Structured Review

GE Healthcare gst
<t>STK25</t> interacts with GOLPH3 and regulates its expression. a , b Exogenous STK25 interacts with GOLPH3. Cells were transfected with the indicated plasmids. Co-IP was performed using FLAG antibody to pull down FLAG-STK25 ( a ) or anti-Myc against Myc-GOLPH3 ( b ). Then, STK25 and GOLPH3 were detected with the indicated antibodies. c , d His-STK25 interacts directly with <t>GST-GOLPH3</t> but not GST by in vitro GST pull-down and His-tag pull-down assays, respectively. e STK25 overexpression decreases GLOPH3 mRNA and protein levels in CRC cells. f STK25 knockdown increases GOLPH3 mRNA and protein levels in CRC cells
Gst, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gst/product/GE Healthcare
Average 99 stars, based on 25 article reviews
Price from $9.99 to $1999.99
gst - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer"

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer

Journal: Journal of Experimental & Clinical Cancer Research : CR

doi: 10.1186/s13046-018-0808-1

STK25 interacts with GOLPH3 and regulates its expression. a , b Exogenous STK25 interacts with GOLPH3. Cells were transfected with the indicated plasmids. Co-IP was performed using FLAG antibody to pull down FLAG-STK25 ( a ) or anti-Myc against Myc-GOLPH3 ( b ). Then, STK25 and GOLPH3 were detected with the indicated antibodies. c , d His-STK25 interacts directly with GST-GOLPH3 but not GST by in vitro GST pull-down and His-tag pull-down assays, respectively. e STK25 overexpression decreases GLOPH3 mRNA and protein levels in CRC cells. f STK25 knockdown increases GOLPH3 mRNA and protein levels in CRC cells
Figure Legend Snippet: STK25 interacts with GOLPH3 and regulates its expression. a , b Exogenous STK25 interacts with GOLPH3. Cells were transfected with the indicated plasmids. Co-IP was performed using FLAG antibody to pull down FLAG-STK25 ( a ) or anti-Myc against Myc-GOLPH3 ( b ). Then, STK25 and GOLPH3 were detected with the indicated antibodies. c , d His-STK25 interacts directly with GST-GOLPH3 but not GST by in vitro GST pull-down and His-tag pull-down assays, respectively. e STK25 overexpression decreases GLOPH3 mRNA and protein levels in CRC cells. f STK25 knockdown increases GOLPH3 mRNA and protein levels in CRC cells

Techniques Used: Expressing, Transfection, Co-Immunoprecipitation Assay, In Vitro, Over Expression

2) Product Images from "Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors"

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1007607

PaLCuCNV C2 interacts with RPS27A and promotes the performance of whitefly. (A) In vitro GST pull-down assays. MBP or MBP-PaL-C2 fusion proteins were pull-down by GST or GST-NtRPS27A fusion protein. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (B) In vivo BiFC analysis of PaL-C2 interaction with NtRPS27A or ubiquitin. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein which is located in nucleus. Bars = 20 mm. (C) Subcellular localization of PaL-C2, NtRPS27A and ubiquitin. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (D) Survival rate of adult whitefly on control and PaLCuCNV-infected tobacco plants. Values are means±SE, n = 30. (E) Daily number of eggs laid by per female whitefly on control empty-vector-inoculated and PaLCuCNV -infected tobacco plants. Values are means±SE, n = 30. (F) Survival rate of non-viruliferous and viruliferous adult whiteflies on cotton plants. Values are means±SE, n = 30. (G) Daily number of eggs laid by per non-viruliferous and viruliferous adult female whiteflies on cotton plants. Values are means±SE, n = 30. Asterisks indicate significant differences between different treatments ( P
Figure Legend Snippet: PaLCuCNV C2 interacts with RPS27A and promotes the performance of whitefly. (A) In vitro GST pull-down assays. MBP or MBP-PaL-C2 fusion proteins were pull-down by GST or GST-NtRPS27A fusion protein. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (B) In vivo BiFC analysis of PaL-C2 interaction with NtRPS27A or ubiquitin. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein which is located in nucleus. Bars = 20 mm. (C) Subcellular localization of PaL-C2, NtRPS27A and ubiquitin. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (D) Survival rate of adult whitefly on control and PaLCuCNV-infected tobacco plants. Values are means±SE, n = 30. (E) Daily number of eggs laid by per female whitefly on control empty-vector-inoculated and PaLCuCNV -infected tobacco plants. Values are means±SE, n = 30. (F) Survival rate of non-viruliferous and viruliferous adult whiteflies on cotton plants. Values are means±SE, n = 30. (G) Daily number of eggs laid by per non-viruliferous and viruliferous adult female whiteflies on cotton plants. Values are means±SE, n = 30. Asterisks indicate significant differences between different treatments ( P

Techniques Used: In Vitro, SDS Page, Western Blot, Staining, In Vivo, Bimolecular Fluorescence Complementation Assay, Infection, Plasmid Preparation

Localization of C2 and NtRPS27A and their interaction. (A) Structure of RPS27A. (B) Interaction between SH2-C2 and NtRPS27A in the yeast two-hybrid system. Yeast strain Y2H Gold co-transformed with the indicated plasmids was spotted on synthetic medium SD-Leu-Trp-His with x-α-gal and 2 mM 3-amino-1,2,4-triazole. The empty vectors pGBKT7 and pGADT7 were used as negative controls. (C) In vivo BiFC analysis of SH2-C2 interaction with NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein that is located in Nuclei. Bars = 20 mm. (D) and (E) In vitro GST pull-down assays. MBP or MBP-SH2-C2 fusion proteins were pull-down by GST, GST-NtRPS27A, GST-ubiquitin or GST-ubiquitin 32-76 fusion proteins. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (F) Subcellular localization of SH2-C2 and different segments of NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein that is located in Nuclei. Bars = 20 mm.
Figure Legend Snippet: Localization of C2 and NtRPS27A and their interaction. (A) Structure of RPS27A. (B) Interaction between SH2-C2 and NtRPS27A in the yeast two-hybrid system. Yeast strain Y2H Gold co-transformed with the indicated plasmids was spotted on synthetic medium SD-Leu-Trp-His with x-α-gal and 2 mM 3-amino-1,2,4-triazole. The empty vectors pGBKT7 and pGADT7 were used as negative controls. (C) In vivo BiFC analysis of SH2-C2 interaction with NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein that is located in Nuclei. Bars = 20 mm. (D) and (E) In vitro GST pull-down assays. MBP or MBP-SH2-C2 fusion proteins were pull-down by GST, GST-NtRPS27A, GST-ubiquitin or GST-ubiquitin 32-76 fusion proteins. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (F) Subcellular localization of SH2-C2 and different segments of NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein that is located in Nuclei. Bars = 20 mm.

Techniques Used: Transformation Assay, In Vivo, Bimolecular Fluorescence Complementation Assay, In Vitro, SDS Page, Western Blot, Staining

Interaction between TYLCV C2 and AtRPS27A affects whitefly performance. (A) In vitro GST pull-down assays. MBP or MBP- C2 fusion proteins were pull-down by GST or GST-AtRPS27A fusion protein. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (B) In vivo BiFC analysis of C2 interaction with NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (C) Subcellular localization of C2 and AtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (D) Survival rate of adult whitefly on wild type Arabidopsis plants and the transgenic C2 expressing Arabidopsis plants. Values are means± SE, n = 30. (E) Daily number of eggs laid by per female whitefly on wild type Arabidopsis plants and the transgenic Arabidopsis plants expressing C2. Values are means±SE, n = 30. Asterisks indicate significant differences between different treatments (P
Figure Legend Snippet: Interaction between TYLCV C2 and AtRPS27A affects whitefly performance. (A) In vitro GST pull-down assays. MBP or MBP- C2 fusion proteins were pull-down by GST or GST-AtRPS27A fusion protein. GST beads were washed and proteins were analyzed by SDS-PAGE western blot. Associated proteins were detected by anti-MBP antibody and gels were stained with Coomassie Brilliant Blue to monitor GST and GST fusion proteins. (B) In vivo BiFC analysis of C2 interaction with NtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (C) Subcellular localization of C2 and AtRPS27A. Nuclei of tobacco leaf epidermal cells were marked with a RFP fusion protein. Bars = 20 mm. (D) Survival rate of adult whitefly on wild type Arabidopsis plants and the transgenic C2 expressing Arabidopsis plants. Values are means± SE, n = 30. (E) Daily number of eggs laid by per female whitefly on wild type Arabidopsis plants and the transgenic Arabidopsis plants expressing C2. Values are means±SE, n = 30. Asterisks indicate significant differences between different treatments (P

Techniques Used: In Vitro, SDS Page, Western Blot, Staining, In Vivo, Bimolecular Fluorescence Complementation Assay, Transgenic Assay, Expressing

3) Product Images from "A role for nuclear lamins in nuclear envelope assembly"

Article Title: A role for nuclear lamins in nuclear envelope assembly

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200101025

Sperm chromatin incubated in extracts containing GST–LB3T (A and B) or GST as a control (C and D) was visualized with TOTO (A and C) and a monoclonal GST antibody (B and D). GST–LB3T was found in bright patches at the surface of chromatin, with less intense staining throughout the chromatin (B). GST alone had no apparent effect on chromatin decondensation (C), and was not detected in association with chromatin (D). λDNA was added to normal extracts (J–N) or LB3T-treated extracts (E–I). After 6 h, samples were fixed and stained with DiOC 6 , TOTO, and the LB3 and nucleoporin antibodies. In extracts containing LB3T, small patches of membrane (MEM) and LB3 fluorescence were seen at the edge of λDNA (E–H), but nucleoporin staining was difficult to detect (I). In controls, bright rims of fluorescence were observed for all three envelope markers (J–N). Bars, 10 μm.
Figure Legend Snippet: Sperm chromatin incubated in extracts containing GST–LB3T (A and B) or GST as a control (C and D) was visualized with TOTO (A and C) and a monoclonal GST antibody (B and D). GST–LB3T was found in bright patches at the surface of chromatin, with less intense staining throughout the chromatin (B). GST alone had no apparent effect on chromatin decondensation (C), and was not detected in association with chromatin (D). λDNA was added to normal extracts (J–N) or LB3T-treated extracts (E–I). After 6 h, samples were fixed and stained with DiOC 6 , TOTO, and the LB3 and nucleoporin antibodies. In extracts containing LB3T, small patches of membrane (MEM) and LB3 fluorescence were seen at the edge of λDNA (E–H), but nucleoporin staining was difficult to detect (I). In controls, bright rims of fluorescence were observed for all three envelope markers (J–N). Bars, 10 μm.

Techniques Used: Incubation, Staining, Fluorescence

4) Product Images from "Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation"

Article Title: Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

Journal: British Journal of Cancer

doi: 10.1038/bjc.2014.39

Gab1 mediates HGF-induced cell invasion and activation of Dock7 and Rac1. ( A ) Gab1 depletion reduces HGF-induced U87R cell invasion. Experiments were performed 3 days after siRNA transfection. ( B ) Gab1 depletion inhibits HGF-induced Rac1 activation measured by G-Lisa assay. Experiments were performed 3 days after siRNA transfection. ( C ) The role of Gab1 in HGF-induced Dock7 activation. Experiments were performed 3 days after transfection. Active Dock7 was pulled down using GST-Rac1-15A and subsequently measured by western blotting. ( D ) Quantification of Dock7 activation data from eight independent experiments, exemplified in ( C ). Activated Dock7 was normalised to the amount of GST-Rac1-15A in the pull down. * P
Figure Legend Snippet: Gab1 mediates HGF-induced cell invasion and activation of Dock7 and Rac1. ( A ) Gab1 depletion reduces HGF-induced U87R cell invasion. Experiments were performed 3 days after siRNA transfection. ( B ) Gab1 depletion inhibits HGF-induced Rac1 activation measured by G-Lisa assay. Experiments were performed 3 days after siRNA transfection. ( C ) The role of Gab1 in HGF-induced Dock7 activation. Experiments were performed 3 days after transfection. Active Dock7 was pulled down using GST-Rac1-15A and subsequently measured by western blotting. ( D ) Quantification of Dock7 activation data from eight independent experiments, exemplified in ( C ). Activated Dock7 was normalised to the amount of GST-Rac1-15A in the pull down. * P

Techniques Used: Activation Assay, Transfection, Western Blot

5) Product Images from "An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity"

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity

Journal:

doi: 10.1038/sj.onc.1208666

TCTP interacts with Bcl-xL. ( a ) Schematic representation of GST, GST-Bcl-xL, and GST-TCTP fusion proteins. ( b ) Migration of purified GST, GST-Bcl-xL, and GST-TCTP on Coomassie blue-stained SDS–PAGE (upper panel) and their specific reactivity on
Figure Legend Snippet: TCTP interacts with Bcl-xL. ( a ) Schematic representation of GST, GST-Bcl-xL, and GST-TCTP fusion proteins. ( b ) Migration of purified GST, GST-Bcl-xL, and GST-TCTP on Coomassie blue-stained SDS–PAGE (upper panel) and their specific reactivity on

Techniques Used: Migration, Purification, Staining, SDS Page

6) Product Images from "The disintegrin domain of ADAM9: a ligand for multiple ?1 renal integrins"

Article Title: The disintegrin domain of ADAM9: a ligand for multiple ?1 renal integrins

Journal:

doi: 10.1042/BJ20041133

Inhibition of cell adhesion to DIS-GST using anti-integrin antibodies
Figure Legend Snippet: Inhibition of cell adhesion to DIS-GST using anti-integrin antibodies

Techniques Used: Inhibition

Enrichment of renal integrins using immobilized DIS-GST fusion protein
Figure Legend Snippet: Enrichment of renal integrins using immobilized DIS-GST fusion protein

Techniques Used:

7) Product Images from "Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons"

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons

Journal:

doi: 10.1091/mbc.E07-03-0237

Pin1 binds to phosphorylated neurofilament-heavy chain (p-NF-H). (A) GST pulldown assays in rat brain lysates. Samples were separated by 10% SDS-PAGE, and gels were Coomassie stained. Protein bands corresponding to approximately 200 kDa were excised and
Figure Legend Snippet: Pin1 binds to phosphorylated neurofilament-heavy chain (p-NF-H). (A) GST pulldown assays in rat brain lysates. Samples were separated by 10% SDS-PAGE, and gels were Coomassie stained. Protein bands corresponding to approximately 200 kDa were excised and

Techniques Used: SDS Page, Staining

8) Product Images from "STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer"

