Structured Review

New England Biolabs gtp
Gtp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gtp/product/New England Biolabs
Average 97 stars, based on 35 article reviews
Price from $9.99 to $1999.99
gtp - by Bioz Stars, 2019-10
97/100 stars

Images

Related Articles

Clone Assay:

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: The amplified DNA was gel-purified, cloned into the pCR2.1 TOPO vector (Life Technologies), and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Amplification:

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A 1.7Kb fragment, containing the YPT1 coding sequence and its 5′ and 3′ UTR, was amplified from yeast genomic DNA using two primers (YPT1XHOI and YPT1SACI) and inserted into the XhoI and SacI sites of pRS315 ( CEN LEU2 ). .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs).

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: The amplified DNA was gel-purified, cloned into the pCR2.1 TOPO vector (Life Technologies), and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Positive Control:

Article Title: Dynamic link of DNA demethylation, DNA strand breaks and repair in mouse zygotes
Article Snippet: For positive control, some of the zygotes were treated with DNAseI (Promega, 0.5 μ/100 μl) for 10 min at RT. .. Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT.

Synthesized:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: The template DNA was designed ( ) and synthesized using AAV-pgk-Cre, a kind gift from Patrick Aebischer (Addgene plasmid # 24593). .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: Dynamic link of DNA demethylation, DNA strand breaks and repair in mouse zygotes
Article Snippet: Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT. .. Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT.

Construct:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: The syn-mRNA-Cre construct ( ) was synthesized in vitro using the T7 mScript Standard mRNA Production System (CELLSCRIPT, Madison, WI) and 2 μg of purified DNA template. .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: This construct can rescue a ypt1 Δ mutant. .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs).

Article Title: Pseudouridines in and near the branch site recognition region of U2 snRNA are required for snRNP biogenesis and pre-mRNA splicing in Xenopus oocytes
Article Snippet: The transcription reaction mixture contained 1.4 mM each of ATP, CTP, UTP, and GpppG; and 0.28 mM GTP (all from New England BioLabs), 40 mM Tris-HCl (pH 7.5), 6 mM MgCl2 , 2 mM spermidine, 5 mM dithiothreitol (DTT), 0.1 mM/mL SmaIlinearized T7-U2 plasmid (containing one extra G at the 5′-end for better transcription, and three Cs at the 3′-end resulting from SmaI cleavage), and 4 U/μL T7 RNA polymerase. .. The transcription reaction mixture contained 1.4 mM each of ATP, CTP, UTP, and GpppG; and 0.28 mM GTP (all from New England BioLabs), 40 mM Tris-HCl (pH 7.5), 6 mM MgCl2 , 2 mM spermidine, 5 mM dithiothreitol (DTT), 0.1 mM/mL SmaIlinearized T7-U2 plasmid (containing one extra G at the 5′-end for better transcription, and three Cs at the 3′-end resulting from SmaI cleavage), and 4 U/μL T7 RNA polymerase.

Article Title: Mapping the Rubella Virus Subgenomic Promoter
Article Snippet: Robo402, dsRobo402/GFP, NRobo402, NRUBrep, and mutagenized constructs from these plasmids were linearized with Eco RI followed by phenol-chloroform extraction and ethanol precipitation. .. For synthesis of 5′-capped RNA transcripts, 1 μg of linearized plasmid was transcribed at 37°C in a 25-μl reaction mixture containing reaction buffer (40 mM Tris-HCl [pH 7.5], 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol); 1 mM each ATP, GTP, CTP, and UTP; 2 mM cap analog [m7 G(5′)ppp(5′)G] (New England BioLabs); 1 U of RNasin (Roche Molecular Biochemicals)/μl; and 25 U of SP6 DNA-dependent RNA polymerase (Epicentre, Madison, Wis.)/μl.

Electrophoresis:

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. RNA products were isolated by phenol–chloroform extraction and dissolved in nuclease-free water (20 μl).

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. RNA products were isolated by phenol-chloroform extraction and dissolved in nuclease-free water (20 μL).

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used. .. For 3′SL RNA, templates were generated via PCR using primer pairs S_EcoRI-T7-3′CS-3′SL (5′AAGCTTGATATCGAATTCTAATACGACTCACTATAGACCCCCCCGAAACAAAAAACAGC3′) and P_A-3′end (5′AGAACCTGTTGATTCAACAGCACC3′).

Incubation:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared. .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)]. .. In vitro translation reactions were programmed with purified mRNA transcripts encoding Tim23 variants.

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units. .. Reactions were carried out in a 100 μl total volume containing 70 μl RRL, 10 mM creatine phosphate, 50 μg/ml creatine phosphokinase, 50 μg/ml calf liver tRNA, 79 mM potassium acetate, 0.5 mM magnesium acetate, 0.02 mM hemin, and a complete mix of amino acids (minus Met mixed with minus Leu) at a concentration of 1 mM.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: Transcription was terminated by the addition of 2-3U of RNase-free DNase (Promega) per μg of plasmid DNA and incubation for 30 min at 37°C, followed by acidic phenol-chloroform extraction and isopropanol precipitation. .. WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used.

Article Title: Dynamic link of DNA demethylation, DNA strand breaks and repair in mouse zygotes
Article Snippet: For positive control, some of the zygotes were treated with DNAseI (Promega, 0.5 μ/100 μl) for 10 min at RT. .. Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT. .. Adjacent click-iT labelling and IF was done as described.

Article Title: Nucleotide and partner-protein control of bacterial replicative helicase structure and function
Article Snippet: All reactions were carried out in 30 μl volumecontaining 0.2mM each of ATP, UTP, GTP and CTP, 3.3 nM ssM13 DNA (New EnglandBiolabs) ,and 500nM DnaG. .. All reactions were carried out in 30 μl volumecontaining 0.2mM each of ATP, UTP, GTP and CTP, 3.3 nM ssM13 DNA (New EnglandBiolabs) ,and 500nM DnaG.

Modification:

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: To generate modified mRNA encoding GFP, TERT, and catalytically inactive (CI) TERT, their respective open reading frames (ORFs) were inserted into the MCS of a starting plasmid containing the T7 promoter, the 5′-UTR of human β -globin (HBB), the MCS, the 3′-UTR of HBB, a 151 bp poly-A sequence, and a restriction site for linearization with a type IIS restriction enzyme following the poly-A sequence. .. The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Labeling of MV was achieved using either PKH26 or PKH67 (Sigma-Aldrich), as per manufacturer protocol with minor modification. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Article Title: Dynamic link of DNA demethylation, DNA strand breaks and repair in mouse zygotes
Article Snippet: Paragraph title: Modified nick translation assay ... Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT.

Transformation Assay:

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs). .. The cells were plated on minimal media, and then selected on 5-FOA (5-fluoroorotic acid) plates to counter select against the balancing plasmid.

