Protein and Host Adaptor Proteins 1 and 4 Orchestrate Virus Release

    doi: 10.1128/mBio.02233-17

    Figure Lengend Snippet: . (B) Levels of NS2 in lysates of cells transfected with the plasmids indicated and blotted with anti-GLuc and anti-actin antibodies. (C) Interactions of WT or mutant NS2 with AP-1A, AP-1B, and AP-4 by PCAs. Plotted are NLRs relative to WT NS2-AP binding. (D) Cells were electroporated with WT or mutated NS2 bicistronic J6/H77NS2/JFH HCV RNA. HCV RNA replication measured via luciferase assays 8 and 72 h after HCV RNA electroporation. RLU, relative light units. (E) HCV infectivity measured via luciferase assays by inoculating naive cells with lysates (intracellular) and supernatants (extracellular) from electroporated cells. (F) Intra- and extracellular infectivity titers measured by limiting-dilution assays (top) and percentages of intracellular infectivity per total (intra- and extracellular) infectivity for the dish (bottom). Viral RNA (G) and HCV core protein (H) release into culture supernatant at 72 h postelectroporation measured by qRT-PCR and ELISA, respectively. GNN is a replication-incompetent HCV strain. ΔE1-E2 is an assembly-defective mutant. Results in panels C to H represent data pooled from at least two independent experiments each with 3 to 10 biological replicates. Shown are the mean ± SD. *, P

    Article Snippet: HCV RNA-transfected donor cells were cocultured with GFP-expressing target cells in the presence of neutralizing anti-E2 antibodies (CBH-5) or a human IgG isotype control (Thermo Fisher no. 12000C) at a concentration of 20 μg/ml.

    Techniques: Transfection, Mutagenesis, Binding Assay, Luciferase, Electroporation, Infection, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    AP-1A/B and AP-4 mediate HCV release. (A) Confirmation of gene expression knockdown by Western blotting in Huh7.5 cells stably expressing AP shRNA or an NT control (values are AP-to-actin protein ratios relative to the NT control). (B) Relative cell viability in these cell lines measured by alamarBlue assays. (C) HCV RNA replication measured via luciferase assays 5 and 72 h after HCV RNA electroporation. RLU, relative light units. (D) HCV infectivity measured via luciferase assay by inoculating naive cells with lysates (intracellular) and supernatants (extracellular) from electroporated cells. (E to G) Levels of APs by Western blot analysis (E), intra- and extracellular viral titers measured by limiting-dilution assays (F), and intracellular infectivity as a percentage of the total infectivity (G) in cells concurrently transduced with shAP-1A, shAP-1B, and shAP-4 and transfected with the respective shRNA-resistant AP cDNA or an empty control plasmid. (H and I) Viral RNA (H) and core protein (I) release into the culture supernatant at 72 h postelectroporation measured by qRT-PCR and ELISA, respectively. Data are plotted relative to NT control values. Results in panels C, D, and F to I represent data pooled from three independent experiments each with three to six biological replicates. Shown are the mean ± SD. *, P

    Journal: mBio

    Article Title: Interactions between the Hepatitis C Virus Nonstructural 2 Protein and Host Adaptor Proteins 1 and 4 Orchestrate Virus Release

    doi: 10.1128/mBio.02233-17

    Figure Lengend Snippet: AP-1A/B and AP-4 mediate HCV release. (A) Confirmation of gene expression knockdown by Western blotting in Huh7.5 cells stably expressing AP shRNA or an NT control (values are AP-to-actin protein ratios relative to the NT control). (B) Relative cell viability in these cell lines measured by alamarBlue assays. (C) HCV RNA replication measured via luciferase assays 5 and 72 h after HCV RNA electroporation. RLU, relative light units. (D) HCV infectivity measured via luciferase assay by inoculating naive cells with lysates (intracellular) and supernatants (extracellular) from electroporated cells. (E to G) Levels of APs by Western blot analysis (E), intra- and extracellular viral titers measured by limiting-dilution assays (F), and intracellular infectivity as a percentage of the total infectivity (G) in cells concurrently transduced with shAP-1A, shAP-1B, and shAP-4 and transfected with the respective shRNA-resistant AP cDNA or an empty control plasmid. (H and I) Viral RNA (H) and core protein (I) release into the culture supernatant at 72 h postelectroporation measured by qRT-PCR and ELISA, respectively. Data are plotted relative to NT control values. Results in panels C, D, and F to I represent data pooled from three independent experiments each with three to six biological replicates. Shown are the mean ± SD. *, P

    Article Snippet: HCV RNA-transfected donor cells were cocultured with GFP-expressing target cells in the presence of neutralizing anti-E2 antibodies (CBH-5) or a human IgG isotype control (Thermo Fisher no. 12000C) at a concentration of 20 μg/ml.