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer

Journal: Journal of Experimental & Clinical Cancer Research : CR

doi: 10.1186/s13046-018-0808-1

STK25 interacts with GOLPH3 and regulates its expression. a , b Exogenous STK25 interacts with GOLPH3. Cells were transfected with the indicated plasmids. Co-IP was performed using FLAG antibody to pull down FLAG-STK25 ( a ) or anti-Myc against Myc-GOLPH3 ( b ). Then, STK25 and GOLPH3 were detected with the indicated antibodies. c , d His-STK25 interacts directly with GST-GOLPH3 but not GST by in vitro GST pull-down and His-tag pull-down assays, respectively. e STK25 overexpression decreases GLOPH3 mRNA and protein levels in CRC cells. f STK25 knockdown increases GOLPH3 mRNA and protein levels in CRC cells
Figure Legend Snippet: STK25 interacts with GOLPH3 and regulates its expression. a , b Exogenous STK25 interacts with GOLPH3. Cells were transfected with the indicated plasmids. Co-IP was performed using FLAG antibody to pull down FLAG-STK25 ( a ) or anti-Myc against Myc-GOLPH3 ( b ). Then, STK25 and GOLPH3 were detected with the indicated antibodies. c , d His-STK25 interacts directly with GST-GOLPH3 but not GST by in vitro GST pull-down and His-tag pull-down assays, respectively. e STK25 overexpression decreases GLOPH3 mRNA and protein levels in CRC cells. f STK25 knockdown increases GOLPH3 mRNA and protein levels in CRC cells

Techniques Used: Expressing, Transfection, Co-Immunoprecipitation Assay, In Vitro, Over Expression

9) Product Images from "Y-box protein-associated acidic protein (YBAP1/C1QBP) affects the localization and cytoplasmic functions of YB-1"

Article Title: Y-box protein-associated acidic protein (YBAP1/C1QBP) affects the localization and cytoplasmic functions of YB-1

Journal: Scientific Reports

doi: 10.1038/s41598-018-24401-3

YBAP1 inhibits nuclear import of the YB-1 C2 region by transportin 1. ( a ) Permeabilized HeLa cells were incubated with 1.6 μM GST-GFP-YB-1-C2, 1.5 μM transportin 1, 4 μM Ran-GDP, and an ATP regeneration system in the presence of 0–3 μM YBAP1. Localization of GST-GFP-YB-1-C2 was examined by a fluorescence microscopy. ( b ) YB-1-His, GST-YBAP1 and GST were incubated with increasing amounts of FLAG-transportin 1. The mixture was subjected to GST-pulldown assays as described in Methods. The eluted proteins (lanes 8–14) and aliquots of the reaction mixture (input, lanes 1–7) were then analyzed by immunoblotting. ( c ) YB-1-His and FLAG-transportin 1 were incubated with increasing amounts of GST-YBAP1. The mixture was subjected to immunoprecipitation with anti-FLAG antibodies as described in Methods. The eluted proteins (lanes 7–12) and aliquots of the reaction mixture (input, lanes 1–6) were analyzed by immunoblotting.
Figure Legend Snippet: YBAP1 inhibits nuclear import of the YB-1 C2 region by transportin 1. ( a ) Permeabilized HeLa cells were incubated with 1.6 μM GST-GFP-YB-1-C2, 1.5 μM transportin 1, 4 μM Ran-GDP, and an ATP regeneration system in the presence of 0–3 μM YBAP1. Localization of GST-GFP-YB-1-C2 was examined by a fluorescence microscopy. ( b ) YB-1-His, GST-YBAP1 and GST were incubated with increasing amounts of FLAG-transportin 1. The mixture was subjected to GST-pulldown assays as described in Methods. The eluted proteins (lanes 8–14) and aliquots of the reaction mixture (input, lanes 1–7) were then analyzed by immunoblotting. ( c ) YB-1-His and FLAG-transportin 1 were incubated with increasing amounts of GST-YBAP1. The mixture was subjected to immunoprecipitation with anti-FLAG antibodies as described in Methods. The eluted proteins (lanes 7–12) and aliquots of the reaction mixture (input, lanes 1–6) were analyzed by immunoblotting.

Techniques Used: Incubation, Fluorescence, Microscopy, Immunoprecipitation

Transportin 1 is the nuclear import receptor for YB-1. ( a ) Nuclear localization of GST-GFP-YB-1-C2 was examined in a semi-intact cell system with HeLa cytosol. Digitonin-permeabilized HeLa cells were incubated with GST-GFP-YB-1-C2, HeLa cytosolic fraction, and an ATP regeneration system. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels). In some experiments, ATP regeneration system was omitted, and apyrase was included instead (middle row). ( b ) FLAG-Transportin 1 expression vector, pCMV-3xFLAG-TRN1 (lanes 2 and 4), or empty vector (lanes 1 and 3) was transfected into HeLa cells. Two days later, cell lysates were subjected to immunoprecipitation with anti-FLAG antibodies. Immunoprecipitates and input lysates were analyzed by immunoblotting with antibodies against YB-1 and FLAG. ( c ) Permeabilized HeLa cells were incubated with 2 μM GST-GFP-YB-1-C2 with 4 μM Ran-GDP and an ATP regeneration system in the absence (top row) or presence (bottom row) of 0.5 μM transportin 1. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels).
Figure Legend Snippet: Transportin 1 is the nuclear import receptor for YB-1. ( a ) Nuclear localization of GST-GFP-YB-1-C2 was examined in a semi-intact cell system with HeLa cytosol. Digitonin-permeabilized HeLa cells were incubated with GST-GFP-YB-1-C2, HeLa cytosolic fraction, and an ATP regeneration system. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels). In some experiments, ATP regeneration system was omitted, and apyrase was included instead (middle row). ( b ) FLAG-Transportin 1 expression vector, pCMV-3xFLAG-TRN1 (lanes 2 and 4), or empty vector (lanes 1 and 3) was transfected into HeLa cells. Two days later, cell lysates were subjected to immunoprecipitation with anti-FLAG antibodies. Immunoprecipitates and input lysates were analyzed by immunoblotting with antibodies against YB-1 and FLAG. ( c ) Permeabilized HeLa cells were incubated with 2 μM GST-GFP-YB-1-C2 with 4 μM Ran-GDP and an ATP regeneration system in the absence (top row) or presence (bottom row) of 0.5 μM transportin 1. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels).

Techniques Used: Incubation, Fluorescence, Microscopy, Expressing, Plasmid Preparation, Transfection, Immunoprecipitation

YBAP1 interacts with the C1 and C2 regions of the YB-1 tail domain. ( a ) HeLa cell lysates were treated with (lanes 4 and 6) or without (lanes 3 and 5) RNase A, and subjected to immunoprecipitation with control rabbit IgG (lanes 3 and 4) or rabbit anti-YB-1 antibodies (lanes 5 and 6). Immunoprecipitates and cell lysates (10% of input, lanes 1; 2.5% of input, lane 2) were analyzed by immunoblotting with antibodies against YB-1, YBAP1, and PABP. ( b ) FLAG-tagged YB-1 and its fragments were synthesized in wheat germ extracts and incubated with GST (lanes 7, 9, 11, 13, 15, and 17) or GST-YBAP1 (lanes 8, 10, 12, 14, 16, and 18). Protein complexes were bound to glutathione–Sepharose, and the eluted materials together with the input extracts (lanes 1–6) were analyzed by immunoblotting with anti-FLAG antibodies. Schematic diagrams of the YB-1 fragments are shown at the bottom. +++ and −−− indicate basic and acidic/aromatic amino acid clusters, respectively.
Figure Legend Snippet: YBAP1 interacts with the C1 and C2 regions of the YB-1 tail domain. ( a ) HeLa cell lysates were treated with (lanes 4 and 6) or without (lanes 3 and 5) RNase A, and subjected to immunoprecipitation with control rabbit IgG (lanes 3 and 4) or rabbit anti-YB-1 antibodies (lanes 5 and 6). Immunoprecipitates and cell lysates (10% of input, lanes 1; 2.5% of input, lane 2) were analyzed by immunoblotting with antibodies against YB-1, YBAP1, and PABP. ( b ) FLAG-tagged YB-1 and its fragments were synthesized in wheat germ extracts and incubated with GST (lanes 7, 9, 11, 13, 15, and 17) or GST-YBAP1 (lanes 8, 10, 12, 14, 16, and 18). Protein complexes were bound to glutathione–Sepharose, and the eluted materials together with the input extracts (lanes 1–6) were analyzed by immunoblotting with anti-FLAG antibodies. Schematic diagrams of the YB-1 fragments are shown at the bottom. +++ and −−− indicate basic and acidic/aromatic amino acid clusters, respectively.

Techniques Used: Immunoprecipitation, Synthesized, Incubation

10) Product Images from "REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS"

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS

Journal: The international journal of biochemistry & cell biology

doi: 10.1016/j.biocel.2011.04.009

Phosphorylation of GST-SRC-1 fragments enables identification of additional cyclin A2/Cdk2 target sites. (A) Schematic diagram depicting full length wild type SRC-1 (wt) and the eight fragments (F1–F8) generated by cloning into the pGEX-4T-1 vector.
Figure Legend Snippet: Phosphorylation of GST-SRC-1 fragments enables identification of additional cyclin A2/Cdk2 target sites. (A) Schematic diagram depicting full length wild type SRC-1 (wt) and the eight fragments (F1–F8) generated by cloning into the pGEX-4T-1 vector.

Techniques Used: Generated, Clone Assay, Plasmid Preparation

11) Product Images from "Molecular Determinants of the Interaction between Clostridium perfringens"

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens

Journal:

doi: 10.1074/jbc.M109.008623

A , CPE-(116–319) binds much more strongly to the ECL2 peptide of Cld3 than does CPE-(290–319). ECL2 peptide (amino acids 140–159) of mouse Cld3 was immobilized and superinfused with different concentrations of GST-CPE-(116–319)
Figure Legend Snippet: A , CPE-(116–319) binds much more strongly to the ECL2 peptide of Cld3 than does CPE-(290–319). ECL2 peptide (amino acids 140–159) of mouse Cld3 was immobilized and superinfused with different concentrations of GST-CPE-(116–319)

Techniques Used:

Binding of GST-CPE to Cld3-transfected HEK cells. Three days after transfection, cells were incubated with 1 μg/ml GST-CPE-(116–319) ( left , middle ) or GST-CPE-(194–319) ( right ) for 1 h at 37 °C, washed with PBS, and the
Figure Legend Snippet: Binding of GST-CPE to Cld3-transfected HEK cells. Three days after transfection, cells were incubated with 1 μg/ml GST-CPE-(116–319) ( left , middle ) or GST-CPE-(194–319) ( right ) for 1 h at 37 °C, washed with PBS, and the

Techniques Used: Binding Assay, Transfection, Incubation

Single amino acid substitution analysis of the ECL2 of Cld3 (Cld3-ECL2) identified the motif 148 NPLVP 152 as essential for the association of GST-CPE-(116–319). The C-terminal flank (Cld3-(154–157)) also contains amino acids involved in
Figure Legend Snippet: Single amino acid substitution analysis of the ECL2 of Cld3 (Cld3-ECL2) identified the motif 148 NPLVP 152 as essential for the association of GST-CPE-(116–319). The C-terminal flank (Cld3-(154–157)) also contains amino acids involved in

Techniques Used:

Binding of GST-CPE-(116–319) and GST-CPE-(194–319) to Cld3 on the surface of transfected HEK cells. Cells were transfected with Cld3 wt -CFP ( A and B ), Cld3 wt ( C and E ), or Cld3-N148D/L150A ( D and E ), 3 days later, the cells were incubated
Figure Legend Snippet: Binding of GST-CPE-(116–319) and GST-CPE-(194–319) to Cld3 on the surface of transfected HEK cells. Cells were transfected with Cld3 wt -CFP ( A and B ), Cld3 wt ( C and E ), or Cld3-N148D/L150A ( D and E ), 3 days later, the cells were incubated

Techniques Used: Binding Assay, Transfection, Incubation

Binding of full-length Cld3 to CPE is affected by amino acid substitutions in the ECL2 of Cld3. HEK cells were transfected with Cld3 wt or a Cld3 mutant . Lysates thereof were used for pull-down assays with GST-CPE-(116–319) or GST immobilized on
Figure Legend Snippet: Binding of full-length Cld3 to CPE is affected by amino acid substitutions in the ECL2 of Cld3. HEK cells were transfected with Cld3 wt or a Cld3 mutant . Lysates thereof were used for pull-down assays with GST-CPE-(116–319) or GST immobilized on

Techniques Used: Binding Assay, Transfection, Mutagenesis

Binding of GST-CPE-(116–319) to Cld5-transfected HEK cells. Cells were incubated with 1 μg/ml GST-CPE-(116–319) ( A ) or GST-CPE-(194–319) ( B ) at 37 °C 3 days after transfection, washed with PBS, and the amount of
Figure Legend Snippet: Binding of GST-CPE-(116–319) to Cld5-transfected HEK cells. Cells were incubated with 1 μg/ml GST-CPE-(116–319) ( A ) or GST-CPE-(194–319) ( B ) at 37 °C 3 days after transfection, washed with PBS, and the amount of

Techniques Used: Binding Assay, Transfection, Incubation

12) Product Images from "The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)"

Article Title: The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.917867

PIM1 interacts with SND1. ( A ) FLAG-PIM1 was overexpressed in 2BS cells, and then cellular proteins were collected for electrophoresis, silver staining, and mass spectrometric analysis to detect target proteins interacting with PIM1. ( B ) HA-SND1 and Flag-PIM1 plasmids were co-transfected into 293T cells. Co-immunoprecipitation and Western blot analysis were performed with corresponding antibodies. ( C ) In RasV12-induced senescent cells, co-immunoprecipitation was performed and precipitated complexes were subjected to Western blot analysis by using antibodies against PIM1 and SND1, respectively. ( D ) GST-SND1 and HA-PIM1, expressed from bacteria, were employed to perform GST pull-down experiments. ( E ) Co-localization of PIM1 and SND1 in the indicated 2BS cells by representative immunofluorescence staining. Data are presented as mean±SD. The experiments were repeated 3 times.
Figure Legend Snippet: PIM1 interacts with SND1. ( A ) FLAG-PIM1 was overexpressed in 2BS cells, and then cellular proteins were collected for electrophoresis, silver staining, and mass spectrometric analysis to detect target proteins interacting with PIM1. ( B ) HA-SND1 and Flag-PIM1 plasmids were co-transfected into 293T cells. Co-immunoprecipitation and Western blot analysis were performed with corresponding antibodies. ( C ) In RasV12-induced senescent cells, co-immunoprecipitation was performed and precipitated complexes were subjected to Western blot analysis by using antibodies against PIM1 and SND1, respectively. ( D ) GST-SND1 and HA-PIM1, expressed from bacteria, were employed to perform GST pull-down experiments. ( E ) Co-localization of PIM1 and SND1 in the indicated 2BS cells by representative immunofluorescence staining. Data are presented as mean±SD. The experiments were repeated 3 times.