Transfection:

Article Title: Mapping the Rubella Virus Subgenomic Promoter
Article Snippet: For synthesis of 5′-capped RNA transcripts, 1 μg of linearized plasmid was transcribed at 37°C in a 25-μl reaction mixture containing reaction buffer (40 mM Tris-HCl [pH 7.5], 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol); 1 mM each ATP, GTP, CTP, and UTP; 2 mM cap analog [m7 G(5′)ppp(5′)G] (New England BioLabs); 1 U of RNasin (Roche Molecular Biochemicals)/μl; and 25 U of SP6 DNA-dependent RNA polymerase (Epicentre, Madison, Wis.)/μl. .. Typical yields were 6 to 7 μg of RNA in a 25-μl reaction mixture containing 1 μg of linearized plasmid.

Nick Translation:

Article Title: Dynamic link of DNA demethylation, DNA strand breaks and repair in mouse zygotes
Article Snippet: For positive control, some of the zygotes were treated with DNAseI (Promega, 0.5 μ/100 μl) for 10 min at RT. .. Afterwards, the zygotes were incubated in nick translation mix containing 5-ethynyl-2′-deoxycytidine-triphosphate (EdCTP), TTP, GTP, ATP, NEB2 buffer, BSA and DNA polymerase I (New England Biolabs) for 2 h at RT. .. Adjacent click-iT labelling and IF was done as described.

Introduce:

Article Title: Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs
Article Snippet: The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs). .. Similarly, mRNA from plasmid pBF-cRc was obtained by in vitro transcription of the MfeI-linearized plasmid using the MEGAscript SP6 kit (Ambion, Life Technologies, Carlsbad, CA) according to the instructions of the manufacturer, in the presence of a cap analog.

Generated:

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A template for PCR mutagenesis was generated by PCR using primers YPT1MF and YPT1MR. .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs).

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8. .. The wild-type human TERT ORF used to generate the DNA templates for mRNA synthesis is identical to the NCBI human TERT transcript variant 1 (reference sequence ).

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: Substrate mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl. .. The RNAs were separated by electrophoresis in a denaturing (8 M urea) 10% polyacrylamide gel, and the appropriate RNA species were excised from the gel with a sterile razor blade after autoradiographic exposure.

Article Title: Interplay between Y-box-binding protein 1 (YB-1) and poly(A) binding protein (PABP) in specific regulation of YB-1 mRNA translation
Article Snippet: Templates for in vitro synthesis of the YB-1 mRNA fragments (nt 1,070–1,240) containing the WT regulatory element or mutated regulatory elements were generated by PCR using pBluescript II SK YB-1 WT, pBluescript II SK YB-1 ΔPABP, pBluescript II SK YB-1 mutYB-1, pBluescript II SK YB-1 ΔRE or pBluescript II SK YB-1 SPS as a template. .. Capped mRNA transcripts were obtained by a reaction where a mixture of 0.2 mM GTP and 1 mM 3′-0-Me-m7 G5′ppp(5′) G (NEB, #S1411L) was used instead of 5 mM GTP.

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: Transcription was terminated by the addition of 2-3U of RNase-free DNase (Promega) per μg of plasmid DNA and incubation for 30 min at 37°C, followed by acidic phenol-chloroform extraction and isopropanol precipitation. .. WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used. .. Different DNA templates were derived by PCR based on the corresponding plasmid, using primer pair S_T7-50_MluI (5′CATGCGCACCCGTGGCCAGG3′) and A-Cap-Seq-WT (5′CTCTTCAATATCCCTGCTGTTGGTGGG3′) for templates harboring a WT sequence between nucleotide positions 280-300 or A-Cap-Seq-SYN (5′ CGTTTGAGGATGCCGGCGGTGGGGGG3′) for templates containing the SYN sequence.

DNA Sequencing:

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: Substrate mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Sequencing:

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: Each contained a T7 promoter universal sequence (5′-TAATACGACTCACTATAGGG-3′) at its 5′ end. .. To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration).

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: The SP6-based pSP65 plasmid library of Tim23 monocysteine variants has been described previously ( , ). mRNA was transcribed from PCR-generated fragments using 5′ and 3′ oligonucleotides complementary to the plasmid SP6 promoter and Tim23 sequence downstream of the stop codon, respectively. .. Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)].

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A 1.7Kb fragment, containing the YPT1 coding sequence and its 5′ and 3′ UTR, was amplified from yeast genomic DNA using two primers (YPT1XHOI and YPT1SACI) and inserted into the XhoI and SacI sites of pRS315 ( CEN LEU2 ). .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs).

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: To generate modified mRNA encoding GFP, TERT, and catalytically inactive (CI) TERT, their respective open reading frames (ORFs) were inserted into the MCS of a starting plasmid containing the T7 promoter, the 5′-UTR of human β -globin (HBB), the MCS, the 3′-UTR of HBB, a 151 bp poly-A sequence, and a restriction site for linearization with a type IIS restriction enzyme following the poly-A sequence. .. The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: The RNA substrate generated by EcoRI digestion and T7 RNA polymerase transcription includes two 5′-terminal G residues (to facilitate in vitro transcription) followed by: 53 nts of CRISPR leader sequence; the 36-nt CRISPR repeat 1; the 35-nt spacer 1; the 36-nt repeat 2; 29 nts of spacer 2; and 11 nts of plasmid-derived sequence (203 nts total). .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Fluorescence:

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)]. .. In vitro translation reactions were programmed with purified mRNA transcripts encoding Tim23 variants.

Article Title: Nucleotide and partner-protein control of bacterial replicative helicase structure and function
Article Snippet: All reactions were carried out in 30 μl volumecontaining 0.2mM each of ATP, UTP, GTP and CTP, 3.3 nM ssM13 DNA (New EnglandBiolabs) ,and 500nM DnaG. .. All reactions were carried out in 30 μl volumecontaining 0.2mM each of ATP, UTP, GTP and CTP, 3.3 nM ssM13 DNA (New EnglandBiolabs) ,and 500nM DnaG.

Magnetic Beads:

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units. .. Reactions were carried out in a 100 μl total volume containing 70 μl RRL, 10 mM creatine phosphate, 50 μg/ml creatine phosphokinase, 50 μg/ml calf liver tRNA, 79 mM potassium acetate, 0.5 mM magnesium acetate, 0.02 mM hemin, and a complete mix of amino acids (minus Met mixed with minus Leu) at a concentration of 1 mM.

Mutagenesis:

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A template for PCR mutagenesis was generated by PCR using primers YPT1MF and YPT1MR. .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs). .. The haploid strain containing the balancing plasmid was transformed with 100 ng of the gapped YPT1 plasmid and the PCR product.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: Substrate mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Regulation of Tacaribe Mammarenavirus Translation: Positive 5′ and Negative 3′ Elements and Role of Key Cellular Factors
Article Snippet: Unless otherwise indicated, pRLUC, p5′wt/3′wt_1, p5′wt/3′wt_2, and the rest of p5′wt/3′wt_2-derived mutant plasmids were digested with SmaI. .. In vitro transcription was performed in a 20-μl reaction volume using 200 ng of purified linearized DNA, 0.4 mM GTP, 1 mM (each) ATP, CTP, and UTP, 1 mM cap analog [m7G(5′)ppp(5′)G; New England BioLabs Inc.], and T7 enzyme mix (MEGAScript T7 kit; Ambion).