    Techniques: Expressing, Western Blot, Stable Transfection, shRNA, Luciferase, Electroporation, Infection, Transduction, Transfection, Plasmid Preparation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    AAK1 and GAK regulate NS2–AP-1 binding and HCV cell-free and cell-to-cell spread. (A) AP-1 expression following transfection of Huh7.5 cells with GLuc-tagged WT or T144A mutant AP-1A/B or an empty control and blotting with anti-GLuc and anti-actin antibodies. (B) NS2 binding to WT and T144A mutant AP-1A/B measured by PCA. Data are plotted relative to the respective WT control. (C) HCV cell-to-cell spread in AP-1B-overexpressing cells versus an empty-vector control measured via FACS analysis 48 h following coculturing of HCV RNA-transfected donor Huh7.5 cells with GFP-expressing target cells. (D) Confirmation of gene expression knockout (KO) by Western blotting in Huh7.5 cells transduced with CRISPR subgenomic RNA lentivirus targeting AAK1 or GAK or an NT control. (E) NS2 binding to AP-1B measured in AAK1 and GAK knockout cells by PCAs. Data are plotted relative to the control cells. (F) Chemical structures of the compounds indicated. (G) Effects of the compounds indicated on NS2–AP-1B binding measured by PCA. (H) Cell-free infectivity of culture supernatants collected following a 6-h treatment of HCV RNA-transfected cells with the four individual compounds at a concentration of 10 μM (compound 7745, 12i, and erlotinib) or 2.5 μM (sunitinib), followed by compound removal and a 12-h incubation in fresh medium, measured via luciferase assay at 72 h postinoculation of naive cells. (I) Dose response of HCV cell-to-cell spread to the compounds indicated measured by FACS analysis following a 6-h treatment of cocultures of HCV RNA-transfected Huh7.5 donor cells and GFP-expressing target cells. Shown in panels B, C, E, and G to I are representative results of experiments from at least two conducted, each with three to six biological replicates. Shown are the mean ± SD. ns, not significant; *, P

    Journal: mBio

    Article Title: Interactions between the Hepatitis C Virus Nonstructural 2 Protein and Host Adaptor Proteins 1 and 4 Orchestrate Virus Release

    doi: 10.1128/mBio.02233-17

    Figure Lengend Snippet: AAK1 and GAK regulate NS2–AP-1 binding and HCV cell-free and cell-to-cell spread. (A) AP-1 expression following transfection of Huh7.5 cells with GLuc-tagged WT or T144A mutant AP-1A/B or an empty control and blotting with anti-GLuc and anti-actin antibodies. (B) NS2 binding to WT and T144A mutant AP-1A/B measured by PCA. Data are plotted relative to the respective WT control. (C) HCV cell-to-cell spread in AP-1B-overexpressing cells versus an empty-vector control measured via FACS analysis 48 h following coculturing of HCV RNA-transfected donor Huh7.5 cells with GFP-expressing target cells. (D) Confirmation of gene expression knockout (KO) by Western blotting in Huh7.5 cells transduced with CRISPR subgenomic RNA lentivirus targeting AAK1 or GAK or an NT control. (E) NS2 binding to AP-1B measured in AAK1 and GAK knockout cells by PCAs. Data are plotted relative to the control cells. (F) Chemical structures of the compounds indicated. (G) Effects of the compounds indicated on NS2–AP-1B binding measured by PCA. (H) Cell-free infectivity of culture supernatants collected following a 6-h treatment of HCV RNA-transfected cells with the four individual compounds at a concentration of 10 μM (compound 7745, 12i, and erlotinib) or 2.5 μM (sunitinib), followed by compound removal and a 12-h incubation in fresh medium, measured via luciferase assay at 72 h postinoculation of naive cells. (I) Dose response of HCV cell-to-cell spread to the compounds indicated measured by FACS analysis following a 6-h treatment of cocultures of HCV RNA-transfected Huh7.5 donor cells and GFP-expressing target cells. Shown in panels B, C, E, and G to I are representative results of experiments from at least two conducted, each with three to six biological replicates. Shown are the mean ± SD. ns, not significant; *, P

    Article Snippet: HCV RNA-transfected donor cells were cocultured with GFP-expressing target cells in the presence of neutralizing anti-E2 antibodies (CBH-5) or a human IgG isotype control (Thermo Fisher no. 12000C) at a concentration of 20 μg/ml.