Techniques Used: Electrophoresis, Silver Staining, Transfection, Immunoprecipitation, Western Blot, Immunofluorescence, Staining

13) Product Images from "Pentatricopeptide repeat protein DEK40 is required for mitochondrial function and kernel development in maize"

Article Title: Pentatricopeptide repeat protein DEK40 is required for mitochondrial function and kernel development in maize

Journal: Journal of Experimental Botany

doi: 10.1093/jxb/erz391

DEK40 recognizes and directly binds cox3 , nad2 , and nad5 transcripts. (A) Nucleotide sequence of RNA probes. Edited sites are indicated in red. (B) RNA EMSAs indicated that DEK40 directly binds to cox3 transcripts that surround the cox3 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. Black arrows show the shifted bound and free RNA probe. (C) RNA EMSAs indicated that DEK40 directly binds to nad2 transcripts that surround the nad2 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. The shifted bound and free RNA probesw are indicated by black arrows. (D) RNA EMSAs indicated that DEK40 directly binds to nad5 transcripts that surround the nad5 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. The shifted bound and free RNA probes are indicated by black arrows.
Figure Legend Snippet: DEK40 recognizes and directly binds cox3 , nad2 , and nad5 transcripts. (A) Nucleotide sequence of RNA probes. Edited sites are indicated in red. (B) RNA EMSAs indicated that DEK40 directly binds to cox3 transcripts that surround the cox3 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. Black arrows show the shifted bound and free RNA probe. (C) RNA EMSAs indicated that DEK40 directly binds to nad2 transcripts that surround the nad2 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. The shifted bound and free RNA probesw are indicated by black arrows. (D) RNA EMSAs indicated that DEK40 directly binds to nad5 transcripts that surround the nad5 edited site. Unlabeled probe was used as a competitor, and GST was used as a negative control. The shifted bound and free RNA probes are indicated by black arrows.

Techniques Used: Sequencing, Negative Control

14) Product Images from "Srs2 promotes synthesis-dependent strand annealing by disrupting DNA polymerase δ-extending D-loops"

Article Title: Srs2 promotes synthesis-dependent strand annealing by disrupting DNA polymerase δ-extending D-loops

Journal: eLife

doi: 10.7554/eLife.22195

Srs2 disrupts Rad51/Rad54 reconstituted D-loops with higher efficiency than protein-free D-loops. ( A ) D-loop disruption assay using purified protein-free D-loops generated by Rad51 and Rad54. ( B ) Protein-free D-loops were split into buffer containing Srs2 or no protein and incubated at 30°C. Samples were taken at 0, 5, 15, and 40 min, and the final concentration of Srs2 is 15 nM. ( C ) GST-Rad54 physically interacts with Srs2. 17.5 nM GST-Rad54 or 175 nM GST were incubated with either 8.75 nM or 17.5 nM of Srs2 for 1 hr before pulldown. ( D ) The protein interaction between Rad54 and Srs2 is sensitive to increasing ionic strength. GST-Rad54 and Srs2 were formed in buffer containing 0, 100, 175, 250, or 400 mM NaCl before pulldown. ( E ) Srs2-K41S interacts with Rad54 with similar salt sensitivity, compared to wild type Srs2. Both wild type Srs2 and Srs2-K41S were allowed to form complex with GST-Rad54 in buffer containing 0, 250, and 500 mM NaCl before pulldown. Plotted are means ± standard deviation from n = 3. In ( D ) and ( E ), 31.3 nM GST-Rad54 or 313 nM GST (GE Healthcare) were incubated with 31.3 nM of Srs2 or Srs2-K41S in the same buffer containing indicated amount of NaCl for 1 hr before pulldown. Pulldown Srs2 amount in buffer containing 0 mM NaCl was normalized to 100 ( D ) or 1 ( E ). DOI: http://dx.doi.org/10.7554/eLife.22195.012 10.7554/eLife.22195.013 Source data for Figure 3B . DOI: http://dx.doi.org/10.7554/eLife.22195.013 10.7554/eLife.22195.014 Source data for Figure 3E . DOI: http://dx.doi.org/10.7554/eLife.22195.014
Figure Legend Snippet: Srs2 disrupts Rad51/Rad54 reconstituted D-loops with higher efficiency than protein-free D-loops. ( A ) D-loop disruption assay using purified protein-free D-loops generated by Rad51 and Rad54. ( B ) Protein-free D-loops were split into buffer containing Srs2 or no protein and incubated at 30°C. Samples were taken at 0, 5, 15, and 40 min, and the final concentration of Srs2 is 15 nM. ( C ) GST-Rad54 physically interacts with Srs2. 17.5 nM GST-Rad54 or 175 nM GST were incubated with either 8.75 nM or 17.5 nM of Srs2 for 1 hr before pulldown. ( D ) The protein interaction between Rad54 and Srs2 is sensitive to increasing ionic strength. GST-Rad54 and Srs2 were formed in buffer containing 0, 100, 175, 250, or 400 mM NaCl before pulldown. ( E ) Srs2-K41S interacts with Rad54 with similar salt sensitivity, compared to wild type Srs2. Both wild type Srs2 and Srs2-K41S were allowed to form complex with GST-Rad54 in buffer containing 0, 250, and 500 mM NaCl before pulldown. Plotted are means ± standard deviation from n = 3. In ( D ) and ( E ), 31.3 nM GST-Rad54 or 313 nM GST (GE Healthcare) were incubated with 31.3 nM of Srs2 or Srs2-K41S in the same buffer containing indicated amount of NaCl for 1 hr before pulldown. Pulldown Srs2 amount in buffer containing 0 mM NaCl was normalized to 100 ( D ) or 1 ( E ). DOI: http://dx.doi.org/10.7554/eLife.22195.012 10.7554/eLife.22195.013 Source data for Figure 3B . DOI: http://dx.doi.org/10.7554/eLife.22195.013 10.7554/eLife.22195.014 Source data for Figure 3E . DOI: http://dx.doi.org/10.7554/eLife.22195.014

Techniques Used: Purification, Generated, Incubation, Concentration Assay, Standard Deviation

15) Product Images from "ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function"

Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201307088

Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).
Figure Legend Snippet: Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).

Techniques Used: Binding Assay, Mutagenesis, In Vitro, Purification

Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.
Figure Legend Snippet: Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.

Techniques Used: In Vivo, Immunolabeling, Mouse Assay, Transfection, Staining, Marker

16) Product Images from "IgG glycan hydrolysis by a bacterial enzyme as a therapy against autoimmune conditions"

Article Title: IgG glycan hydrolysis by a bacterial enzyme as a therapy against autoimmune conditions

Journal:

doi: 10.1073/pnas.0711271105

EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)
Figure Legend Snippet: EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)

Techniques Used: Mouse Assay, Injection, SDS Page, Staining

EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)
Figure Legend Snippet: EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)

Techniques Used: Mouse Assay, Injection, SDS Page, Staining

17) Product Images from "Modulation of Cellular Protein Trafficking by Human Immunodeficiency Virus Type 1 Nef: Role of the Acidic Residue in the ExxxLL Motif"

Article Title: Modulation of Cellular Protein Trafficking by Human Immunodeficiency Virus Type 1 Nef: Role of the Acidic Residue in the ExxxLL Motif

Journal:

doi: 10.1128/JVI.80.4.1837-1849.2006

Pull-down of intact AP-1 or AP-3 from cytoplasmic lysates by GST-Nef. Lysates of HeLa cells were incubated with equal amounts of purified wild-type or mutated GST-Nef, previously immobilized on glutathione-Sepharose beads. Bound proteins were resolved
Figure Legend Snippet: Pull-down of intact AP-1 or AP-3 from cytoplasmic lysates by GST-Nef. Lysates of HeLa cells were incubated with equal amounts of purified wild-type or mutated GST-Nef, previously immobilized on glutathione-Sepharose beads. Bound proteins were resolved

Techniques Used: Incubation, Purification

18) Product Images from "Adenovirus E1A Inhibits SCFFbw7 Ubiquitin Ligase *"

Article Title: Adenovirus E1A Inhibits SCFFbw7 Ubiquitin Ligase *

Journal:

doi: 10.1074/jbc.M109.006809

E1A inhibits Roc1/Rbx1-CUL1-dependent elongation reaction of ubiquitin chains. A , effect of E1A on the elongation of ubiquitin chains by the Roc1/Rbx1-CUL1 complex in vitro . Bacterially coexpressed and purified GST-fused full-length Roc1/Rbx1 and FLAG-tagged
Figure Legend Snippet: E1A inhibits Roc1/Rbx1-CUL1-dependent elongation reaction of ubiquitin chains. A , effect of E1A on the elongation of ubiquitin chains by the Roc1/Rbx1-CUL1 complex in vitro . Bacterially coexpressed and purified GST-fused full-length Roc1/Rbx1 and FLAG-tagged

Techniques Used: In Vitro, Purification

19) Product Images from "WDR5 Interacts with Mixed Lineage Leukemia (MLL) Protein via the Histone H3-binding Pocket *WDR5 Interacts with Mixed Lineage Leukemia (MLL) Protein via the Histone H3-binding Pocket * S⃞"

Article Title: WDR5 Interacts with Mixed Lineage Leukemia (MLL) Protein via the Histone H3-binding Pocket *WDR5 Interacts with Mixed Lineage Leukemia (MLL) Protein via the Histone H3-binding Pocket * S⃞

Journal:

doi: 10.1074/jbc.M806900200

WDR5-MLL interactions. A and B , detailed interactions between WDR5 and MLL peptide and comparison with the WDR5-H3K4me2 interaction. C , GST pull-down experiments with GST-MLL228 mutants and WDR5. Mutating Arg-2 in histone H3-like motif significantly
Figure Legend Snippet: WDR5-MLL interactions. A and B , detailed interactions between WDR5 and MLL peptide and comparison with the WDR5-H3K4me2 interaction. C , GST pull-down experiments with GST-MLL228 mutants and WDR5. Mutating Arg-2 in histone H3-like motif significantly

Techniques Used:

Methylated histone competes with MLL for WDR5 interaction. A , for competition experiments, GST-MLL228 was incubated with WDR5 in the presence of increasing amounts of unmodified, mono-, di-, and tri-methylated histone H3 (1-11 aa, 0, 5, 20, 60, 150
Figure Legend Snippet: Methylated histone competes with MLL for WDR5 interaction. A , for competition experiments, GST-MLL228 was incubated with WDR5 in the presence of increasing amounts of unmodified, mono-, di-, and tri-methylated histone H3 (1-11 aa, 0, 5, 20, 60, 150

Techniques Used: Methylation, Incubation

20) Product Images from "A Novel Colonic Repressor Element Regulates Intestinal Gene Expression by Interacting with Cux/CDP"

Article Title: A Novel Colonic Repressor Element Regulates Intestinal Gene Expression by Interacting with Cux/CDP

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.22.15.5467-5478.2002

Characterization of Cux/CDP and GATA interaction with CRESIP. (A) GST fusion proteins for each different CR and HD domain of the Cux/CDP protein were generated (top) and calibrated by SDS-PAGE and Coomassie staining (middle). Arrow, partial cleavage of the GST tag. GST fusion proteins (GST-fus.; 50 ng ) were used for EMSA with labeled WT-CRESIP or MUT-CRESIP oligonucleotides (bottom). Competitions (Comp) were performed with a 1,000-fold molar excess of the WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides. (B) A GST-Cux/CDP mutant (mut) protein that lacked portions of the N-terminal HD- and C-terminal regions was constructed (top). Western blot analysis was performed with a rabbit anti-GST polyclonal antibody on a GST affinity-purified bacterial extract that overexpressed the GST-Cux/CDPmut protein (middle). The GST-Cux/CDPmut fusion protein was used for EMSA and was competed with a 1,000-fold molar excess of the WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides (bottom). (C) Nuclear extracts of Cos-7 cells (5 μg) transfected with an empty (ctl) or GATA-4 (G4) expression vector were used for each binding reaction. Competitions (Comp) were performed with a 100-fold molar excess of WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides.
Figure Legend Snippet: Characterization of Cux/CDP and GATA interaction with CRESIP. (A) GST fusion proteins for each different CR and HD domain of the Cux/CDP protein were generated (top) and calibrated by SDS-PAGE and Coomassie staining (middle). Arrow, partial cleavage of the GST tag. GST fusion proteins (GST-fus.; 50 ng ) were used for EMSA with labeled WT-CRESIP or MUT-CRESIP oligonucleotides (bottom). Competitions (Comp) were performed with a 1,000-fold molar excess of the WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides. (B) A GST-Cux/CDP mutant (mut) protein that lacked portions of the N-terminal HD- and C-terminal regions was constructed (top). Western blot analysis was performed with a rabbit anti-GST polyclonal antibody on a GST affinity-purified bacterial extract that overexpressed the GST-Cux/CDPmut protein (middle). The GST-Cux/CDPmut fusion protein was used for EMSA and was competed with a 1,000-fold molar excess of the WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides (bottom). (C) Nuclear extracts of Cos-7 cells (5 μg) transfected with an empty (ctl) or GATA-4 (G4) expression vector were used for each binding reaction. Competitions (Comp) were performed with a 100-fold molar excess of WT-CRESIP or MUT-CRESIP unlabeled oligonucleotides.

Techniques Used: Generated, SDS Page, Staining, Labeling, Mutagenesis, Construct, Western Blot, Affinity Purification, Transfection, CTL Assay, Expressing, Plasmid Preparation, Binding Assay

21) Product Images from "RanBPM Is an Inhibitor of ERK Signaling"

Article Title: RanBPM Is an Inhibitor of ERK Signaling

Journal: PLoS ONE

doi: 10.1371/journal.pone.0047803

RanBPM interacts with c-Raf and reduces c-Raf-Hsp90 association. ( A ) Co-immunoprecipitation of RanBPM and c-Raf. RanBPM shRNA Hela cells were transfected with empty vector or RanBPM si-mt, and 48 post-transfection whole cell extracts were incubated with either an HA antibody or mouse IgG control. Presence of c-Raf in immunoprecipitates was determined using a c-Raf antibody and RanBPM expression was verified using HA, compared to 5% input extract. ( B ) RanBPM shRNA Hela cells were transfected with GST-ΔN-c-Raf and either pCMV empty vector or RanBPM si-mt, or with RanBPM si-mt and GST empty vector, and whole cell extracts were prepared 48 h post-transfection. Activated c-Raf was pulled down using glutathione-agarose beads, the presence of RanBPM was assessed using an HA antibody, and c-Raf expression was determined using a GST antibody, compared to 5% input extract. ( C ) Co-imunoprecipitation of Hsp90 with c-Raf. Extracts from Hela control (C) and RanBPM shRNA cells (2–7) were immunoprecipitated with c-Raf or mouse IgG control antibodies. Equal amounts of immunoprecipitated c-Raf from control and RanBPM shRNA cells were run on SDS-PAGE and analyzed by western blot with Hsp90 and c-Raf antibodies. Inputs represent 5% of the total protein used for immunoprecipitation. ( D ) Hela RanBPM shRNA cells were transfected with empty vector (-) or RanBPM si-mt, and whole cell extracts prepared 48 post-transfection were immunoprecipitated and analyzed as in C.
Figure Legend Snippet: RanBPM interacts with c-Raf and reduces c-Raf-Hsp90 association. ( A ) Co-immunoprecipitation of RanBPM and c-Raf. RanBPM shRNA Hela cells were transfected with empty vector or RanBPM si-mt, and 48 post-transfection whole cell extracts were incubated with either an HA antibody or mouse IgG control. Presence of c-Raf in immunoprecipitates was determined using a c-Raf antibody and RanBPM expression was verified using HA, compared to 5% input extract. ( B ) RanBPM shRNA Hela cells were transfected with GST-ΔN-c-Raf and either pCMV empty vector or RanBPM si-mt, or with RanBPM si-mt and GST empty vector, and whole cell extracts were prepared 48 h post-transfection. Activated c-Raf was pulled down using glutathione-agarose beads, the presence of RanBPM was assessed using an HA antibody, and c-Raf expression was determined using a GST antibody, compared to 5% input extract. ( C ) Co-imunoprecipitation of Hsp90 with c-Raf. Extracts from Hela control (C) and RanBPM shRNA cells (2–7) were immunoprecipitated with c-Raf or mouse IgG control antibodies. Equal amounts of immunoprecipitated c-Raf from control and RanBPM shRNA cells were run on SDS-PAGE and analyzed by western blot with Hsp90 and c-Raf antibodies. Inputs represent 5% of the total protein used for immunoprecipitation. ( D ) Hela RanBPM shRNA cells were transfected with empty vector (-) or RanBPM si-mt, and whole cell extracts prepared 48 post-transfection were immunoprecipitated and analyzed as in C.