Isolation:

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. Mixtures were incubated at 37 °C for 8–12 h. To remove DNA template, Turbo DNase was added (2 U per reaction mixture; Life Technologies), and mixtures were further incubated (37 °C, 15–20 min).

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA).

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Paragraph title: Microvesicle isolation ... Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Flow Cytometry:

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Labeling:

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: Substrate mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl. .. The RNAs were separated by electrophoresis in a denaturing (8 M urea) 10% polyacrylamide gel, and the appropriate RNA species were excised from the gel with a sterile razor blade after autoradiographic exposure.

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Labeling of MV was achieved using either PKH26 or PKH67 (Sigma-Aldrich), as per manufacturer protocol with minor modification. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Purification:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: The syn-mRNA-Cre construct ( ) was synthesized in vitro using the T7 mScript Standard mRNA Production System (CELLSCRIPT, Madison, WI) and 2 μg of purified DNA template. .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: eIF4A alleviates the translational repression mediated by classical secondary structures more than by G-quadruplexes
Article Snippet: This kit uses the anti-reverse cap analogue (ARCA) to ensure the cap is in the correct orientation. mRNA was purified using the MEGAclear kit (ThermoFisher AM1908) and quantified by nanodrop. .. For , 7.5 mM ATP/CTP/UTP, 1.5 mM GTP and either 6 mM ARCA (NEB S1411S) or 6 mM G(5′)ppp(5′)A RNA Cap Structure Analog (NEB S1406S) was used whereas for Figure , 7.5 mM ATP/CTP/UTP, 6 mM ARCA (S1411S) and either 1.5 mM GTP or 1.5 mM 7-deazaguanine (TriLink N-1044) was used.

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: PCR product served as the T7 DNA template in the transcription reaction. .. To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. Mixtures were incubated at 37 °C for 8–12 h. To remove DNA template, Turbo DNase was added (2 U per reaction mixture; Life Technologies), and mixtures were further incubated (37 °C, 15–20 min).

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: The SP6-based pSP65 plasmid library of Tim23 monocysteine variants has been described previously ( , ). mRNA was transcribed from PCR-generated fragments using 5′ and 3′ oligonucleotides complementary to the plasmid SP6 promoter and Tim23 sequence downstream of the stop codon, respectively. .. Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)]. .. In vitro translation reactions were programmed with purified mRNA transcripts encoding Tim23 variants.

Article Title: Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs
Article Snippet: To obtain vFv and rotavirus gene 10 capped mRNAs, plasmids pGEM-vFv and pGEM-NSP4 ( ) were linearized with SacII (New England BioLabs, Ispwich, MA) and purified by phenol-chloroform extraction and ethanol precipitation. .. The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs).

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: In this study, a T7 RNA polymerase-dependent transcription reaction mixture (20 μL) was set up in a 1X transcription buffer (40 mM Tris, pH7.8, 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, 10 mM DTT; Life Technologies). .. The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. Turbo DNase was then added (2 U per reaction mixture, Life Technologies) to remove DNA template.

Article Title: Regulation of Tacaribe Mammarenavirus Translation: Positive 5′ and Negative 3′ Elements and Role of Key Cellular Factors
Article Snippet: Linearized plasmids were purified by phenol-chloroform extraction and ethanol precipitation. .. In vitro transcription was performed in a 20-μl reaction volume using 200 ng of purified linearized DNA, 0.4 mM GTP, 1 mM (each) ATP, CTP, and UTP, 1 mM cap analog [m7G(5′)ppp(5′)G; New England BioLabs Inc.], and T7 enzyme mix (MEGAScript T7 kit; Ambion). .. Then the DNA template was removed by treatment with RNase-free DNase (Ambion), the RNA product was purified through Sephadex G-50 columns (illustra MicroSpin, GE Healthcare), and its integrity was verified by electrophoresis on agarose gels.

Polymerase Chain Reaction:

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: PCR product served as the T7 DNA template in the transcription reaction. .. To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. Mixtures were incubated at 37 °C for 8–12 h. To remove DNA template, Turbo DNase was added (2 U per reaction mixture; Life Technologies), and mixtures were further incubated (37 °C, 15–20 min).

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: The SP6-based pSP65 plasmid library of Tim23 monocysteine variants has been described previously ( , ). mRNA was transcribed from PCR-generated fragments using 5′ and 3′ oligonucleotides complementary to the plasmid SP6 promoter and Tim23 sequence downstream of the stop codon, respectively. .. Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)]. .. In vitro translation reactions were programmed with purified mRNA transcripts encoding Tim23 variants.

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A template for PCR mutagenesis was generated by PCR using primers YPT1MF and YPT1MR. .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs). .. The haploid strain containing the balancing plasmid was transformed with 100 ng of the gapped YPT1 plasmid and the PCR product.

Article Title: Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs
Article Snippet: The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs). .. The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs).

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: In this study, a T7 RNA polymerase-dependent transcription reaction mixture (20 μL) was set up in a 1X transcription buffer (40 mM Tris, pH7.8, 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, 10 mM DTT; Life Technologies). .. The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. Turbo DNase was then added (2 U per reaction mixture, Life Technologies) to remove DNA template.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: For preparation of RNA substrates containing repeat 1, spacer 1, repeat 2, and truncated spacer 2 (see ), we generated a DNA template by PCR amplification from S. epidermidis RP62a CRISPR sequences using a forward primer containing a T7 promoter (5′-TAATACGACTCACTATAGGGACAGCAAAAATGATGCTTG-3′) and a reverse primer corresponding to a portion of the second spacer (5′-GTAACGTATGCAAATGACAATTA-3′). .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Interplay between Y-box-binding protein 1 (YB-1) and poly(A) binding protein (PABP) in specific regulation of YB-1 mRNA translation
Article Snippet: Templates for in vitro synthesis of the YB-1 mRNA fragments (nt 1,070–1,240) containing the WT regulatory element or mutated regulatory elements were generated by PCR using pBluescript II SK YB-1 WT, pBluescript II SK YB-1 ΔPABP, pBluescript II SK YB-1 mutYB-1, pBluescript II SK YB-1 ΔRE or pBluescript II SK YB-1 SPS as a template. .. Capped mRNA transcripts were obtained by a reaction where a mixture of 0.2 mM GTP and 1 mM 3′-0-Me-m7 G5′ppp(5′) G (NEB, #S1411L) was used instead of 5 mM GTP.

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used. .. Different DNA templates were derived by PCR based on the corresponding plasmid, using primer pair S_T7-50_MluI (5′CATGCGCACCCGTGGCCAGG3′) and A-Cap-Seq-WT (5′CTCTTCAATATCCCTGCTGTTGGTGGG3′) for templates harboring a WT sequence between nucleotide positions 280-300 or A-Cap-Seq-SYN (5′ CGTTTGAGGATGCCGGCGGTGGGGGG3′) for templates containing the SYN sequence.