    Techniques: Binding Assay, Expressing, Transfection, Mutagenesis, Plasmid Preparation, FACS, Knock-Out, Western Blot, Transduction, CRISPR, Infection, Concentration Assay, Incubation, Luciferase

    HCV particles cotraffic with AP-4 in a post-TGN compartment. (A) Quantification of motile TC-core puncta cotrafficking with AP-4, AP-1A, AP-1B, AP-2, and LC3. (B) Representative live-cell fluorescence microscopy montages of TC-core HCV (green) cotrafficking with AP-4-mCherry (top and panels middle) or AP-1B-meCherry (bottom) (red). The time elapsed (seconds) during video acquisition and the vertical dimension of the crop (micrometers) are indicated. (C) Velocity (left) and total distance traveled (right) of individual TC-core puncta cotrafficking with AP-4, AP-1A, AP-1B, or AP-2. (D and E) Representative montages (D) and quantitative data relative to WT TC-core (E) from live cell fluorescence microscopy of AP-4 cotrafficking with Y136A (top), NS2 deletion (middle), and NS2 double dileucine (DM; bottom) TC-core mutants. (F) Quantification of velocity per acquisition of WT TC-Core associated with AP-4 upon treatment with PIK93. (G) HCV cell-to-cell spread measured by FACS analysis following a 6-h treatment of cocultures of HCV RNA-transfected Huh7.5 donor cells and GFP-expressing target cells with PIK93. (H) Representative confocal IF microscopy images at ×40 magnification of NS2 (green) and TGN46 (red) or RAB11 (red) in HCV-transfected cells. n = > 25. Scale bars represent 10 µm. (I) Quantitative colocalization analysis of z stacks by using Manders’ colocalization coefficients. Mean M2 values are represented as percent colocalization (the fraction of green intensity that coincides with red intensity ± SD). N.D., not detected. Experiments were replicated at least twice. *, P

    Journal: mBio

    Article Title: Interactions between the Hepatitis C Virus Nonstructural 2 Protein and Host Adaptor Proteins 1 and 4 Orchestrate Virus Release

    doi: 10.1128/mBio.02233-17

    Figure Lengend Snippet: HCV particles cotraffic with AP-4 in a post-TGN compartment. (A) Quantification of motile TC-core puncta cotrafficking with AP-4, AP-1A, AP-1B, AP-2, and LC3. (B) Representative live-cell fluorescence microscopy montages of TC-core HCV (green) cotrafficking with AP-4-mCherry (top and panels middle) or AP-1B-meCherry (bottom) (red). The time elapsed (seconds) during video acquisition and the vertical dimension of the crop (micrometers) are indicated. (C) Velocity (left) and total distance traveled (right) of individual TC-core puncta cotrafficking with AP-4, AP-1A, AP-1B, or AP-2. (D and E) Representative montages (D) and quantitative data relative to WT TC-core (E) from live cell fluorescence microscopy of AP-4 cotrafficking with Y136A (top), NS2 deletion (middle), and NS2 double dileucine (DM; bottom) TC-core mutants. (F) Quantification of velocity per acquisition of WT TC-Core associated with AP-4 upon treatment with PIK93. (G) HCV cell-to-cell spread measured by FACS analysis following a 6-h treatment of cocultures of HCV RNA-transfected Huh7.5 donor cells and GFP-expressing target cells with PIK93. (H) Representative confocal IF microscopy images at ×40 magnification of NS2 (green) and TGN46 (red) or RAB11 (red) in HCV-transfected cells. n = > 25. Scale bars represent 10 µm. (I) Quantitative colocalization analysis of z stacks by using Manders’ colocalization coefficients. Mean M2 values are represented as percent colocalization (the fraction of green intensity that coincides with red intensity ± SD). N.D., not detected. Experiments were replicated at least twice. *, P

    Article Snippet: HCV RNA-transfected donor cells were cocultured with GFP-expressing target cells in the presence of neutralizing anti-E2 antibodies (CBH-5) or a human IgG isotype control (Thermo Fisher no. 12000C) at a concentration of 20 μg/ml.