Techniques Used: Immunoprecipitation, shRNA, Transfection, Plasmid Preparation, Incubation, Expressing, SDS Page, Western Blot

RanBPM inhibits ERK1/2 activation through regulation of c-Raf. ( A ) RanBPM regulates ERK1/2 signaling downstream of Ras. RanBPM shRNA Hela cells were left untransfected, or were transfected with either constitutively active RasV12 and RanBPM si-mt or RasV12 and empty pCMV vector. 24 h post-transfection, whole cell extracts were prepared and analyzed by western blotting. MEK1/2 and ERK1/2 activation was assessed by hybridization with phospho-MEK1/2 and phospho-ERK1/2 antibodies respectively and total MEK1/2 and total ERK1/2 levels were assessed using MEK1/2 and ERK1/2 antibodies. Expression of RasV12 and RanBPM was determined with an HA antibody. ( B ) RanBPM expression down-regulates c-Raf protein levels. RanBPM shRNA Hela cells were left untransfected, or were transfected with either constitutively active c-Raf (pEBG-GST-ΔN-c-Raf) and empty pCMV vector, or GST-ΔN-c-Raf and RanBPM si-mt. 48 h post-transfection, whole cell extracts were prepared and analyzed by western blotting. c-Raf expression was determined using a GST antibody, and ERK1/2 activation was assessed using a phospho-ERK1/2 antibody. RanBPM expression was verified using an HA antibody, and γ-tubulin was used as a loading control. ( C ) RanBPM shRNA Hela cells were either left untransfected or were transfected with constitutively active c-Raf (pCMV-Flag-Y/Y-c-Raf) and 48 h post-transfection, whole cell extracts were prepared as in B. Expression of c-Raf was assessed using a Flag antibody, and RanBPM expression was determined using an HA antibody. GAPDH was used as a loading control. ( D ) Whole cell extracts were prepared from Hela and HEK293 control shRNA and RanBPM shRNA cells and endogenous protein levels were analyzed by western blotting with c-Raf and RanBPM antibodies, with β-actin used as a loading control. ( E ) Control and RanBPM shRNA Hela cells were either left untransfected, or were transfected with empty vector or RanBPM si-mt. 48 h post-transfection, whole cell extracts were prepared and analyzed as in D. ( F ) RanBPM down-regulation does not affect c-Raf mRNA levels. cDNA from Hela control and RanBPM shRNA cells was analyzed by qRT-PCR using specific primers for GAPDH and c-Raf. Gene expression was quantified using the ΔΔC(t), with c-Raf expression normalized to GAPDH. Expression in RanBPM shRNA cells was calculated relative to that of control shRNA cells (set to an arbitrary value of 1). Data represents the mean of nine independent experiments, with error bars indicating standard error (SE).
Figure Legend Snippet: RanBPM inhibits ERK1/2 activation through regulation of c-Raf. ( A ) RanBPM regulates ERK1/2 signaling downstream of Ras. RanBPM shRNA Hela cells were left untransfected, or were transfected with either constitutively active RasV12 and RanBPM si-mt or RasV12 and empty pCMV vector. 24 h post-transfection, whole cell extracts were prepared and analyzed by western blotting. MEK1/2 and ERK1/2 activation was assessed by hybridization with phospho-MEK1/2 and phospho-ERK1/2 antibodies respectively and total MEK1/2 and total ERK1/2 levels were assessed using MEK1/2 and ERK1/2 antibodies. Expression of RasV12 and RanBPM was determined with an HA antibody. ( B ) RanBPM expression down-regulates c-Raf protein levels. RanBPM shRNA Hela cells were left untransfected, or were transfected with either constitutively active c-Raf (pEBG-GST-ΔN-c-Raf) and empty pCMV vector, or GST-ΔN-c-Raf and RanBPM si-mt. 48 h post-transfection, whole cell extracts were prepared and analyzed by western blotting. c-Raf expression was determined using a GST antibody, and ERK1/2 activation was assessed using a phospho-ERK1/2 antibody. RanBPM expression was verified using an HA antibody, and γ-tubulin was used as a loading control. ( C ) RanBPM shRNA Hela cells were either left untransfected or were transfected with constitutively active c-Raf (pCMV-Flag-Y/Y-c-Raf) and 48 h post-transfection, whole cell extracts were prepared as in B. Expression of c-Raf was assessed using a Flag antibody, and RanBPM expression was determined using an HA antibody. GAPDH was used as a loading control. ( D ) Whole cell extracts were prepared from Hela and HEK293 control shRNA and RanBPM shRNA cells and endogenous protein levels were analyzed by western blotting with c-Raf and RanBPM antibodies, with β-actin used as a loading control. ( E ) Control and RanBPM shRNA Hela cells were either left untransfected, or were transfected with empty vector or RanBPM si-mt. 48 h post-transfection, whole cell extracts were prepared and analyzed as in D. ( F ) RanBPM down-regulation does not affect c-Raf mRNA levels. cDNA from Hela control and RanBPM shRNA cells was analyzed by qRT-PCR using specific primers for GAPDH and c-Raf. Gene expression was quantified using the ΔΔC(t), with c-Raf expression normalized to GAPDH. Expression in RanBPM shRNA cells was calculated relative to that of control shRNA cells (set to an arbitrary value of 1). Data represents the mean of nine independent experiments, with error bars indicating standard error (SE).

Techniques Used: Activation Assay, shRNA, Transfection, Plasmid Preparation, Western Blot, Hybridization, Expressing, Quantitative RT-PCR

22) Product Images from "O-Linked Glycosylation Ensures the Normal Conformation of the Autotransporter Adhesin Involved in Diffuse Adherence ▿"

Article Title: O-Linked Glycosylation Ensures the Normal Conformation of the Autotransporter Adhesin Involved in Diffuse Adherence ▿

Journal:

doi: 10.1128/JB.00969-07

Binding of unglycosylated mature AIDA-I to cultured epithelial cells. The glycosylated (open squares) or unglycosylated (closed squares) fusion of GST to mature AIDA-I (encompassing amino acids 50 to 847) was purified by affinity chromatography. Various
Figure Legend Snippet: Binding of unglycosylated mature AIDA-I to cultured epithelial cells. The glycosylated (open squares) or unglycosylated (closed squares) fusion of GST to mature AIDA-I (encompassing amino acids 50 to 847) was purified by affinity chromatography. Various

Techniques Used: Binding Assay, Cell Culture, Purification, Affinity Chromatography

23) Product Images from "Endothelial cell specific adhesion molecule (ESAM) localizes to platelet–platelet contacts and regulates thrombus formation in vivo"

Article Title: Endothelial cell specific adhesion molecule (ESAM) localizes to platelet–platelet contacts and regulates thrombus formation in vivo

Journal:

doi: 10.1111/j.1538-7836.2009.03606.x

ESAM associates with the scaffold protein NHERF-1 in human platelets. (A) Amino acid sequence of the ESAM cytoplasmic tail c-terminus in multiple species. The PDZ domain binding motif is underlined. (B) A PDZ domain array was probed using a GST-ESAM cytoplasmic
Figure Legend Snippet: ESAM associates with the scaffold protein NHERF-1 in human platelets. (A) Amino acid sequence of the ESAM cytoplasmic tail c-terminus in multiple species. The PDZ domain binding motif is underlined. (B) A PDZ domain array was probed using a GST-ESAM cytoplasmic

Techniques Used: Sequencing, Binding Assay

24) Product Images from "Functional Role of CREB-Binding Protein in the Circadian Clock System of Drosophila melanogaster ▿"

Article Title: Functional Role of CREB-Binding Protein in the Circadian Clock System of Drosophila melanogaster ▿

Journal:

doi: 10.1128/MCB.02155-06

CBP disrupts the association of dCLK with CYC. (A) The C/H3 region of CBP is sufficient for the competition with CYC for binding to dCLK protein. GST or GST-dCLK was preincubated with increasing amounts of MBP or the C/H3 region of CBP fused to MBP (2
Figure Legend Snippet: CBP disrupts the association of dCLK with CYC. (A) The C/H3 region of CBP is sufficient for the competition with CYC for binding to dCLK protein. GST or GST-dCLK was preincubated with increasing amounts of MBP or the C/H3 region of CBP fused to MBP (2

Techniques Used: Binding Assay

25) Product Images from "Chlamydophila felis CF0218 Is a Novel TMH Family Protein with Potential as a Diagnostic Antigen for Diagnosis of C. felis Infection ▿ Infection ▿ †"

Article Title: Chlamydophila felis CF0218 Is a Novel TMH Family Protein with Potential as a Diagnostic Antigen for Diagnosis of C. felis Infection ▿ Infection ▿ †

Journal:

doi: 10.1128/CVI.00134-08

Production of recombinant CF0218 and its immunogenicity. (A) Purified GST alone, GST-CF0218, and GST-cleaved CF0218 were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). (B to E) Equal amounts of recombinant CF0218 shown in panel
Figure Legend Snippet: Production of recombinant CF0218 and its immunogenicity. (A) Purified GST alone, GST-CF0218, and GST-cleaved CF0218 were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). (B to E) Equal amounts of recombinant CF0218 shown in panel

Techniques Used: Recombinant, Purification, SDS Page, Staining

26) Product Images from "Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿"

Article Title: Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿

Journal:

doi: 10.1128/IAI.01352-07

Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and
Figure Legend Snippet: Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and

Techniques Used: Purification, Recombinant

27) Product Images from "ArgBP2, a Z-body and Z-band protein, binds sarcomeric, costameric and signaling molecules"

Article Title: ArgBP2, a Z-body and Z-band protein, binds sarcomeric, costameric and signaling molecules

Journal: Cytoskeleton (Hoboken, N.J.)

doi: 10.1002/cm.20490

Analysis of interaction of midArgBP2-GST (Arg-15) with F-actin. Amido Black stained 6-12% gel of pellet (p) and supernatant (s) factions resulting from centrifugation of mixtures of actin filaments and midArg15-GST. Lane M: Molecular weight marker, lane
Figure Legend Snippet: Analysis of interaction of midArgBP2-GST (Arg-15) with F-actin. Amido Black stained 6-12% gel of pellet (p) and supernatant (s) factions resulting from centrifugation of mixtures of actin filaments and midArg15-GST. Lane M: Molecular weight marker, lane

Techniques Used: Staining, Centrifugation, Molecular Weight, Marker

28) Product Images from "The Interaction between Rice ERF3 and WOX11 Promotes Crown Root Development by Regulating Gene Expression Involved in Cytokinin Signaling [OPEN]"

Article Title: The Interaction between Rice ERF3 and WOX11 Promotes Crown Root Development by Regulating Gene Expression Involved in Cytokinin Signaling [OPEN]

Journal: The Plant Cell

doi: 10.1105/tpc.15.00227

ERF3 Directly Interacts with WOX11 in Vitro and in Vivo (A) Pull-down assay of ERF3 interaction with WOX11. Left, ERF3-GST fusion protein or GST alone were incubated with WOX11-His in His beads. ERF3-GST but not GST was pulled down by the beads containing WOX11-His. Right, WOX11-His and WOX3-His were incubated with EFR3-GST in GST beads. WOX11-His but not WOX3-His was pulled down by the beads containing ERF3-GST. (B) Interaction of ERF3 and WOX11 in rice protoplasts. Representative cells are shown, as imaged by confocal laser scanning microscopy. a, e, and i, Ghd7:CFP localization in the nucleus (blue fluorescence); b, detection in rice protoplasts of YN:WOX11 and ERF3:YC interaction, shown as yellow signal; f and j, as negative controls with YN:pVYNE(R)/pVYCE(R):YC and YN: pVYNE(R)/ERF3:YC; c, g, and k, bright field; d, h, and l, colocalization of three signals is indicated in merged images. Bars = 10 µm. (C) In vivo coimmunoprecipitation assay of ERF3 and WOX11 interaction. Roots of 10-d-old seedling of ERF3-FLAG transgenic plants and the wild type (WT) were immunoprecipitated (IP) using an anti-FLAG polyclonal antibody and immunoblotted (IB) using anti-FLAG or anti-WOX11 antibodies as indicated.
Figure Legend Snippet: ERF3 Directly Interacts with WOX11 in Vitro and in Vivo (A) Pull-down assay of ERF3 interaction with WOX11. Left, ERF3-GST fusion protein or GST alone were incubated with WOX11-His in His beads. ERF3-GST but not GST was pulled down by the beads containing WOX11-His. Right, WOX11-His and WOX3-His were incubated with EFR3-GST in GST beads. WOX11-His but not WOX3-His was pulled down by the beads containing ERF3-GST. (B) Interaction of ERF3 and WOX11 in rice protoplasts. Representative cells are shown, as imaged by confocal laser scanning microscopy. a, e, and i, Ghd7:CFP localization in the nucleus (blue fluorescence); b, detection in rice protoplasts of YN:WOX11 and ERF3:YC interaction, shown as yellow signal; f and j, as negative controls with YN:pVYNE(R)/pVYCE(R):YC and YN: pVYNE(R)/ERF3:YC; c, g, and k, bright field; d, h, and l, colocalization of three signals is indicated in merged images. Bars = 10 µm. (C) In vivo coimmunoprecipitation assay of ERF3 and WOX11 interaction. Roots of 10-d-old seedling of ERF3-FLAG transgenic plants and the wild type (WT) were immunoprecipitated (IP) using an anti-FLAG polyclonal antibody and immunoblotted (IB) using anti-FLAG or anti-WOX11 antibodies as indicated.