CRISPR:

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: The RNA substrate generated by EcoRI digestion and T7 RNA polymerase transcription includes two 5′-terminal G residues (to facilitate in vitro transcription) followed by: 53 nts of CRISPR leader sequence; the 36-nt CRISPR repeat 1; the 35-nt spacer 1; the 36-nt repeat 2; 29 nts of spacer 2; and 11 nts of plasmid-derived sequence (203 nts total). .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Plasmid Preparation:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: The template DNA was designed ( ) and synthesized using AAV-pgk-Cre, a kind gift from Patrick Aebischer (Addgene plasmid # 24593). .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: The SP6-based pSP65 plasmid library of Tim23 monocysteine variants has been described previously ( , ). mRNA was transcribed from PCR-generated fragments using 5′ and 3′ oligonucleotides complementary to the plasmid SP6 promoter and Tim23 sequence downstream of the stop codon, respectively. .. Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)].

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: A gapped plasmid was created by digesting the plasmid with AvrII (cuts 200bp upstream of ATG) and SgrAI (cuts 20bp upstream of TGA) which released a 0.8Kb fragment. .. Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs).

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: To generate modified mRNA encoding GFP, TERT, and catalytically inactive (CI) TERT, their respective open reading frames (ORFs) were inserted into the MCS of a starting plasmid containing the T7 promoter, the 5′-UTR of human β -globin (HBB), the MCS, the 3′-UTR of HBB, a 151 bp poly-A sequence, and a restriction site for linearization with a type IIS restriction enzyme following the poly-A sequence. .. The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8.

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: Reporter plasmids were linearized using BglII or EcoRV in case of the plasmid coding for the AGA-codon. .. In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units.

Article Title: Pseudouridines in and near the branch site recognition region of U2 snRNA are required for snRNP biogenesis and pre-mRNA splicing in Xenopus oocytes
Article Snippet: T7 in vitro transcription was used to generate unmodified U2, or U2 snRNA fully substituted with 5-fluorouridines or pseudouridines. .. The transcription reaction mixture contained 1.4 mM each of ATP, CTP, UTP, and GpppG; and 0.28 mM GTP (all from New England BioLabs), 40 mM Tris-HCl (pH 7.5), 6 mM MgCl2 , 2 mM spermidine, 5 mM dithiothreitol (DTT), 0.1 mM/mL SmaIlinearized T7-U2 plasmid (containing one extra G at the 5′-end for better transcription, and three Cs at the 3′-end resulting from SmaI cleavage), and 4 U/μL T7 RNA polymerase. .. To create U2 RNA fully substituted with 5-fluorouridines or pseudouridines, 1.2 mM UTP was replaced by either 1.2 mM 5-fluorouridine triphosphate (Sierra Bioresearch) or 1.2 mM pseudouridine triphosphate (Sierra Bioresearch), respectively.

Article Title: Mapping the Rubella Virus Subgenomic Promoter
Article Snippet: Robo402, dsRobo402/GFP, NRobo402, NRUBrep, and mutagenized constructs from these plasmids were linearized with Eco RI followed by phenol-chloroform extraction and ethanol precipitation. .. For synthesis of 5′-capped RNA transcripts, 1 μg of linearized plasmid was transcribed at 37°C in a 25-μl reaction mixture containing reaction buffer (40 mM Tris-HCl [pH 7.5], 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol); 1 mM each ATP, GTP, CTP, and UTP; 2 mM cap analog [m7 G(5′)ppp(5′)G] (New England BioLabs); 1 U of RNasin (Roche Molecular Biochemicals)/μl; and 25 U of SP6 DNA-dependent RNA polymerase (Epicentre, Madison, Wis.)/μl. .. The transcripts were analyzed by electrophoresis of aliquots of the reaction mixtures in 1% agarose gels in the presence of ethidium bromide.

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: The RNA substrate generated by EcoRI digestion and T7 RNA polymerase transcription includes two 5′-terminal G residues (to facilitate in vitro transcription) followed by: 53 nts of CRISPR leader sequence; the 36-nt CRISPR repeat 1; the 35-nt spacer 1; the 36-nt repeat 2; 29 nts of spacer 2; and 11 nts of plasmid-derived sequence (203 nts total). .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl.

Article Title: Regulation of Tacaribe Mammarenavirus Translation: Positive 5′ and Negative 3′ Elements and Role of Key Cellular Factors
Article Snippet: To obtain transcript 5′βGlo/3′ΔH , plasmid p5′βGlo/3′wt was linearized at the BsaAI restriction site. .. In vitro transcription was performed in a 20-μl reaction volume using 200 ng of purified linearized DNA, 0.4 mM GTP, 1 mM (each) ATP, CTP, and UTP, 1 mM cap analog [m7G(5′)ppp(5′)G; New England BioLabs Inc.], and T7 enzyme mix (MEGAScript T7 kit; Ambion).

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: Transcription was terminated by the addition of 2-3U of RNase-free DNase (Promega) per μg of plasmid DNA and incubation for 30 min at 37°C, followed by acidic phenol-chloroform extraction and isopropanol precipitation. .. WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used.

Agarose Gel Electrophoresis:

Article Title: eIF4A alleviates the translational repression mediated by classical secondary structures more than by G-quadruplexes
Article Snippet: Integrity of RNA was checked by inspection on a native agarose gel. mRNAs used in and Figure were transcribed using the TranscriptAid T7 High Yield Transcription Kit (ThermoFisher K0441) as per manufacturer's instructions. .. For , 7.5 mM ATP/CTP/UTP, 1.5 mM GTP and either 6 mM ARCA (NEB S1411S) or 6 mM G(5′)ppp(5′)A RNA Cap Structure Analog (NEB S1406S) was used whereas for Figure , 7.5 mM ATP/CTP/UTP, 6 mM ARCA (S1411S) and either 1.5 mM GTP or 1.5 mM 7-deazaguanine (TriLink N-1044) was used.

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. RNA products were isolated by phenol–chloroform extraction and dissolved in nuclease-free water (20 μl).

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8. .. The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8.

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. RNA products were isolated by phenol-chloroform extraction and dissolved in nuclease-free water (20 μL).

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

In Vitro:

Article Title: Synthetic mRNA is a more reliable tool for the delivery of DNA-targeting proteins into the cell nucleus than fusion with a protein transduction domain
Article Snippet: The syn-mRNA-Cre construct ( ) was synthesized in vitro using the T7 mScript Standard mRNA Production System (CELLSCRIPT, Madison, WI) and 2 μg of purified DNA template. .. A custom ribonucleotide blend comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate, 5-methylcytidine triphosphate (TriLink Biotechnologies, San Diego, CA), ATP, and GTP (New England Biolabs) was prepared.