    Techniques: Fluorescence, Microscopy, FACS, Transfection, Expressing

    Interactions between HCV proteins and host APs. (A) Results of PCA screening for interactions of AP μ subunits with individual HCV proteins. Histogram of the mean z scores of the set studied and RRS of interactions obtained from three independent experiments. The dotted line defines the cutoff used for positive interactions. (B) Heat map of the interactions color coded on the basis of the NLR. (C) NS2 interacts with APs in HCV RNA-transfected cells. Immunoprecipitations (IPs) from membrane fractions of HCV RNA-transfected or naive Huh7.5 cells with anti-NS2 (C), anti-AP-1A, or anti-AP-4 (D) antibodies and IgG controls (C). Antibodies used for immunoblotting are indicated on the left. (E) Representative confocal IF microscopy images at ×40 magnification of AP (red) and NS2 (green) in HCV-transfected cells. Scale bars represent 10 µm. (F) Quantitative colocalization analysis of z stacks by using Manders’ colocalization coefficients. Mean M2 values are presented as percent colocalization (the fraction of green intensity that coincides with red intensity) ± SD.

    Journal: mBio

    Article Title: Interactions between the Hepatitis C Virus Nonstructural 2 Protein and Host Adaptor Proteins 1 and 4 Orchestrate Virus Release

    doi: 10.1128/mBio.02233-17

    Figure Lengend Snippet: Interactions between HCV proteins and host APs. (A) Results of PCA screening for interactions of AP μ subunits with individual HCV proteins. Histogram of the mean z scores of the set studied and RRS of interactions obtained from three independent experiments. The dotted line defines the cutoff used for positive interactions. (B) Heat map of the interactions color coded on the basis of the NLR. (C) NS2 interacts with APs in HCV RNA-transfected cells. Immunoprecipitations (IPs) from membrane fractions of HCV RNA-transfected or naive Huh7.5 cells with anti-NS2 (C), anti-AP-1A, or anti-AP-4 (D) antibodies and IgG controls (C). Antibodies used for immunoblotting are indicated on the left. (E) Representative confocal IF microscopy images at ×40 magnification of AP (red) and NS2 (green) in HCV-transfected cells. Scale bars represent 10 µm. (F) Quantitative colocalization analysis of z stacks by using Manders’ colocalization coefficients. Mean M2 values are presented as percent colocalization (the fraction of green intensity that coincides with red intensity) ± SD.

    Article Snippet: HCV RNA-transfected donor cells were cocultured with GFP-expressing target cells in the presence of neutralizing anti-E2 antibodies (CBH-5) or a human IgG isotype control (Thermo Fisher no. 12000C) at a concentration of 20 μg/ml.

    Techniques: Transfection, Microscopy

    Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P

    Journal: Journal of Virology

    Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

    doi: 10.1128/JVI.00503-18

    Figure Lengend Snippet: Stable transduction with lentiviral shRNA vectors exhibits off-target effects. (a) Huh7.5-1, Puro (Huh7.5-1 cells transfected with a plasmid expressing a puromycin resistance gene), no. 18, and no. 30 cells were infected with HCV at an MOI of 2. Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) HCVpp was used to infect Huh7.5-1, Puro, no. 18, and no. 30 cells, and firefly luciferase activity was measured to determine HCV entry. (c) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with in vitro -synthesized HCV RNA. Intracellular HCV RNA was examined by real-time PCR 48 h after transfection. (d) Huh7.5-1, Puro, no. 18, and no. 30 cells were transfected with a Tk promoter- Renilla luciferase-HCV IRES-firefly luciferase construct, and the relative IRES activity was measured 48 h after transfection. (e and f) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2, and intracellular (e) and extracellular (f) infectivity was measured 48 h after infection. The viral titer was normalized to that of Huh7.5-1 cells. (g and h) Luciferase under the IFN-β promoter (g) or the ISRE promoter (h) was transfected into Huh7.5-1, Puro, no. 18, and no. 30 cells. The cells were infected with HCV 24 h after transfection. The relative luciferase activity was measured at the indicated time points and normalized to that of Huh7.5-1 at 3 h postinfection. Huh7.5-1 cells transfected with the N terminus of RIG-I was used as a positive control. (i) Conditioned culture media from Huh7.5-1, Puro, no. 18, and no. 30 cells were used to treat HCV-infected Huh7.5-1 cells for 12 h. The intracellular HCV RNA was measured by real-time PCR 48 h postinfection. As a positive control, HCV-infected Huh7.5 cells were treated with culture medium from RIG-I-transfected Huh7.5-1 cells. (j) Huh7.5-1, Puro, no. 18, and no. 30 cells were infected with HCV at an MOI of 2. mRNAs of 4 ISG genes, OAS1, IFIT1, MX1, and ISG20, were measured by real-time PCR 48 h after infection. IFN-α-treated Huh7.5-1 was applied as a positive control. Values are presented as means and SD ( n = 3). *, P