Techniques Used: In Vitro, In Vivo, Pull Down Assay, Incubation, Confocal Laser Scanning Microscopy, Fluorescence, Co-Immunoprecipitation Assay, Transgenic Assay, Immunoprecipitation

29) Product Images from "Wwp2-Mediated Ubiquitination of the RNA Polymerase II Large Subunit in Mouse Embryonic Pluripotent Stem Cells ▿"

Article Title: Wwp2-Mediated Ubiquitination of the RNA Polymerase II Large Subunit in Mouse Embryonic Pluripotent Stem Cells ▿

Journal:

doi: 10.1128/MCB.01667-06

Interacting regions between Wwp2 and Rpb1. (A) The ability of the Rpb1 CTD binds to Wwp2 was analyzed by GST pull-down assay (top panel). Bacterially expressed fusion proteins were stained with Coomassie blue (bottom panel). (B) The ability of various
Figure Legend Snippet: Interacting regions between Wwp2 and Rpb1. (A) The ability of the Rpb1 CTD binds to Wwp2 was analyzed by GST pull-down assay (top panel). Bacterially expressed fusion proteins were stained with Coomassie blue (bottom panel). (B) The ability of various

Techniques Used: Pull Down Assay, Staining

Identification and characterization of the interaction between Wwp2 and Rpb1. (A) Coomassie blue staining of an SDS-polyacrylamide gel electrophoresis gel containing the proteins from the indicated columns is shown. (B) GST pull-down assay to show that
Figure Legend Snippet: Identification and characterization of the interaction between Wwp2 and Rpb1. (A) Coomassie blue staining of an SDS-polyacrylamide gel electrophoresis gel containing the proteins from the indicated columns is shown. (B) GST pull-down assay to show that

Techniques Used: Staining, Polyacrylamide Gel Electrophoresis, Pull Down Assay

Wwp2 promotes degradation of Rpb1 through 26S proteasome. (A) Ubiquitinated GST-CTD catalyzed by Wwp2 can be degraded through 26S proteasome. (B) Knocking down Wwp2 expression elevates the steady-state protein level of Rpb1 in F9 cells. The Tc-inducible
Figure Legend Snippet: Wwp2 promotes degradation of Rpb1 through 26S proteasome. (A) Ubiquitinated GST-CTD catalyzed by Wwp2 can be degraded through 26S proteasome. (B) Knocking down Wwp2 expression elevates the steady-state protein level of Rpb1 in F9 cells. The Tc-inducible

Techniques Used: Expressing

30) Product Images from "Wnt signaling targets ETO coactivation domain of TAF4/TFIID in vivo"

Article Title: Wnt signaling targets ETO coactivation domain of TAF4/TFIID in vivo

Journal:

doi: 10.1073/pnas.0811914106

The ETO domain interacts with Pygopus in a GST pull-down experiment. ( A ) ( Left ) A schematic representation of the GST fusion protein used in the pull-down experiments. ( Right ) A Coomassie-stained gel loaded with protein molecular weight markers (M), GST,
Figure Legend Snippet: The ETO domain interacts with Pygopus in a GST pull-down experiment. ( A ) ( Left ) A schematic representation of the GST fusion protein used in the pull-down experiments. ( Right ) A Coomassie-stained gel loaded with protein molecular weight markers (M), GST,

Techniques Used: Staining, Molecular Weight

31) Product Images from "Y-box protein-associated acidic protein (YBAP1/C1QBP) affects the localization and cytoplasmic functions of YB-1"

Article Title: Y-box protein-associated acidic protein (YBAP1/C1QBP) affects the localization and cytoplasmic functions of YB-1

Journal: Scientific Reports

doi: 10.1038/s41598-018-24401-3

YBAP1 inhibits nuclear import of the YB-1 C2 region by transportin 1. ( a ) Permeabilized HeLa cells were incubated with 1.6 μM GST-GFP-YB-1-C2, 1.5 μM transportin 1, 4 μM Ran-GDP, and an ATP regeneration system in the presence of 0–3 μM YBAP1. Localization of GST-GFP-YB-1-C2 was examined by a fluorescence microscopy. ( b ) YB-1-His, GST-YBAP1 and GST were incubated with increasing amounts of FLAG-transportin 1. The mixture was subjected to GST-pulldown assays as described in Methods. The eluted proteins (lanes 8–14) and aliquots of the reaction mixture (input, lanes 1–7) were then analyzed by immunoblotting. ( c ) YB-1-His and FLAG-transportin 1 were incubated with increasing amounts of GST-YBAP1. The mixture was subjected to immunoprecipitation with anti-FLAG antibodies as described in Methods. The eluted proteins (lanes 7–12) and aliquots of the reaction mixture (input, lanes 1–6) were analyzed by immunoblotting.
Figure Legend Snippet: YBAP1 inhibits nuclear import of the YB-1 C2 region by transportin 1. ( a ) Permeabilized HeLa cells were incubated with 1.6 μM GST-GFP-YB-1-C2, 1.5 μM transportin 1, 4 μM Ran-GDP, and an ATP regeneration system in the presence of 0–3 μM YBAP1. Localization of GST-GFP-YB-1-C2 was examined by a fluorescence microscopy. ( b ) YB-1-His, GST-YBAP1 and GST were incubated with increasing amounts of FLAG-transportin 1. The mixture was subjected to GST-pulldown assays as described in Methods. The eluted proteins (lanes 8–14) and aliquots of the reaction mixture (input, lanes 1–7) were then analyzed by immunoblotting. ( c ) YB-1-His and FLAG-transportin 1 were incubated with increasing amounts of GST-YBAP1. The mixture was subjected to immunoprecipitation with anti-FLAG antibodies as described in Methods. The eluted proteins (lanes 7–12) and aliquots of the reaction mixture (input, lanes 1–6) were analyzed by immunoblotting.

Techniques Used: Incubation, Fluorescence, Microscopy, Immunoprecipitation

Transportin 1 is the nuclear import receptor for YB-1. ( a ) Nuclear localization of GST-GFP-YB-1-C2 was examined in a semi-intact cell system with HeLa cytosol. Digitonin-permeabilized HeLa cells were incubated with GST-GFP-YB-1-C2, HeLa cytosolic fraction, and an ATP regeneration system. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels). In some experiments, ATP regeneration system was omitted, and apyrase was included instead (middle row). ( b ) FLAG-Transportin 1 expression vector, pCMV-3xFLAG-TRN1 (lanes 2 and 4), or empty vector (lanes 1 and 3) was transfected into HeLa cells. Two days later, cell lysates were subjected to immunoprecipitation with anti-FLAG antibodies. Immunoprecipitates and input lysates were analyzed by immunoblotting with antibodies against YB-1 and FLAG. ( c ) Permeabilized HeLa cells were incubated with 2 μM GST-GFP-YB-1-C2 with 4 μM Ran-GDP and an ATP regeneration system in the absence (top row) or presence (bottom row) of 0.5 μM transportin 1. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels).
Figure Legend Snippet: Transportin 1 is the nuclear import receptor for YB-1. ( a ) Nuclear localization of GST-GFP-YB-1-C2 was examined in a semi-intact cell system with HeLa cytosol. Digitonin-permeabilized HeLa cells were incubated with GST-GFP-YB-1-C2, HeLa cytosolic fraction, and an ATP regeneration system. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels). In some experiments, ATP regeneration system was omitted, and apyrase was included instead (middle row). ( b ) FLAG-Transportin 1 expression vector, pCMV-3xFLAG-TRN1 (lanes 2 and 4), or empty vector (lanes 1 and 3) was transfected into HeLa cells. Two days later, cell lysates were subjected to immunoprecipitation with anti-FLAG antibodies. Immunoprecipitates and input lysates were analyzed by immunoblotting with antibodies against YB-1 and FLAG. ( c ) Permeabilized HeLa cells were incubated with 2 μM GST-GFP-YB-1-C2 with 4 μM Ran-GDP and an ATP regeneration system in the absence (top row) or presence (bottom row) of 0.5 μM transportin 1. Localization of GST-GFP-YB-1-C2 was examined by fluorescence microscopy (left panels). Phase-contrast images are also shown (right panels).

Techniques Used: Incubation, Fluorescence, Microscopy, Expressing, Plasmid Preparation, Transfection, Immunoprecipitation

YBAP1 interacts with the C1 and C2 regions of the YB-1 tail domain. ( a ) HeLa cell lysates were treated with (lanes 4 and 6) or without (lanes 3 and 5) RNase A, and subjected to immunoprecipitation with control rabbit IgG (lanes 3 and 4) or rabbit anti-YB-1 antibodies (lanes 5 and 6). Immunoprecipitates and cell lysates (10% of input, lanes 1; 2.5% of input, lane 2) were analyzed by immunoblotting with antibodies against YB-1, YBAP1, and PABP. ( b ) FLAG-tagged YB-1 and its fragments were synthesized in wheat germ extracts and incubated with GST (lanes 7, 9, 11, 13, 15, and 17) or GST-YBAP1 (lanes 8, 10, 12, 14, 16, and 18). Protein complexes were bound to glutathione–Sepharose, and the eluted materials together with the input extracts (lanes 1–6) were analyzed by immunoblotting with anti-FLAG antibodies. Schematic diagrams of the YB-1 fragments are shown at the bottom. +++ and −−− indicate basic and acidic/aromatic amino acid clusters, respectively.
Figure Legend Snippet: YBAP1 interacts with the C1 and C2 regions of the YB-1 tail domain. ( a ) HeLa cell lysates were treated with (lanes 4 and 6) or without (lanes 3 and 5) RNase A, and subjected to immunoprecipitation with control rabbit IgG (lanes 3 and 4) or rabbit anti-YB-1 antibodies (lanes 5 and 6). Immunoprecipitates and cell lysates (10% of input, lanes 1; 2.5% of input, lane 2) were analyzed by immunoblotting with antibodies against YB-1, YBAP1, and PABP. ( b ) FLAG-tagged YB-1 and its fragments were synthesized in wheat germ extracts and incubated with GST (lanes 7, 9, 11, 13, 15, and 17) or GST-YBAP1 (lanes 8, 10, 12, 14, 16, and 18). Protein complexes were bound to glutathione–Sepharose, and the eluted materials together with the input extracts (lanes 1–6) were analyzed by immunoblotting with anti-FLAG antibodies. Schematic diagrams of the YB-1 fragments are shown at the bottom. +++ and −−− indicate basic and acidic/aromatic amino acid clusters, respectively.

Techniques Used: Immunoprecipitation, Synthesized, Incubation

32) Product Images from "The COOH-terminal domain of huntingtin interacts with RhoGEF kalirin and modulates cell survival"

Article Title: The COOH-terminal domain of huntingtin interacts with RhoGEF kalirin and modulates cell survival

Journal: Scientific Reports

doi: 10.1038/s41598-018-26255-1

Mutant Htt compromises kalirin-enriched proteins from promoting nucleotide exchange on Rac1. ( a ) Stronger binding of kalirin to mutant Htt than to WT Htt. Triton X-100 solubilized brain endosomes prepared from WT (7Q) or HD140Q/140Q mouse brains were incubated with protein-G beads coupled with antibodies against aa2703-2911 of Htt. Precipitates were washed and analyzed by SDS-PAGE and Western blot with indicated antibodies. Of note, the detection of Htt signal in the lane identified as WT anti-FLAG was due to the leak-over of the WT anti-Htt-C sample from the adjacent lane. Shown is one blot analysis out of three experiments. ( b ) Kalirin-7 immunoprecipitated from mouse brain membranes was incubated with Htt precipitated from mouse brain cytosol (wild-type or HD140Q/140Q) at 4 ° C for 2 hrs and used for catalyzing [ 3 H]GDP release from GST-Rac1. Data are represented as mean percentage of released [ 3 H]GDP from GST-Rac1 (n = 3, Mean ± SD, Student t-test: * p
Figure Legend Snippet: Mutant Htt compromises kalirin-enriched proteins from promoting nucleotide exchange on Rac1. ( a ) Stronger binding of kalirin to mutant Htt than to WT Htt. Triton X-100 solubilized brain endosomes prepared from WT (7Q) or HD140Q/140Q mouse brains were incubated with protein-G beads coupled with antibodies against aa2703-2911 of Htt. Precipitates were washed and analyzed by SDS-PAGE and Western blot with indicated antibodies. Of note, the detection of Htt signal in the lane identified as WT anti-FLAG was due to the leak-over of the WT anti-Htt-C sample from the adjacent lane. Shown is one blot analysis out of three experiments. ( b ) Kalirin-7 immunoprecipitated from mouse brain membranes was incubated with Htt precipitated from mouse brain cytosol (wild-type or HD140Q/140Q) at 4 ° C for 2 hrs and used for catalyzing [ 3 H]GDP release from GST-Rac1. Data are represented as mean percentage of released [ 3 H]GDP from GST-Rac1 (n = 3, Mean ± SD, Student t-test: * p

Techniques Used: Mutagenesis, Binding Assay, Incubation, SDS Page, Western Blot, Immunoprecipitation