Article Title: eIF4A alleviates the translational repression mediated by classical secondary structures more than by G-quadruplexes
Article Snippet: Paragraph title: In vitro transcription ... For , 7.5 mM ATP/CTP/UTP, 1.5 mM GTP and either 6 mM ARCA (NEB S1411S) or 6 mM G(5′)ppp(5′)A RNA Cap Structure Analog (NEB S1406S) was used whereas for Figure , 7.5 mM ATP/CTP/UTP, 6 mM ARCA (S1411S) and either 1.5 mM GTP or 1.5 mM 7-deazaguanine (TriLink N-1044) was used.

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: Paragraph title: In vitro production of viral RNA simulants via transcription by T7 RNA polymerase ... To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration).

Article Title: Cardiolipin mediates membrane and channel interactions of the mitochondrial TIM23 protein import complex receptor Tim50
Article Snippet: The SP6-based pSP65 plasmid library of Tim23 monocysteine variants has been described previously ( , ). mRNA was transcribed from PCR-generated fragments using 5′ and 3′ oligonucleotides complementary to the plasmid SP6 promoter and Tim23 sequence downstream of the stop codon, respectively. .. Purified PCR products were transcribed in vitro with SP6 polymerase at 37°C for 1.5 hours in reactions containing 100 mM Hepes-KOH (pH 7.5), 20 mM MgCl2 , 2.5 mM spermidine, 12 mM dithiothreitol (DTT), 4 mM ATP, 4 mM CTP (cytidine 5′-triphosphate), 4 mM UTP (uridine 5′-triphosphate), 0.4 mM GTP (guanosine 5′-triphosphate) G(5′)ppp(5′)G RNA cap analog (0.013 U/μl; New England Biolabs), RNasin (0.5 U/μl), and pyrophosphatase (6 U/nl); supplemented with 4 mM GTP; and allowed to incubate for an additional 30 min. mRNA was precipitated overnight at −20°C in ethanol and 90 mM sodium acetate (pH 5.2), washed in 70% (v/v) ethanol, and reconstituted in TE buffer [10 mM tris-HCl and 1 mM EDTA (pH 7.5)]. .. In vitro translation reactions were programmed with purified mRNA transcripts encoding Tim23 variants.

Article Title: Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs
Article Snippet: Paragraph title: In vitro RNA transcription. ... The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs).

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: Reporter plasmids were linearized using BglII or EcoRV in case of the plasmid coding for the AGA-codon. .. In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units. .. 400 ng of transcript was used for in vitro translation using rabbit reticulocyte lysate (RRL) treated with micrococcal nuclease (Promega, Fitchburg, WI #L4960).

Article Title: Genome Editing in Mouse Spermatogonial Stem/Progenitor Cells Using Engineered Nucleases
Article Snippet: For mRNA synthesis in vitro transcription, capping and tailing were performed similar to Warren et al. . .. T7 MEGAscript kit (Life Technologies, Grand Island, NY) was used with a reduced GTP concentration (1.5 mM) and 6 mM m7 G(5')ppp(5')G RNA Cap Structure Analog (New England Biolabs, Ipswich, MA) added to synthesize RNA.

Article Title: Pseudouridines in and near the branch site recognition region of U2 snRNA are required for snRNP biogenesis and pre-mRNA splicing in Xenopus oocytes
Article Snippet: T7 in vitro transcription was used to generate unmodified U2, or U2 snRNA fully substituted with 5-fluorouridines or pseudouridines. .. The transcription reaction mixture contained 1.4 mM each of ATP, CTP, UTP, and GpppG; and 0.28 mM GTP (all from New England BioLabs), 40 mM Tris-HCl (pH 7.5), 6 mM MgCl2 , 2 mM spermidine, 5 mM dithiothreitol (DTT), 0.1 mM/mL SmaIlinearized T7-U2 plasmid (containing one extra G at the 5′-end for better transcription, and three Cs at the 3′-end resulting from SmaI cleavage), and 4 U/μL T7 RNA polymerase.

Article Title: Mapping the Rubella Virus Subgenomic Promoter
Article Snippet: Paragraph title: In vitro transcription. ... For synthesis of 5′-capped RNA transcripts, 1 μg of linearized plasmid was transcribed at 37°C in a 25-μl reaction mixture containing reaction buffer (40 mM Tris-HCl [pH 7.5], 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol); 1 mM each ATP, GTP, CTP, and UTP; 2 mM cap analog [m7 G(5′)ppp(5′)G] (New England BioLabs); 1 U of RNasin (Roche Molecular Biochemicals)/μl; and 25 U of SP6 DNA-dependent RNA polymerase (Epicentre, Madison, Wis.)/μl.

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: Paragraph title: 2.3. In vitro production of viral RNA simulants via using transcription by T7 RNA polymerase ... The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA).

Article Title: Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis
Article Snippet: Substrate mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and confirmed by DNA sequencing. .. RNAs were generated by in vitro transcription using T7 RNA Polymerase (New England Biolabs) and uniformly labeled with 20 μCi [α-32 P] CTP (3,000 Ci/mmol; Perkin-Elmer), 500 μM ATP, 500 μM GTP and 500 μM UTP, 12 μM unlabeled CTP (New England Biolabs), 1x RNA polymerase buffer (New England Biolabs), and 20 U T7 RNA polymerase in a total volume of 20 μl. .. The RNAs were separated by electrophoresis in a denaturing (8 M urea) 10% polyacrylamide gel, and the appropriate RNA species were excised from the gel with a sterile razor blade after autoradiographic exposure.

Article Title: Interplay between Y-box-binding protein 1 (YB-1) and poly(A) binding protein (PABP) in specific regulation of YB-1 mRNA translation
Article Snippet: Paragraph title: In vitro transcription. ... Capped mRNA transcripts were obtained by a reaction where a mixture of 0.2 mM GTP and 1 mM 3′-0-Me-m7 G5′ppp(5′) G (NEB, #S1411L) was used instead of 5 mM GTP.

Article Title: Regulation of Tacaribe Mammarenavirus Translation: Positive 5′ and Negative 3′ Elements and Role of Key Cellular Factors
Article Snippet: Linearized plasmids were purified by phenol-chloroform extraction and ethanol precipitation. .. In vitro transcription was performed in a 20-μl reaction volume using 200 ng of purified linearized DNA, 0.4 mM GTP, 1 mM (each) ATP, CTP, and UTP, 1 mM cap analog [m7G(5′)ppp(5′)G; New England BioLabs Inc.], and T7 enzyme mix (MEGAScript T7 kit; Ambion). .. Then the DNA template was removed by treatment with RNase-free DNase (Ambion), the RNA product was purified through Sephadex G-50 columns (illustra MicroSpin, GE Healthcare), and its integrity was verified by electrophoresis on agarose gels.

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: Transcription was terminated by the addition of 2-3U of RNase-free DNase (Promega) per μg of plasmid DNA and incubation for 30 min at 37°C, followed by acidic phenol-chloroform extraction and isopropanol precipitation. .. WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used. .. Different DNA templates were derived by PCR based on the corresponding plasmid, using primer pair S_T7-50_MluI (5′CATGCGCACCCGTGGCCAGG3′) and A-Cap-Seq-WT (5′CTCTTCAATATCCCTGCTGTTGGTGGG3′) for templates harboring a WT sequence between nucleotide positions 280-300 or A-Cap-Seq-SYN (5′ CGTTTGAGGATGCCGGCGGTGGGGGG3′) for templates containing the SYN sequence.