    Article Snippet: HCV RNA was in vitro transcribed from the plasmid pJFH1 ( ) using a Mega-script kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

    Techniques: Transduction, shRNA, Transfection, Plasmid Preparation, Expressing, Infection, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, In Vitro, Synthesized, Construct, Positive Control

    Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P

    Journal: Journal of Virology

    Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

    doi: 10.1128/JVI.00503-18

    Figure Lengend Snippet: Knocking out the shRNA sequence in no. 18 and no. 30 cells did not influence HCV replication or miRNA expression. (a) Schematic depiction of the lentiviral shRNA vector used in this study. (b) The shRNA sequence was knocked out by CRISPR in no. 18 and no. 30 cells. Two guide RNAs were designed to target upstream (highlighted in yellow) and downstream (highlighted in green) of the shRNA. The protospacer-adjacent motif (PAM) sequence is also indicated. The no. 18-2 and 18-5 clones were isolated from no. 18 cells, and the no. 30-3 and 30-5 clones were isolated from no. 30 cells. Knockout was confirmed by sequencing. (c and d) The indicated cell clones, Huh7.5-1 cells, no. 18 cells, and no. 30 cells were infected with HCV and lentiviruses expressing eGFP simultaneously at an MOI of 2. The protein levels of HCV core and eGFP were measured by Western blotting 48 h after infection. Actin was used as a loading control. (e) Cells were treated as for panels c and d, and the intracellular HCV RNA levels were measured by real-time PCR 48 h after infection. (f and g) The expression levels of miR-216a-5p and miR-217 were examined by real-time PCR in no. 18-2, no. 18-5, no. 30-3, and no. 30-5 clones compared with Huh7.5-1 cells. (h) Sequences of the eGFP shRNA used in this study and the corresponding region of the lentiviral vector that integrated into no. 18 cells. (i) Huh7.5-1 cells were stably transduced with an empty lentiviral vector without the shRNA or the U6-shRNA cassette, or the eGFP shRNA vector at an MOI of 2, after which the pools were infected with HCV at an MOI of 2. The protein level of the HCV core was measured by Western blotting 48 h after HCV infection. (j) Cells were treated as for panel a, and the intracellular HCV RNA was measured by real-time PCR 48 h after HCV infection. (k) Expression levels of miR-216b-5p and miR-217 were measured by real-time PCR in the indicated stably transduced cells. Untreated Huh7.5-1 cells were used as controls. Values are presented as means and SD ( n = 3). *, P

    Article Snippet: HCV RNA was in vitro transcribed from the plasmid pJFH1 ( ) using a Mega-script kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

    Techniques: shRNA, Sequencing, Expressing, Plasmid Preparation, CRISPR, Clone Assay, Isolation, Knock-Out, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Transduction

    Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P

    Journal: Journal of Virology

    Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

    doi: 10.1128/JVI.00503-18

    Figure Lengend Snippet: Potential functions of differentially expressed miRNAs in HCV infection. (a) Huh7.5-1 cells were transfected with 50 nM mimics of the indicated miRNAs, followed by HCV infection at 24 h after transfection. The mix included a mixture of the mimics of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (b) Huh7.5-1 cells were treated as for panel a, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (c) No. 18 cells were transfected with 50 nM inhibitors of the indicated miRNAs, followed by HCV infection 24 h after transfection. The mix contained a mixture of the inhibitors of miR-216a-5p, miR-216b-5p, miR-217, and miR-30b-5p (12.5 nM each). Intracellular HCV RNA was examined by real-time PCR 48 h after infection. (d) No. 18 cells were treated as for panel c, and the protein levels of HCV NS5A and HCV core were assayed by Western blotting 48 h after HCV infection. (e) Huh7.5 cells harboring a JFH1 subgenomic replicon (Huh7.5-SGR) that expressed Renilla luciferase were transfected with mimics of the indicated miRNAs as for panel a. Luciferase activity was examined 48 h after transfection. (f) Huh7.5-SGR cells were transfected with inhibitors of the indicated miRNAs as for panel c. Luciferase activity was examined 48 h after transfection. Values are presented as means and SD ( n = 3). *, P

    Article Snippet: HCV RNA was in vitro transcribed from the plasmid pJFH1 ( ) using a Mega-script kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

    Techniques: Infection, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Activity Assay

    Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P

    Journal: Journal of Virology

    Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

    doi: 10.1128/JVI.00503-18

    Figure Lengend Snippet: Stable, but not transient, transduction with lentiviral shRNA vectors decreased HCV protein and RNA. (a) Huh7.5 cells were infected with HCV at an MOI of 2. The protein levels of CHMP4B and HCV core were analyzed by Western blotting 48 h after infection. (b) Huh7.5 cells were transiently transduced with different doses of the lentiviral CHMP4B shRNA or a nontarget control, followed by infection with HCV at an MOI of 2 24 h after transduction. The protein levels of CHMP4B, HCV NS5A, and HCV core were assayed 48 h after HCV infection. Actin was used as a loading control. (c) Huh7.5 cells were treated as for panel b. The level of intracellular HCV RNA was assayed by real-time PCR 48 h after infection. (d) Huh7.5 cells were treated as for panel b. The level of cellular miR-122-5p was analyzed by real-time PCR 48 h after infection. (e) Huh7.5 cells were stably transduced with the nontarget control shRNA or the CHMP4B shRNA at an MOI of 2. The pool of stably transduced Huh7.5 cells with the nontarget control (CON) and two clones (S5 and S8) derived from stably CHMP4B-shRNA-transduced Huh7.5 cells were infected with HCV at an MOI of 2. Untreated and puromycin resistance gene plasmid-transfected Huh7.5 cells (Huh7.5-puro) were used as controls. The protein levels of CHMP4B, HCV core, and NS5A were assayed 48 h after infection. Actin was used as a loading control. (f) Cells were treated as for panel e, and the intracellular HCV RNA was assayed by real-time PCR 48 h after infection. Values are presented as means and SD ( n = 3). *, P

    Article Snippet: HCV RNA was in vitro transcribed from the plasmid pJFH1 ( ) using a Mega-script kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

    Techniques: Transduction, shRNA, Infection, Western Blot, Real-time Polymerase Chain Reaction, Stable Transfection, Clone Assay, Derivative Assay, Plasmid Preparation, Transfection

    miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P

    Journal: Journal of Virology

    Article Title: Transduction with Lentiviral Vectors Altered the Expression Profile of Host MicroRNAs

    doi: 10.1128/JVI.00503-18

    Figure Lengend Snippet: miR-216a-5p and miR-216b-5p interfered with host autophagy to inhibit HCV infection. (a) eGFP, Beclin-1, or Atg5 was overexpressed in Huh7.5-1, no. 18, and no. 30 cells, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (b) Huh7.5-1, no. 18, and no. 30 cells were treated as for panel a, and the intracellular HCV RNA was quantified by real-time PCR 48 h after HCV infection. (c) Huh7.5-1 cells were transfected with 50 nM mimics of miR-216a-5p or miR-216b-5p, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (d) Huh7.5-1 cells were transfected with 50 nM siRNAs for Beclin-1 or Atg5, followed by HCV infection 24 h after transfection. The expression levels of the indicated proteins were measured by Western blotting 48 h after HCV infection. (e) Huh7.5-1 cells were treated as for panels c and d, and the intracellular HCV RNA in transfected cells was determined by real-time PCR 48 h after HCV infection. Values are presented as means and SD ( n = 3). *, P

    Article Snippet: HCV RNA was in vitro transcribed from the plasmid pJFH1 ( ) using a Mega-script kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

    Techniques: Infection, Transfection, Expressing, Western Blot, Real-time Polymerase Chain Reaction