Kalirin interacts with Htt in brain membranes. ( a ) and ( b ) Kalirin and Htt are mutually co-precipitated. Mouse brain membranes as described in Method were solubilized in lysis buffer containing 1% Triton X-100 and centrifuged to discard unsolubilized membranes. The supernatant was incubated with antibodies against Htt-C (aa2703-2911 of Htt) 36 , ( a ) or aa1641-1654 of kalirin-7 ( b ). After washes, immunoprecipitates were eluted into sample buffer and analyzed by SDS-PAGE and Western blot with indicated antibodies. Shown are blot analyses from one of four experiments for both ( a ) and ( b ). ( c ) and ( d ) Interaction between Htt and kalirin is independent of HAP1. Triton X-100 solubilized mouse brain endosomes (lanes 1, 2, and 3) or mouse embryonic stem cell total membranes (lane-5) were used for immunoprecipitation with antibodies against aa181-810 of Htt (Htt-N, lanes 2 and 5) or aa2703-2911 of Htt (Htt-C, lane-3) or the FLAG tag (lane-4). For IgG control precipitation, solubilized endosomes and ES cell membranes were mixed and incubated together with anti-FLAG antibodies (lane-4). Precipitates were washed, eluted into SDS-PAGE sample buffer and analyzed by Western blot with antibodies against pan -kalirin, HAP1, or aa1-17 of Htt. The arrowhead labeled with IgG heavy chain indicates the 55 kD band present in the complex precipitated by anti-FLAG antibodies. We noticed that the majority of Htt proteins were cleaved during experimental procedures (Input, lane-1). This was not a surprise because it is well known that NH 2 Htt is prone to cleavage by proteases. This may be the reason why the antibody against Htt1-17 detected much weaker signals of full-length Htt in precipitates obtained with anti-Htt-C antibodies. ( d ) Triton X-100 solubilized cortical total membranes from HAP1 knockout (KO) and corresponding WT mouse embryos were incubated with antibodies specific for aa2703-2911 of Htt or kalirin7 or FLAG/GST (IgG controls). Precipitates were washed and analyzed by SDS-PAGE and Western blot with antibodies for detecting Htt and kalirin. Blots were first probed with anti-pan-kalirin to detect precipitated kalirin and then re-probed with anti-Htt1-17 to detect precipitated Htt.
Figure Legend Snippet: Kalirin interacts with Htt in brain membranes. ( a ) and ( b ) Kalirin and Htt are mutually co-precipitated. Mouse brain membranes as described in Method were solubilized in lysis buffer containing 1% Triton X-100 and centrifuged to discard unsolubilized membranes. The supernatant was incubated with antibodies against Htt-C (aa2703-2911 of Htt) 36 , ( a ) or aa1641-1654 of kalirin-7 ( b ). After washes, immunoprecipitates were eluted into sample buffer and analyzed by SDS-PAGE and Western blot with indicated antibodies. Shown are blot analyses from one of four experiments for both ( a ) and ( b ). ( c ) and ( d ) Interaction between Htt and kalirin is independent of HAP1. Triton X-100 solubilized mouse brain endosomes (lanes 1, 2, and 3) or mouse embryonic stem cell total membranes (lane-5) were used for immunoprecipitation with antibodies against aa181-810 of Htt (Htt-N, lanes 2 and 5) or aa2703-2911 of Htt (Htt-C, lane-3) or the FLAG tag (lane-4). For IgG control precipitation, solubilized endosomes and ES cell membranes were mixed and incubated together with anti-FLAG antibodies (lane-4). Precipitates were washed, eluted into SDS-PAGE sample buffer and analyzed by Western blot with antibodies against pan -kalirin, HAP1, or aa1-17 of Htt. The arrowhead labeled with IgG heavy chain indicates the 55 kD band present in the complex precipitated by anti-FLAG antibodies. We noticed that the majority of Htt proteins were cleaved during experimental procedures (Input, lane-1). This was not a surprise because it is well known that NH 2 Htt is prone to cleavage by proteases. This may be the reason why the antibody against Htt1-17 detected much weaker signals of full-length Htt in precipitates obtained with anti-Htt-C antibodies. ( d ) Triton X-100 solubilized cortical total membranes from HAP1 knockout (KO) and corresponding WT mouse embryos were incubated with antibodies specific for aa2703-2911 of Htt or kalirin7 or FLAG/GST (IgG controls). Precipitates were washed and analyzed by SDS-PAGE and Western blot with antibodies for detecting Htt and kalirin. Blots were first probed with anti-pan-kalirin to detect precipitated kalirin and then re-probed with anti-Htt1-17 to detect precipitated Htt.

Techniques Used: Lysis, Incubation, SDS Page, Western Blot, Immunoprecipitation, FLAG-tag, Labeling, Knock-Out

33) Product Images from "The mRNP remodeling mediated by UPF1 promotes rapid degradation of replication-dependent histone mRNA"

Article Title: The mRNP remodeling mediated by UPF1 promotes rapid degradation of replication-dependent histone mRNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku610

UPF1 competes with CTIF for binding to SLBP. ( A ) HeLa cells were depleted of either CTIF or UPF1 using specific siRNA and then re-transfected with plasmid expressing FLAG-SLBP. Total-cell extracts were analyzed either before or after IP using α-FLAG-conjugated agarose beads. The levels of co-immunopurified cellular UPF1 and CTIF were normalized to the levels of immunopurified FLAG-SLBP. The normalized levels obtained from the IP of FLAG-SLBP in the presence of Control siRNA were set to 1. ( B ) HeLa cells were transiently transfected with the equivalent amount of plasmid expressing FLAG-SLBP and gradually increasing amounts of plasmid expressing either Myc-UPF1-WT or -HP. Total-cell extracts were subjected to IP using α-FLAG-conjugated agarose beads. ( C ) In vitro competition assay results. E. coli lysates that express GST or GST-SLBP (1–127) were mixed with His-UPF1(295–914) in the presence of gradually increasing amounts of purified His-CTIF (365–598). Purified recombinant bRIP1 (ribosome-inactivating protein 1 from barley seeds), which served as a negative control, was added to the reactions to ensure addition of equal amounts of total protein. After GST pull-down, the purified proteins were analyzed by western blotting (WB) using α-GST antibody (upper) or α-6xHis antibody (lower). The locations of molecular weight (MW) markers are indicated on the left. Asterisk indicates nonspecific bands or degradation products of GST-SLBP (1–127). Each panel of results is representative of at least two independently performed experiments.
Figure Legend Snippet: UPF1 competes with CTIF for binding to SLBP. ( A ) HeLa cells were depleted of either CTIF or UPF1 using specific siRNA and then re-transfected with plasmid expressing FLAG-SLBP. Total-cell extracts were analyzed either before or after IP using α-FLAG-conjugated agarose beads. The levels of co-immunopurified cellular UPF1 and CTIF were normalized to the levels of immunopurified FLAG-SLBP. The normalized levels obtained from the IP of FLAG-SLBP in the presence of Control siRNA were set to 1. ( B ) HeLa cells were transiently transfected with the equivalent amount of plasmid expressing FLAG-SLBP and gradually increasing amounts of plasmid expressing either Myc-UPF1-WT or -HP. Total-cell extracts were subjected to IP using α-FLAG-conjugated agarose beads. ( C ) In vitro competition assay results. E. coli lysates that express GST or GST-SLBP (1–127) were mixed with His-UPF1(295–914) in the presence of gradually increasing amounts of purified His-CTIF (365–598). Purified recombinant bRIP1 (ribosome-inactivating protein 1 from barley seeds), which served as a negative control, was added to the reactions to ensure addition of equal amounts of total protein. After GST pull-down, the purified proteins were analyzed by western blotting (WB) using α-GST antibody (upper) or α-6xHis antibody (lower). The locations of molecular weight (MW) markers are indicated on the left. Asterisk indicates nonspecific bands or degradation products of GST-SLBP (1–127). Each panel of results is representative of at least two independently performed experiments.

Techniques Used: Binding Assay, Transfection, Plasmid Preparation, Expressing, In Vitro, Competitive Binding Assay, Purification, Recombinant, Negative Control, Western Blot, Molecular Weight

34) Product Images from "Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity"

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity

Journal: BMC Biochemistry

doi: 10.1186/1471-2091-10-34

Surface plasmon resonance analysis of the binding of proteins to endonuclein . Endonuclein was immobilized to a sensor chip and the on and off rates for ligand binding were recorded on a BIAcore 2000. The recorded sensorgrams show binding of 1 μM of pregnancy specific β-1 glycoprotein, 5 μM recombinant TIP-1 as fusion peptide with glutathion S-transferase (GST-TIP-1), 1 μM BiP and 1 μM of pure glutathion S-transferase (GST) as a control. Interaction with endonuclein was verified with all proteins except GST which revealed no detectable binding.
Figure Legend Snippet: Surface plasmon resonance analysis of the binding of proteins to endonuclein . Endonuclein was immobilized to a sensor chip and the on and off rates for ligand binding were recorded on a BIAcore 2000. The recorded sensorgrams show binding of 1 μM of pregnancy specific β-1 glycoprotein, 5 μM recombinant TIP-1 as fusion peptide with glutathion S-transferase (GST-TIP-1), 1 μM BiP and 1 μM of pure glutathion S-transferase (GST) as a control. Interaction with endonuclein was verified with all proteins except GST which revealed no detectable binding.

Techniques Used: SPR Assay, Binding Assay, Chromatin Immunoprecipitation, Ligand Binding Assay, Recombinant

35) Product Images from "Adenovirus E1A Inhibits SCFFbw7 Ubiquitin Ligase *"

Article Title: Adenovirus E1A Inhibits SCFFbw7 Ubiquitin Ligase *

Journal:

doi: 10.1074/jbc.M109.006809

E1A inhibits Roc1/Rbx1-CUL1-dependent elongation reaction of ubiquitin chains. A , effect of E1A on the elongation of ubiquitin chains by the Roc1/Rbx1-CUL1 complex in vitro . Bacterially coexpressed and purified GST-fused full-length Roc1/Rbx1 and FLAG-tagged
Figure Legend Snippet: E1A inhibits Roc1/Rbx1-CUL1-dependent elongation reaction of ubiquitin chains. A , effect of E1A on the elongation of ubiquitin chains by the Roc1/Rbx1-CUL1 complex in vitro . Bacterially coexpressed and purified GST-fused full-length Roc1/Rbx1 and FLAG-tagged

Techniques Used: In Vitro, Purification

36) Product Images from "Characterization of the novel interaction between muskelin and TBX20, a critical cardiogenic transcription factor"

Article Title: Characterization of the novel interaction between muskelin and TBX20, a critical cardiogenic transcription factor

Journal: Biochemical and biophysical research communications

doi: 10.1016/j.bbrc.2011.05.020

Identification of the interaction domains of TBX20b and MKLN1 (A) Top: Schematic of TBX20 isoforms. Bottom: COSM6 cells were transfected with HA-MKLN1 and GST, GST-TBX20a, GST-TBX20b, and truncations of GST-TBX20b. Copurification assays and western blot analyses compared whole cell lysate (WCL) and the elution fraction (EF). The blots were probed with GST and HA1.1 antibodies as before. (B) Top: Schematic of MKLN1 protein. Bottom: Similar copurification analyses were performed with truncated HA-tagged MKLN1 constructs. Gels were loaded as in panel (A) comparing WCL and EF with the GST and the GST-TBX20b transfected cells. Western blot analysis of the truncated HA-MKLN1 constructs (top-to-bottom) are listed left-to-right.
Figure Legend Snippet: Identification of the interaction domains of TBX20b and MKLN1 (A) Top: Schematic of TBX20 isoforms. Bottom: COSM6 cells were transfected with HA-MKLN1 and GST, GST-TBX20a, GST-TBX20b, and truncations of GST-TBX20b. Copurification assays and western blot analyses compared whole cell lysate (WCL) and the elution fraction (EF). The blots were probed with GST and HA1.1 antibodies as before. (B) Top: Schematic of MKLN1 protein. Bottom: Similar copurification analyses were performed with truncated HA-tagged MKLN1 constructs. Gels were loaded as in panel (A) comparing WCL and EF with the GST and the GST-TBX20b transfected cells. Western blot analysis of the truncated HA-MKLN1 constructs (top-to-bottom) are listed left-to-right.

Techniques Used: Transfection, Copurification, Western Blot, Construct

Identification of MKLN1 as a novel interacting partner to TBX20b (A) AH109 yeast cells were cotransformed with pGBTK-T7 and pGAD-T7 vector controls, pGBTK-TBX20b with the pGAD-T7 control, pGAD-MKLN1 with the pGBTK-T7 control, and pGBTK-TBX20b with pGAD-MKLN1. Each cotransformation was replated as a patch on a Trp/Leu plate, and replica-plated onto a Q plate. Growth with pGBTK-TBX20b and pGAD-MKLN1 indicates protein interaction. (B) GST and GST-TBX20b proteins were isolated from bacterial lysates and copurified with in vitro radiolabeled MKLN1. The bottom panel shows the coomassie-stained SDS-PAGE gel with radioactive MKLN1 input (lane 1), and the GST-pulldown elution fractions of GST (lane 2) and GST-TBX20 (lane 3). The top panel is the radiography film revealing presence of MKLN1. (C) COSM6 cells were transfected with HA-MKLN1 and GST or GST-TBX20b as indicated. Interacting proteins were isolated by copurification. Whole cell lysate (WCL) and elution fractions (EF) were analyzed by SDS-PAGE and western blot analysis probing for GST and HA1.1.
Figure Legend Snippet: Identification of MKLN1 as a novel interacting partner to TBX20b (A) AH109 yeast cells were cotransformed with pGBTK-T7 and pGAD-T7 vector controls, pGBTK-TBX20b with the pGAD-T7 control, pGAD-MKLN1 with the pGBTK-T7 control, and pGBTK-TBX20b with pGAD-MKLN1. Each cotransformation was replated as a patch on a Trp/Leu plate, and replica-plated onto a Q plate. Growth with pGBTK-TBX20b and pGAD-MKLN1 indicates protein interaction. (B) GST and GST-TBX20b proteins were isolated from bacterial lysates and copurified with in vitro radiolabeled MKLN1. The bottom panel shows the coomassie-stained SDS-PAGE gel with radioactive MKLN1 input (lane 1), and the GST-pulldown elution fractions of GST (lane 2) and GST-TBX20 (lane 3). The top panel is the radiography film revealing presence of MKLN1. (C) COSM6 cells were transfected with HA-MKLN1 and GST or GST-TBX20b as indicated. Interacting proteins were isolated by copurification. Whole cell lysate (WCL) and elution fractions (EF) were analyzed by SDS-PAGE and western blot analysis probing for GST and HA1.1.

Techniques Used: Plasmid Preparation, Isolation, In Vitro, Staining, SDS Page, Transfection, Copurification, Western Blot

37) Product Images from "Plk Phosphorylation Regulates the Microtubule-Stabilizing Protein TCTP"

Article Title: Plk Phosphorylation Regulates the Microtubule-Stabilizing Protein TCTP

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.22.17.6209-6221.2002

In vitro binding of HA-Plk to GST-TCTP. Lysates from baculovirus-infected Sf9 cells expressing HA-Plk were used in a pull-down assay with either GST or GST-TCTP prebound to glutathione (GSH)-agarose beads. HA-Plk and GST/GST-TCTP were detected by Western immunoblotting with anti-HA monoclonal and anti-GST polyclonal antibodies, respectively.
Figure Legend Snippet: In vitro binding of HA-Plk to GST-TCTP. Lysates from baculovirus-infected Sf9 cells expressing HA-Plk were used in a pull-down assay with either GST or GST-TCTP prebound to glutathione (GSH)-agarose beads. HA-Plk and GST/GST-TCTP were detected by Western immunoblotting with anti-HA monoclonal and anti-GST polyclonal antibodies, respectively.