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

Ethanol Precipitation:

Article Title: Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs
Article Snippet: To obtain vFv and rotavirus gene 10 capped mRNAs, plasmids pGEM-vFv and pGEM-NSP4 ( ) were linearized with SacII (New England BioLabs, Ispwich, MA) and purified by phenol-chloroform extraction and ethanol precipitation. .. The T7 polymerization mixture contained 1 μg of linearized DNA, 7.5 mM (each) ATP, CTP, and UTP, 1.5 mM GTP, and 6 mM cap analog (New England BioLabs).

Article Title: Mapping the Rubella Virus Subgenomic Promoter
Article Snippet: Robo402, dsRobo402/GFP, NRobo402, NRUBrep, and mutagenized constructs from these plasmids were linearized with Eco RI followed by phenol-chloroform extraction and ethanol precipitation. .. For synthesis of 5′-capped RNA transcripts, 1 μg of linearized plasmid was transcribed at 37°C in a 25-μl reaction mixture containing reaction buffer (40 mM Tris-HCl [pH 7.5], 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol); 1 mM each ATP, GTP, CTP, and UTP; 2 mM cap analog [m7 G(5′)ppp(5′)G] (New England BioLabs); 1 U of RNasin (Roche Molecular Biochemicals)/μl; and 25 U of SP6 DNA-dependent RNA polymerase (Epicentre, Madison, Wis.)/μl.

Article Title: Regulation of Tacaribe Mammarenavirus Translation: Positive 5′ and Negative 3′ Elements and Role of Key Cellular Factors
Article Snippet: Linearized plasmids were purified by phenol-chloroform extraction and ethanol precipitation. .. In vitro transcription was performed in a 20-μl reaction volume using 200 ng of purified linearized DNA, 0.4 mM GTP, 1 mM (each) ATP, CTP, and UTP, 1 mM cap analog [m7G(5′)ppp(5′)G; New England BioLabs Inc.], and T7 enzyme mix (MEGAScript T7 kit; Ambion).

Article Title: Composition of the Sequence Downstream of the Dengue Virus 5′ Cyclization Sequence (dCS) Affects Viral RNA Replication
Article Snippet: DENV replicon DNA templates were generated by ClaI digestion of the corresponding plasmid (for pDRrep, XbaI was used), followed by phenol-chloroform extraction and ethanol precipitation. .. WNV replicon RNAs were generated similarly as described above, with the exception that DNA templates were digested with XbaI, and in vitro transcription was performed using 3mM each ATP, CTP and UTP; 1mM GTP; and 6mM m7 G(5′)ppp(5′)G cap analog (New England Biolabs, Beverly, MA) with the addition of 2mM GTP after 30 min. RNAs corresponding to the 5′ or 3′ viral ends were generated as described above, with the exception that 3mM of each rNTP without m7 G(5′)ppp(5′)A cap analog was used.

Evaporation:

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: Reporter plasmids were linearized using BglII or EcoRV in case of the plasmid coding for the AGA-codon. .. In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units. .. 400 ng of transcript was used for in vitro translation using rabbit reticulocyte lysate (RRL) treated with micrococcal nuclease (Promega, Fitchburg, WI #L4960).

Concentration Assay:

Article Title: Detecting respiratory viral RNA using expanded genetic alphabets and self-avoiding DNA
Article Snippet: PCR product served as the T7 DNA template in the transcription reaction. .. To make simulants, a T7 RNA polymerase-dependent transcription reaction mixture (20 μl) was set up in a 1 × transcription buffer (40 mM Tris [pH 7.8], 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, and 10 mM dithiothreitol [DTT]; Life Technologies) that also contained ATP, CTP, GTP, and UTP (2 μl of 75-mM stock solutions; New England Biolabs [NEB], Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product), and T7 RNA polymerase (2 μl of 200 U/μl to give 20 U/μl final concentration). .. Mixtures were incubated at 37 °C for 8–12 h. To remove DNA template, Turbo DNase was added (2 U per reaction mixture; Life Technologies), and mixtures were further incubated (37 °C, 15–20 min).

Article Title: Inosine induces context-dependent recoding and translational stalling
Article Snippet: In vitro transcription was done with NEB HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions for capped RNA synthesis with the following modifications: synthesis was carried out for 16 h overnight in a 37°C incubator to prevent evaporation using 10 mM of ITP instead of GTP and 2 mM of m7 G cap analog (NEB #S1404S) followed by DNaseI digestion (Thermo Fisher Scientific, MA, Waltham, #EN0521) using 5 units. .. 400 ng of transcript was used for in vitro translation using rabbit reticulocyte lysate (RRL) treated with micrococcal nuclease (Promega, Fitchburg, WI #L4960).

Article Title: Genome Editing in Mouse Spermatogonial Stem/Progenitor Cells Using Engineered Nucleases
Article Snippet: First, GFP-ZFN2 and GFP-ZFN1, encoded on the SP202A and SP202B plasmids, were linearized with Xba I restriction enzyme; GFP-TALEN1 and GFP-TALEN2, encoded on M733L and M733R plasmids, were linearized with Afl II. .. T7 MEGAscript kit (Life Technologies, Grand Island, NY) was used with a reduced GTP concentration (1.5 mM) and 6 mM m7 G(5')ppp(5')G RNA Cap Structure Analog (New England Biolabs, Ipswich, MA) added to synthesize RNA. .. Then the Poly(A) Tailing and MEGAClear kits (Life Technologies, Grand Island, NY) were used according to the manufacturer's directions.

Article Title: High-throughput Multiplexed xMAP Luminex Array Panel for Detection of Twenty TWO Medically Important Mosquito-borne Arboviruses based on Innovations in Synthetic Biology
Article Snippet: In this study, a T7 RNA polymerase-dependent transcription reaction mixture (20 μL) was set up in a 1X transcription buffer (40 mM Tris, pH7.8, 20 mM NaCl, 18 mM MgCl2 , 2 mM spermidine HCl, 10 mM DTT; Life Technologies). .. The reaction mixture contained ATP, CTP, GTP, and UTP (2 μL of 75 mM stock solutions, NEB, Ipswich, MA, USA), DNA template (2.5–5 pmol, purified and concentrated PCR product); T7 RNA polymerase (2 μL of a 200 U/μL to give 20 U/μL final concentration, Austin, TX, USA). .. Turbo DNase was then added (2 U per reaction mixture, Life Technologies) to remove DNA template.

Article Title: Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway
Article Snippet: Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol. .. Total RNA from microvesicles was extracted using Trizol (Thermofisher) and capped with desthiobiotin-GTP (NEB) using vaccinia virus mRNA capping enzyme (NEB) as per manufacturer’s protocol.