Techniques Used: In Vitro, Binding Assay, Infection, Expressing, Pull Down Assay, Western Blot

38) Product Images from "The COOH-terminal domain of huntingtin interacts with RhoGEF kalirin and modulates cell survival"

Article Title: The COOH-terminal domain of huntingtin interacts with RhoGEF kalirin and modulates cell survival

Journal: Scientific Reports

doi: 10.1038/s41598-018-26255-1

Mutant Htt compromises kalirin-enriched proteins from promoting nucleotide exchange on Rac1. ( a ) Stronger binding of kalirin to mutant Htt than to WT Htt. Triton X-100 solubilized brain endosomes prepared from WT (7Q) or HD140Q/140Q mouse brains were incubated with protein-G beads coupled with antibodies against aa2703-2911 of Htt. Precipitates were washed and analyzed by SDS-PAGE and Western blot with indicated antibodies. Of note, the detection of Htt signal in the lane identified as WT anti-FLAG was due to the leak-over of the WT anti-Htt-C sample from the adjacent lane. Shown is one blot analysis out of three experiments. ( b ) Kalirin-7 immunoprecipitated from mouse brain membranes was incubated with Htt precipitated from mouse brain cytosol (wild-type or HD140Q/140Q) at 4 ° C for 2 hrs and used for catalyzing [ 3 H]GDP release from GST-Rac1. Data are represented as mean percentage of released [ 3 H]GDP from GST-Rac1 (n = 3, Mean ± SD, Student t-test: * p
Figure Legend Snippet: Mutant Htt compromises kalirin-enriched proteins from promoting nucleotide exchange on Rac1. ( a ) Stronger binding of kalirin to mutant Htt than to WT Htt. Triton X-100 solubilized brain endosomes prepared from WT (7Q) or HD140Q/140Q mouse brains were incubated with protein-G beads coupled with antibodies against aa2703-2911 of Htt. Precipitates were washed and analyzed by SDS-PAGE and Western blot with indicated antibodies. Of note, the detection of Htt signal in the lane identified as WT anti-FLAG was due to the leak-over of the WT anti-Htt-C sample from the adjacent lane. Shown is one blot analysis out of three experiments. ( b ) Kalirin-7 immunoprecipitated from mouse brain membranes was incubated with Htt precipitated from mouse brain cytosol (wild-type or HD140Q/140Q) at 4 ° C for 2 hrs and used for catalyzing [ 3 H]GDP release from GST-Rac1. Data are represented as mean percentage of released [ 3 H]GDP from GST-Rac1 (n = 3, Mean ± SD, Student t-test: * p

Techniques Used: Mutagenesis, Binding Assay, Incubation, SDS Page, Western Blot, Immunoprecipitation

Kalirin interacts with Htt in brain membranes. ( a ) and ( b , ( a ) or aa1641-1654 of kalirin-7 ( b ). After washes, immunoprecipitates were eluted into sample buffer and analyzed by SDS-PAGE and Western blot with indicated antibodies. Shown are blot analyses from one of four experiments for both ( a ) and ( b ). ( c ) and ( d ) Interaction between Htt and kalirin is independent of HAP1. Triton X-100 solubilized mouse brain endosomes (lanes 1, 2, and 3) or mouse embryonic stem cell total membranes (lane-5) were used for immunoprecipitation with antibodies against aa181-810 of Htt (Htt-N, lanes 2 and 5) or aa2703-2911 of Htt (Htt-C, lane-3) or the FLAG tag (lane-4). For IgG control precipitation, solubilized endosomes and ES cell membranes were mixed and incubated together with anti-FLAG antibodies (lane-4). Precipitates were washed, eluted into SDS-PAGE sample buffer and analyzed by Western blot with antibodies against pan -kalirin, HAP1, or aa1-17 of Htt. The arrowhead labeled with IgG heavy chain indicates the 55 kD band present in the complex precipitated by anti-FLAG antibodies. We noticed that the majority of Htt proteins were cleaved during experimental procedures (Input, lane-1). This was not a surprise because it is well known that NH 2 Htt is prone to cleavage by proteases. This may be the reason why the antibody against Htt1-17 detected much weaker signals of full-length Htt in precipitates obtained with anti-Htt-C antibodies. ( d ) Triton X-100 solubilized cortical total membranes from HAP1 knockout (KO) and corresponding WT mouse embryos were incubated with antibodies specific for aa2703-2911 of Htt or kalirin7 or FLAG/GST (IgG controls). Precipitates were washed and analyzed by SDS-PAGE and Western blot with antibodies for detecting Htt and kalirin. Blots were first probed with anti-pan-kalirin to detect precipitated kalirin and then re-probed with anti-Htt1-17 to detect precipitated Htt.
Figure Legend Snippet: Kalirin interacts with Htt in brain membranes. ( a ) and ( b , ( a ) or aa1641-1654 of kalirin-7 ( b ). After washes, immunoprecipitates were eluted into sample buffer and analyzed by SDS-PAGE and Western blot with indicated antibodies. Shown are blot analyses from one of four experiments for both ( a ) and ( b ). ( c ) and ( d ) Interaction between Htt and kalirin is independent of HAP1. Triton X-100 solubilized mouse brain endosomes (lanes 1, 2, and 3) or mouse embryonic stem cell total membranes (lane-5) were used for immunoprecipitation with antibodies against aa181-810 of Htt (Htt-N, lanes 2 and 5) or aa2703-2911 of Htt (Htt-C, lane-3) or the FLAG tag (lane-4). For IgG control precipitation, solubilized endosomes and ES cell membranes were mixed and incubated together with anti-FLAG antibodies (lane-4). Precipitates were washed, eluted into SDS-PAGE sample buffer and analyzed by Western blot with antibodies against pan -kalirin, HAP1, or aa1-17 of Htt. The arrowhead labeled with IgG heavy chain indicates the 55 kD band present in the complex precipitated by anti-FLAG antibodies. We noticed that the majority of Htt proteins were cleaved during experimental procedures (Input, lane-1). This was not a surprise because it is well known that NH 2 Htt is prone to cleavage by proteases. This may be the reason why the antibody against Htt1-17 detected much weaker signals of full-length Htt in precipitates obtained with anti-Htt-C antibodies. ( d ) Triton X-100 solubilized cortical total membranes from HAP1 knockout (KO) and corresponding WT mouse embryos were incubated with antibodies specific for aa2703-2911 of Htt or kalirin7 or FLAG/GST (IgG controls). Precipitates were washed and analyzed by SDS-PAGE and Western blot with antibodies for detecting Htt and kalirin. Blots were first probed with anti-pan-kalirin to detect precipitated kalirin and then re-probed with anti-Htt1-17 to detect precipitated Htt.

Techniques Used: SDS Page, Western Blot, Immunoprecipitation, FLAG-tag, Incubation, Labeling, Knock-Out

39) Product Images from "Reconstitution of Nuclear Import in Permeabilized Cells"

Article Title: Reconstitution of Nuclear Import in Permeabilized Cells

Journal:

doi: 10.1007/978-1-60327-461-6_11

Titration of recombinant factors to optimize nuclear import in digitonin-permeabilized NRK cells. The nuclear import assays were performed with reactions reconstituted with recombinant transport factors and cargoes. GST-IBB and GST-M9 were detected with
Figure Legend Snippet: Titration of recombinant factors to optimize nuclear import in digitonin-permeabilized NRK cells. The nuclear import assays were performed with reactions reconstituted with recombinant transport factors and cargoes. GST-IBB and GST-M9 were detected with

Techniques Used: Titration, Recombinant

Titration of recombinant factors to optimize nuclear import in digitonin-permeabilized NRK cells. The nuclear import assays were performed with reactions reconstituted with recombinant transport factors and cargoes. GST-IBB and GST-M9 were detected with
Figure Legend Snippet: Titration of recombinant factors to optimize nuclear import in digitonin-permeabilized NRK cells. The nuclear import assays were performed with reactions reconstituted with recombinant transport factors and cargoes. GST-IBB and GST-M9 were detected with

Techniques Used: Titration, Recombinant

40) Product Images from "Association of Csk to VE-cadherin and inhibition of cell proliferation"

Article Title: Association of Csk to VE-cadherin and inhibition of cell proliferation

Journal:

doi: 10.1038/sj.emboj.7600647

In vitro -translated Csk can be precipitated with a GST-VE-cadherin fusion protein. Either the Csk57–204 fragment identified in the yeast two-hybrid screen ( A ) or full-length Csk (Csk-wt) ( B ) was synthesized in a coupled in vitro transcription/translation
Figure Legend Snippet: In vitro -translated Csk can be precipitated with a GST-VE-cadherin fusion protein. Either the Csk57–204 fragment identified in the yeast two-hybrid screen ( A ) or full-length Csk (Csk-wt) ( B ) was synthesized in a coupled in vitro transcription/translation

Techniques Used: In Vitro, Two Hybrid Screening, Synthesized

41) Product Images from "Emerin Is Hyperphosphorylated and Redistributed in Herpes Simplex Virus Type 1-Infected Cells in a Manner Dependent on both UL34 and US3 ▿"

Article Title: Emerin Is Hyperphosphorylated and Redistributed in Herpes Simplex Virus Type 1-Infected Cells in a Manner Dependent on both UL34 and US3 ▿

Journal:

doi: 10.1128/JVI.00196-07

Interaction between emerin and pUL34. (A) Spyro Ruby-stained SDS-polyacrylamide gel of pUL34-GST pull down. GST (lane 2) or a fusion protein containing full-length pUL34 fused to GST was purified by affinity chromatography on glutathione-Sepharose beads
Figure Legend Snippet: Interaction between emerin and pUL34. (A) Spyro Ruby-stained SDS-polyacrylamide gel of pUL34-GST pull down. GST (lane 2) or a fusion protein containing full-length pUL34 fused to GST was purified by affinity chromatography on glutathione-Sepharose beads

Techniques Used: Staining, Purification, Affinity Chromatography

42) Product Images from "GTSE1 Is a Microtubule Plus-End Tracking Protein That Regulates EB1-Dependent Cell Migration"

Article Title: GTSE1 Is a Microtubule Plus-End Tracking Protein That Regulates EB1-Dependent Cell Migration

Journal: PLoS ONE

doi: 10.1371/journal.pone.0051259

GTSE1 is recruited to microtubule plus ends through short EB1-interaction motifs. (A) Sequence alignment of hGTSE1 amino acids 503–538 that contain tandem conserved SKIP-like motifs. The first four rows contain GTSE1 homologs from human (hs), mouse (mm), Xenopus (xl) and zebrafish (dr). The last three rows show conserved regions from other human +TIPs. SKIP-like motifs are highlighted in green boxes. Conserved TP motifs are highlighted in grey boxes. Basic residues are colored red, serines and threonines are colored blue. (B) GTSE1 immunoprecipitates EB1 in U2OS cells. U2OS cell lysates were immunoprecipitated with anti-GTSE1 antibody, or anti-GFP as a control. Input lysate and immunoprecipitated fractions were run by SDS-PAGE and Western blotted with either anti-GTSE1 or anti-EB1 antibody. (C) In vitro pull-down binding assay using purified GST or GST-EB1 fusion proteins incubated with in vitro translated 35 S-labeled GTSE1 WT (hGTSE1 WT IVT) or GTSE1 mutated at the SKIP motifs (L511N P512N L522N P523N) (GTSE1 Sk IVT). Inputs represent 20% of IVTs used for pull-down assays. The top gel shows IVT GTSE1 by autoradiograph, bottom gels are commassie stained. GST-EB1 interacts with in vitro translated GTSE1, but not GTSE1 mutated at SKIP motifs. (D) Still images of live clonal U2OS cells expressing wild type GTSE1-GFP (GTSE1 WT 204 ) or GTSE1-GFP mutated at the SKIP motifs (L511N P512N L522N P523N) (GTSE1 Sk 202 )( Movie S4 ). Similar to EB1 depletion, the mutated GTSE1-GFP does not track growing microtubule tips, but localizes to the microtubule lattice. All scale bars represent 10 microns.
Figure Legend Snippet: GTSE1 is recruited to microtubule plus ends through short EB1-interaction motifs. (A) Sequence alignment of hGTSE1 amino acids 503–538 that contain tandem conserved SKIP-like motifs. The first four rows contain GTSE1 homologs from human (hs), mouse (mm), Xenopus (xl) and zebrafish (dr). The last three rows show conserved regions from other human +TIPs. SKIP-like motifs are highlighted in green boxes. Conserved TP motifs are highlighted in grey boxes. Basic residues are colored red, serines and threonines are colored blue. (B) GTSE1 immunoprecipitates EB1 in U2OS cells. U2OS cell lysates were immunoprecipitated with anti-GTSE1 antibody, or anti-GFP as a control. Input lysate and immunoprecipitated fractions were run by SDS-PAGE and Western blotted with either anti-GTSE1 or anti-EB1 antibody. (C) In vitro pull-down binding assay using purified GST or GST-EB1 fusion proteins incubated with in vitro translated 35 S-labeled GTSE1 WT (hGTSE1 WT IVT) or GTSE1 mutated at the SKIP motifs (L511N P512N L522N P523N) (GTSE1 Sk IVT). Inputs represent 20% of IVTs used for pull-down assays. The top gel shows IVT GTSE1 by autoradiograph, bottom gels are commassie stained. GST-EB1 interacts with in vitro translated GTSE1, but not GTSE1 mutated at SKIP motifs. (D) Still images of live clonal U2OS cells expressing wild type GTSE1-GFP (GTSE1 WT 204 ) or GTSE1-GFP mutated at the SKIP motifs (L511N P512N L522N P523N) (GTSE1 Sk 202 )( Movie S4 ). Similar to EB1 depletion, the mutated GTSE1-GFP does not track growing microtubule tips, but localizes to the microtubule lattice. All scale bars represent 10 microns.

Techniques Used: Sequencing, Immunoprecipitation, SDS Page, Western Blot, In Vitro, Binding Assay, Purification, Incubation, Labeling, Autoradiography, Staining, Expressing

43) Product Images from "Kank attenuates actin remodeling by preventing interaction between IRSp53 and Rac1"

Article Title: Kank attenuates actin remodeling by preventing interaction between IRSp53 and Rac1

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200805147

Kank regulates the binding between IRSp53 and active Rac1. (A) Inhibition of binding in vitro of Rac1 (for the top Western blots) or cdc42 (for the bottom Western blots) with IRSp53 by Kank. Binding between GST-IRSp53(N) (lanes 3–8) or control GST (lane 1) and His-Rac1 G12V or His-cdc42 G12V (lanes 2–8) was examined in the presence of MBP-Kank coil (increasing concentrations; lanes 6–8). His-Rac1 G12V (top) and His-cdc42 G12V (bottom) used for the experiments in lanes 2–8 are shown in the last lane (shown as Input). (B) Quantified data of Rac1 and cdc42 bands. The intensity of the bands of Rac1 and cdc42 in A was quantified, and the mean ± SD of three Western blots for each band is shown. Band intensities are measured in arbitrary units. (C) Increased binding between IRSp53 and active Rac1 in vivo on KD of Kank. Lysates from HEK293 cells stably expressing Rac1 G12V were used for immunoprecipitation (IP) with normal IgG as a negative control (lane 1) or with α-IRSp53 (against the C terminus) after transfection with control esiRNA (lane 2) or with Kank esiRNA (lanes 3 and 4, duplicated). Pull down with GST-PAK1 CRIB , a cdc42/Rac1-binding domain of PAK1 fused to GST, was used for detecting active Rac1 (lane 5). Western blots of individual proteins are shown. Immunoprecipitated Rac1 and IRSp53 were quantified, and the relative amount of coimmunoprecipitated Rac1 was calculated as the ratio of the intensity of Rac1 to that of corresponding immunoprecipitated IRSp53 and is shown under the image of anti-Rac1 antibody. Black lines indicate that intervening lanes have been spliced out. WB, Western blot.
Figure Legend Snippet: Kank regulates the binding between IRSp53 and active Rac1. (A) Inhibition of binding in vitro of Rac1 (for the top Western blots) or cdc42 (for the bottom Western blots) with IRSp53 by Kank. Binding between GST-IRSp53(N) (lanes 3–8) or control GST (lane 1) and His-Rac1 G12V or His-cdc42 G12V (lanes 2–8) was examined in the presence of MBP-Kank coil (increasing concentrations; lanes 6–8). His-Rac1 G12V (top) and His-cdc42 G12V (bottom) used for the experiments in lanes 2–8 are shown in the last lane (shown as Input). (B) Quantified data of Rac1 and cdc42 bands. The intensity of the bands of Rac1 and cdc42 in A was quantified, and the mean ± SD of three Western blots for each band is shown. Band intensities are measured in arbitrary units. (C) Increased binding between IRSp53 and active Rac1 in vivo on KD of Kank. Lysates from HEK293 cells stably expressing Rac1 G12V were used for immunoprecipitation (IP) with normal IgG as a negative control (lane 1) or with α-IRSp53 (against the C terminus) after transfection with control esiRNA (lane 2) or with Kank esiRNA (lanes 3 and 4, duplicated). Pull down with GST-PAK1 CRIB , a cdc42/Rac1-binding domain of PAK1 fused to GST, was used for detecting active Rac1 (lane 5). Western blots of individual proteins are shown. Immunoprecipitated Rac1 and IRSp53 were quantified, and the relative amount of coimmunoprecipitated Rac1 was calculated as the ratio of the intensity of Rac1 to that of corresponding immunoprecipitated IRSp53 and is shown under the image of anti-Rac1 antibody. Black lines indicate that intervening lanes have been spliced out. WB, Western blot.