CTG Assay:

Article Title: Interplay between Y-box-binding protein 1 (YB-1) and poly(A) binding protein (PABP) in specific regulation of YB-1 mRNA translation
Article Snippet: The reverse primer was 5′-GCA GAT AGT TCT AGA AAT CTG GTC AAC GGG CA-3′. .. Capped mRNA transcripts were obtained by a reaction where a mixture of 0.2 mM GTP and 1 mM 3′-0-Me-m7 G5′ppp(5′) G (NEB, #S1411L) was used instead of 5 mM GTP.

Variant Assay:

Article Title: Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells
Article Snippet: The resulting intermediate plasmids were sequenced, linearized, and transcribed using the buffer and RNA polymerase from the MEGAscript T7 Kit (Ambion, Austin, TX, USA), and a custom mix of canonical and noncanonical nucleotides (TriLink BioTechnologies, San Diego, CA, USA) in which the final nucleotide concentrations per 40 µ l IVT reaction were 7.5 mM for each of ATP, 5-methylcytidine-5′-triphosphate (m5C), and pseudouridine-5′-triphosphate ( Ψ ), 1.5 mM for GTP, and 6 mM for the cap analog (ARCA) (New England Biolabs, Ipswitch, MA, USA), or a molar ratio of ATP:m5C: Ψ :GTP:ARCA of 1:1:1:0.2:0.8. .. The size and integrity of the mRNA products were verified using denaturing agarose gel electrophoresis ( ).

Homologous Recombination:

Article Title: Establishing a Role for the GTPase Ypt1p at the Late Golgi
Article Snippet: Random PCR mutagenesis was performed with the same primers and the following conditions: 7mM MgCl2 , 50mM KCl, 0.5mM MnCl2 , 10mM Tris pH 8.3, 0.1% Triton-X-100, dNTPs 1mM TTP, 1mM CTP, 200μM ATP, 200μM GTP, and 2.5units of Taq polymerase (New England Biolabs). .. The haploid strain containing the balancing plasmid was transformed with 100 ng of the gapped YPT1 plasmid and the PCR product.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs α 32 p gtp
    Purification and characterization of FluPol C a , Elution profile of FluPol C , after affinity purification over IgG-sepharose, from a size-exclusion chromatography column. Eluted protein was detected by measuring the absorbance at 280 nm. b , Fractions corresponding to the major peak eluting from the size-exclusion chromatography column were mixed and analysed by SDS–PAGE on a 15% polyacrylamide gel, alongside the indicated molecular mass markers. Protein was visualized by Coomassie blue staining (PB1, 86.0 kDa; PB2, 87.2 kDa; P3, 81.9 kDa). c , Transcription and replication initiation assays. Lanes 2–6 test for transcription initiation. With the addition of vRNA promoter only (lanes 4 and 5), FluPol C can cleave a capped and radiolabelled 20-nucleotide RNA, demonstrating promoter-dependent endonuclease activity. Lane 6 shows that with the addition of NTPs, this capped primer can be extended to produce a capped transcript, thus demonstrating transcription initiation activity. This result is confirmed by lanes 7–9, which test for extension of a capped and radiolabelled 11-nucleotide RNA primer. Extension only takes place when the polymerase is supplied with NTPs and promoter RNA (lane 9). Lanes 10–12 assay for replication initiation. Lane 12 shows that FluPol C (400 ng per reaction) is able to synthesize ApG dinucleotide in a primer-independent manner. This demonstrates de novo . d , De novo initiation and elongation assay. FluPol C (800 ng) was incubated for 3 h with NTPs, [α- 32 <t>P]GTP</t> and 5′ or 3′ vRNA promoter strands, as indicated. In the presence of both promoter strands (lane 4), FluPol C is able to produce a full-length copy of the template (14 nucleotides, corresponding to the major band), demonstrating de novo replication initiation and elongation activity. The minor slower and faster bands may correspond to non-templated extension and premature termination products, respectively.
    α 32 P Gtp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p gtp/product/New England Biolabs
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    α 32 p gtp - by Bioz Stars, 2019-10
    93/100 stars
      Buy from Supplier

    80
    New England Biolabs ranq69l gtp
    Exp5 binding to pre-miR-30 mutants with different stem lengths. Gel-shift assays were performed as described in Materials and Methods. Lane 1, 32 P-labeled WT pre-miR-30 probe in the absence of <t>Exp5/RanQ69L-GTP;</t> lanes 2–17, with Exp5/RanQ69L-GTP; lanes 3–17, 10 or 40 ng of the indicated unlabeled RNAs were used as competitors. Binding efficiencies (%) were calculated as the intensities of the shifted bands, quantified by a PhosphorImager, divided by that of the shifted band in lane 2 (without competitors). The sequences and predicted secondary structures of the WT and mutant pre-miR-30 RNAs are presented below the autoradiograph. Since SP6 RNA polymerase starts transcription with a ‘G’, the corresponding position in pre-miR-30 was changed from ‘U’ to ‘G’, and its base pairing nucleotide was changed from ‘A’ to ‘C’. These changes are indicated by a box. The 2 nt 3′ overhang was also changed to ‘UU’. These changes did not affect Exp5 binding (data not shown).
    Ranq69l Gtp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 80/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ranq69l gtp/product/New England Biolabs
    Average 80 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ranq69l gtp - by Bioz Stars, 2019-10
    80/100 stars
      Buy from Supplier

    Image Search Results


    Purification and characterization of FluPol C a , Elution profile of FluPol C , after affinity purification over IgG-sepharose, from a size-exclusion chromatography column. Eluted protein was detected by measuring the absorbance at 280 nm. b , Fractions corresponding to the major peak eluting from the size-exclusion chromatography column were mixed and analysed by SDS–PAGE on a 15% polyacrylamide gel, alongside the indicated molecular mass markers. Protein was visualized by Coomassie blue staining (PB1, 86.0 kDa; PB2, 87.2 kDa; P3, 81.9 kDa). c , Transcription and replication initiation assays. Lanes 2–6 test for transcription initiation. With the addition of vRNA promoter only (lanes 4 and 5), FluPol C can cleave a capped and radiolabelled 20-nucleotide RNA, demonstrating promoter-dependent endonuclease activity. Lane 6 shows that with the addition of NTPs, this capped primer can be extended to produce a capped transcript, thus demonstrating transcription initiation activity. This result is confirmed by lanes 7–9, which test for extension of a capped and radiolabelled 11-nucleotide RNA primer. Extension only takes place when the polymerase is supplied with NTPs and promoter RNA (lane 9). Lanes 10–12 assay for replication initiation. Lane 12 shows that FluPol C (400 ng per reaction) is able to synthesize ApG dinucleotide in a primer-independent manner. This demonstrates de novo . d , De novo initiation and elongation assay. FluPol C (800 ng) was incubated for 3 h with NTPs, [α- 32 P]GTP and 5′ or 3′ vRNA promoter strands, as indicated. In the presence of both promoter strands (lane 4), FluPol C is able to produce a full-length copy of the template (14 nucleotides, corresponding to the major band), demonstrating de novo replication initiation and elongation activity. The minor slower and faster bands may correspond to non-templated extension and premature termination products, respectively.

    Journal:

    Article Title: Crystal structure of the RNA-dependent RNA polymerase from influenza C virus

    doi: 10.1038/nature15525

    Figure Lengend Snippet: Purification and characterization of FluPol C a , Elution profile of FluPol C , after affinity purification over IgG-sepharose, from a size-exclusion chromatography column. Eluted protein was detected by measuring the absorbance at 280 nm. b , Fractions corresponding to the major peak eluting from the size-exclusion chromatography column were mixed and analysed by SDS–PAGE on a 15% polyacrylamide gel, alongside the indicated molecular mass markers. Protein was visualized by Coomassie blue staining (PB1, 86.0 kDa; PB2, 87.2 kDa; P3, 81.9 kDa). c , Transcription and replication initiation assays. Lanes 2–6 test for transcription initiation. With the addition of vRNA promoter only (lanes 4 and 5), FluPol C can cleave a capped and radiolabelled 20-nucleotide RNA, demonstrating promoter-dependent endonuclease activity. Lane 6 shows that with the addition of NTPs, this capped primer can be extended to produce a capped transcript, thus demonstrating transcription initiation activity. This result is confirmed by lanes 7–9, which test for extension of a capped and radiolabelled 11-nucleotide RNA primer. Extension only takes place when the polymerase is supplied with NTPs and promoter RNA (lane 9). Lanes 10–12 assay for replication initiation. Lane 12 shows that FluPol C (400 ng per reaction) is able to synthesize ApG dinucleotide in a primer-independent manner. This demonstrates de novo . d , De novo initiation and elongation assay. FluPol C (800 ng) was incubated for 3 h with NTPs, [α- 32 P]GTP and 5′ or 3′ vRNA promoter strands, as indicated. In the presence of both promoter strands (lane 4), FluPol C is able to produce a full-length copy of the template (14 nucleotides, corresponding to the major band), demonstrating de novo replication initiation and elongation activity. The minor slower and faster bands may correspond to non-templated extension and premature termination products, respectively.

    Article Snippet: Capped and radiolabelled RNA was produced by incubating 5′ diphosphate synthetic 20-nucleotide (5′-ppAAUCUAUAAUAGCAUUAUCC-3′) , or 11-nucleotide (5′-ppGAAUACUCAAG-3′) , RNA (Chemgenes), with [α-32 P]GTP, vaccinia virus capping enzyme (NEB) and 2′- O -methyltransferase (NEB), following the manufacturer’s instructions.

    Techniques: Purification, Affinity Purification, Size-exclusion Chromatography, SDS Page, Staining, Activity Assay, Incubation

    Exp5 binding to pre-miR-30 mutants with different stem lengths. Gel-shift assays were performed as described in Materials and Methods. Lane 1, 32 P-labeled WT pre-miR-30 probe in the absence of Exp5/RanQ69L-GTP; lanes 2–17, with Exp5/RanQ69L-GTP; lanes 3–17, 10 or 40 ng of the indicated unlabeled RNAs were used as competitors. Binding efficiencies (%) were calculated as the intensities of the shifted bands, quantified by a PhosphorImager, divided by that of the shifted band in lane 2 (without competitors). The sequences and predicted secondary structures of the WT and mutant pre-miR-30 RNAs are presented below the autoradiograph. Since SP6 RNA polymerase starts transcription with a ‘G’, the corresponding position in pre-miR-30 was changed from ‘U’ to ‘G’, and its base pairing nucleotide was changed from ‘A’ to ‘C’. These changes are indicated by a box. The 2 nt 3′ overhang was also changed to ‘UU’. These changes did not affect Exp5 binding (data not shown).

    Journal:

    Article Title: Structural requirements for pre-microRNA binding and nuclear export by Exportin 5

    doi: 10.1093/nar/gkh824

    Figure Lengend Snippet: Exp5 binding to pre-miR-30 mutants with different stem lengths. Gel-shift assays were performed as described in Materials and Methods. Lane 1, 32 P-labeled WT pre-miR-30 probe in the absence of Exp5/RanQ69L-GTP; lanes 2–17, with Exp5/RanQ69L-GTP; lanes 3–17, 10 or 40 ng of the indicated unlabeled RNAs were used as competitors. Binding efficiencies (%) were calculated as the intensities of the shifted bands, quantified by a PhosphorImager, divided by that of the shifted band in lane 2 (without competitors). The sequences and predicted secondary structures of the WT and mutant pre-miR-30 RNAs are presented below the autoradiograph. Since SP6 RNA polymerase starts transcription with a ‘G’, the corresponding position in pre-miR-30 was changed from ‘U’ to ‘G’, and its base pairing nucleotide was changed from ‘A’ to ‘C’. These changes are indicated by a box. The 2 nt 3′ overhang was also changed to ‘UU’. These changes did not affect Exp5 binding (data not shown).

    Article Snippet: Approximately 20 000 c.p.m. of 32 P-labeled RNA was incubated with 2.5 μg Exp5 and 5 μg of RanQ69L-GTP in 15 μl of 1× buffer (NEB buffer 4) at room temperature for 10 min. As a negative control for Exp5/RanQ69L, an equivalent quantity of BSA or RanQ69L-GTP alone was incubated with the RNA.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Mutagenesis, Autoradiography

    Exp5 binding to pre-miR-30 mutants with different terminal loops. Lane 1, WT pre-miR-30 probe in the absence of Exp5/RanQ69L-GTP; lanes 2–13, with Exp5/RanQ69L-GTP; lanes 3–13, 10 or 40 ng of the indicated unlabeled RNA competitors were added. Binding efficiencies (%) were calculated as the intensities of the shifted bands divided by that of the shifted band in lane 2. Sequences and predicted secondary structures of the loop deletion mutants are shown below the autoradiograph.

    Journal:

    Article Title: Structural requirements for pre-microRNA binding and nuclear export by Exportin 5

    doi: 10.1093/nar/gkh824

    Figure Lengend Snippet: Exp5 binding to pre-miR-30 mutants with different terminal loops. Lane 1, WT pre-miR-30 probe in the absence of Exp5/RanQ69L-GTP; lanes 2–13, with Exp5/RanQ69L-GTP; lanes 3–13, 10 or 40 ng of the indicated unlabeled RNA competitors were added. Binding efficiencies (%) were calculated as the intensities of the shifted bands divided by that of the shifted band in lane 2. Sequences and predicted secondary structures of the loop deletion mutants are shown below the autoradiograph.

    Article Snippet: Approximately 20 000 c.p.m. of 32 P-labeled RNA was incubated with 2.5 μg Exp5 and 5 μg of RanQ69L-GTP in 15 μl of 1× buffer (NEB buffer 4) at room temperature for 10 min. As a negative control for Exp5/RanQ69L, an equivalent quantity of BSA or RanQ69L-GTP alone was incubated with the RNA.

    Techniques: Binding Assay, Autoradiography