Techniques Used: Binding Assay, Inhibition, In Vitro, Western Blot, In Vivo, Stable Transfection, Expressing, Immunoprecipitation, Negative Control, Transfection, esiRNA

44) Product Images from "Linking axonal degeneration to microtubule remodeling by Spastin-mediated microtubule severing"

Article Title: Linking axonal degeneration to microtubule remodeling by Spastin-mediated microtubule severing

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200409058

Spastin is sufficient for severing MTs. Taxol-stabilized MTs were assembled from purified tubulin GTP and taxol and incubated with recombinant Spastin and nucleotides as indicated in the figure. After 10 min at 37°C, microtubules were separated from tubulin dimer by ultracentrifugation. In the absence of ATP, WT GST-Spastin sediments with microtubules (lanes 1 and 9), indicating direct binding. In contrast, with ATP, most of the tubulin was recovered in the supernatant fraction (lane 4), indicating that severing occurred. Note that Spastin does not sediment nonspecifically (lane 4). E442Q and K388A mutant Spastin sediment with microtubules but do not sever even in the presence of ATP (lanes 5 and 7). These results suggest that ATP hydrolysis is required for severing. Neither AMP-PNP nor ADP could substitute for ATP (lanes 11 and 13). The two panels represent separate experiments. (top gel) White line indicates that intervening lanes have been spliced out. Quantitation of the data from the gels is shown in the bar graph.
Figure Legend Snippet: Spastin is sufficient for severing MTs. Taxol-stabilized MTs were assembled from purified tubulin GTP and taxol and incubated with recombinant Spastin and nucleotides as indicated in the figure. After 10 min at 37°C, microtubules were separated from tubulin dimer by ultracentrifugation. In the absence of ATP, WT GST-Spastin sediments with microtubules (lanes 1 and 9), indicating direct binding. In contrast, with ATP, most of the tubulin was recovered in the supernatant fraction (lane 4), indicating that severing occurred. Note that Spastin does not sediment nonspecifically (lane 4). E442Q and K388A mutant Spastin sediment with microtubules but do not sever even in the presence of ATP (lanes 5 and 7). These results suggest that ATP hydrolysis is required for severing. Neither AMP-PNP nor ADP could substitute for ATP (lanes 11 and 13). The two panels represent separate experiments. (top gel) White line indicates that intervening lanes have been spliced out. Quantitation of the data from the gels is shown in the bar graph.

Techniques Used: Purification, Incubation, Recombinant, Binding Assay, Mutagenesis, Quantitation Assay

45) Product Images from "Scaffold protein FHL2 facilitates MDM2-mediated degradation of IER3 to regulate proliferation of cervical cancer cells"

Article Title: Scaffold protein FHL2 facilitates MDM2-mediated degradation of IER3 to regulate proliferation of cervical cancer cells

Journal: Oncogene

doi: 10.1038/onc.2016.54

Identification of IER3 lysine 60 as the ubiquitin acceptor site. ( a ) The alignment of amino-acid sequences of mammalian IER3 proteins encompassing two lysines, K60 and K84 (red), is shown. ( b ) The stability of the GST-tagged IER3 wild-type (WT) and substitution mutants was determined after transfection of HeLa cells with the respective plasmids. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h, and cell lysates were analyzed by western blot analysis. ( c , d ) Changes in the protein stability of IER3 WT and mutants in response to FHL2 knockdown ( c ) or overexpression ( d ) were assessed by western blot analysis. A green fluorescent protein (GFP)-expressing plasmid was included as an inner control of transfection efficiency. ( e ) An in vivo ubiquitination assay was performed after transfection of HeLa cells with the indicated plasmids followed by immunoprecipitation.
Figure Legend Snippet: Identification of IER3 lysine 60 as the ubiquitin acceptor site. ( a ) The alignment of amino-acid sequences of mammalian IER3 proteins encompassing two lysines, K60 and K84 (red), is shown. ( b ) The stability of the GST-tagged IER3 wild-type (WT) and substitution mutants was determined after transfection of HeLa cells with the respective plasmids. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h, and cell lysates were analyzed by western blot analysis. ( c , d ) Changes in the protein stability of IER3 WT and mutants in response to FHL2 knockdown ( c ) or overexpression ( d ) were assessed by western blot analysis. A green fluorescent protein (GFP)-expressing plasmid was included as an inner control of transfection efficiency. ( e ) An in vivo ubiquitination assay was performed after transfection of HeLa cells with the indicated plasmids followed by immunoprecipitation.

Techniques Used: Transfection, Incubation, Western Blot, Over Expression, Expressing, Plasmid Preparation, In Vivo, Ubiquitin Assay, Immunoprecipitation

Identification of MDM2 as the E3 ubiquitin ligase for IER3. ( a ) The interaction of IER3 with different E3 ubiquitin ligases was determined by immunoprecipitation (IP) in HeLa cells. The arrows indicate the expected positions of the proteins. ( b ) In vitro , a direct interaction between IER3 and MDM2 was determined by IP using recombinant GST-IER3 (1 μg) and MDM2 (0.5 μg) proteins. ( c ) Structures of GST-tagged full-length and truncated mutants of MDM2 are illustrated. ( d ) HeLa cells were co-transfected with each GST-tagged MDM2 construct and FLAG-IER3. Twenty-four hours after transfection, cell lysates were prepared and IP with GST beads. The arrows indicate the expected positions of MDM2 proteins. ( e ) MDM2 was knocked down in HeLa cells using MDM2 siRNA (100 and 200 nM) and the cell lysates were analyzed by immunoblotting (IB). ( f ) HeLa cells were transfected with the indicated plasmids and changes in the stability of IER3 proteins induced by MDM2 were determined by IB analysis. Green fluorescent protein (GFP)-expressing plasmid was included as an internal control of transfection efficiency. ( g ) Degrees of IER3 ubiquitination (Ub) were determined by IP after HeLa cells were transfected with GST-IER3 and HA-ubiquitin together with the MDM2 plasmid. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h followed by IP and IB analysis. ( h ) MDM2 was knocked down using a siRNA against MDM2 in HeLa cells. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h followed by IP and IB analysis. ( i ) In vitro Ub of IER3 by MDM2 was assessed by the incubation of recombinant IER3 protein (1 μg) in Ub buffer containing MDM2 protein (0.3 μg). The western blot results are shown.
Figure Legend Snippet: Identification of MDM2 as the E3 ubiquitin ligase for IER3. ( a ) The interaction of IER3 with different E3 ubiquitin ligases was determined by immunoprecipitation (IP) in HeLa cells. The arrows indicate the expected positions of the proteins. ( b ) In vitro , a direct interaction between IER3 and MDM2 was determined by IP using recombinant GST-IER3 (1 μg) and MDM2 (0.5 μg) proteins. ( c ) Structures of GST-tagged full-length and truncated mutants of MDM2 are illustrated. ( d ) HeLa cells were co-transfected with each GST-tagged MDM2 construct and FLAG-IER3. Twenty-four hours after transfection, cell lysates were prepared and IP with GST beads. The arrows indicate the expected positions of MDM2 proteins. ( e ) MDM2 was knocked down in HeLa cells using MDM2 siRNA (100 and 200 nM) and the cell lysates were analyzed by immunoblotting (IB). ( f ) HeLa cells were transfected with the indicated plasmids and changes in the stability of IER3 proteins induced by MDM2 were determined by IB analysis. Green fluorescent protein (GFP)-expressing plasmid was included as an internal control of transfection efficiency. ( g ) Degrees of IER3 ubiquitination (Ub) were determined by IP after HeLa cells were transfected with GST-IER3 and HA-ubiquitin together with the MDM2 plasmid. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h followed by IP and IB analysis. ( h ) MDM2 was knocked down using a siRNA against MDM2 in HeLa cells. Twelve hours after transfection, the cells were incubated with MG132 (50 μM) for 12 h followed by IP and IB analysis. ( i ) In vitro Ub of IER3 by MDM2 was assessed by the incubation of recombinant IER3 protein (1 μg) in Ub buffer containing MDM2 protein (0.3 μg). The western blot results are shown.

Techniques Used: Immunoprecipitation, In Vitro, Recombinant, Transfection, Construct, Expressing, Plasmid Preparation, Incubation, Western Blot

Mapping of the binding regions for the interaction between FHL2 and IER3. ( a ) Structures of the plasmids encoding HA-tagged full-length and truncated mutants of FHL2 are illustrated. ( b ) HeLa cells were co-transfected with each HA-tagged FHL2 construct and GST-IER3. Twenty-four hours after transfection, cell lysates were prepared and immunoprecipitated with GST beads. Arrows indicate expected positions of FHL2 proteins. GAPDH was included as a loading control. ( c ) Structures of GST-tagged full-length and deletion mutants of IER3 are illustrated. ( d ) Immunoprecipitation was performed as described in b following transfection with GST-IER3 constructs and Myc-FHL2 into HeLa cells. Arrows indicate IER3 proteins. ( e ) Transfection and immunoprecipitation were performed as described in b with indicated DNA constructs. Arrows indicate expected sizes of FHL2 mutants.
Figure Legend Snippet: Mapping of the binding regions for the interaction between FHL2 and IER3. ( a ) Structures of the plasmids encoding HA-tagged full-length and truncated mutants of FHL2 are illustrated. ( b ) HeLa cells were co-transfected with each HA-tagged FHL2 construct and GST-IER3. Twenty-four hours after transfection, cell lysates were prepared and immunoprecipitated with GST beads. Arrows indicate expected positions of FHL2 proteins. GAPDH was included as a loading control. ( c ) Structures of GST-tagged full-length and deletion mutants of IER3 are illustrated. ( d ) Immunoprecipitation was performed as described in b following transfection with GST-IER3 constructs and Myc-FHL2 into HeLa cells. Arrows indicate IER3 proteins. ( e ) Transfection and immunoprecipitation were performed as described in b with indicated DNA constructs. Arrows indicate expected sizes of FHL2 mutants.

Techniques Used: Binding Assay, Transfection, Construct, Immunoprecipitation

Regulation of MDM2-mediated degradation of IER3 by FHL2. ( a , b ) Changes in IER3 levels were determined by western blot analysis in HeLa cells after transfection with the indicated plasmids and siRNAs (200 nM). ( c ) The direct interaction between FHL2 and MDM2 was assessed by an in vitro immunoprecipitation (IP) after incubation of recombinant FHL2 (1 μg) and GST-MDM2 (0.5 μg) proteins. ( d ) The HA-tagged WT and mutant FHL2 constructs shown in Figure 2a were co-transfected with MDM2 into HeLa cells and their binding capacities were assessed by IP. The arrows indicate the expected positions of FHL2 proteins. ( e ) The GST-tagged WT and mutant MDM2 constructs presented in Figure 5c were co-transfected with Myc-FHL2 into HeLa cells and their binding capacities were assessed by IP. The arrows indicate the expected positions of MDM2 proteins. ( f , g ) The effect of FHL2 expression on the association of IER3 and MDM2 was determined after transfection of HeLa cells with the indicated plasmids and siRNA followed by IP and western blot analysis. The relative interaction ratios are graphically presented from the results of three independent experiments ( P
Figure Legend Snippet: Regulation of MDM2-mediated degradation of IER3 by FHL2. ( a , b ) Changes in IER3 levels were determined by western blot analysis in HeLa cells after transfection with the indicated plasmids and siRNAs (200 nM). ( c ) The direct interaction between FHL2 and MDM2 was assessed by an in vitro immunoprecipitation (IP) after incubation of recombinant FHL2 (1 μg) and GST-MDM2 (0.5 μg) proteins. ( d ) The HA-tagged WT and mutant FHL2 constructs shown in Figure 2a were co-transfected with MDM2 into HeLa cells and their binding capacities were assessed by IP. The arrows indicate the expected positions of FHL2 proteins. ( e ) The GST-tagged WT and mutant MDM2 constructs presented in Figure 5c were co-transfected with Myc-FHL2 into HeLa cells and their binding capacities were assessed by IP. The arrows indicate the expected positions of MDM2 proteins. ( f , g ) The effect of FHL2 expression on the association of IER3 and MDM2 was determined after transfection of HeLa cells with the indicated plasmids and siRNA followed by IP and western blot analysis. The relative interaction ratios are graphically presented from the results of three independent experiments ( P

Techniques Used: Western Blot, Transfection, In Vitro, Immunoprecipitation, Incubation, Recombinant, Mutagenesis, Construct, Binding Assay, Expressing

46) Product Images from "DNA-binding specificity and dimerization of the DNA-binding domain of the PEND protein in the chloroplast envelope membrane"

Article Title: DNA-binding specificity and dimerization of the DNA-binding domain of the PEND protein in the chloroplast envelope membrane

Journal: Nucleic Acids Research

doi:

Intermolecular interaction of cbZIP domains. ( A ) Binding of GST fusion proteins to the immobilised MBP fusion proteins. The MBP fusion proteins along with MBP alone were separated by SDS–PAGE, and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with various GST fusion proteins as indicated. After washing, the GST was located by anti-GST antibody (goat) and anti-goat IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( B ) Binding of MBP–BZ to immobilized GST fusion proteins. The GST fusion proteins as well as GST were separated by SDS–PAGE and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with MBP–BZ fusion protein. After washing, the MBP was located by anti-MBP antibody (rabbit) and anti-rabbit IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( C ) Schematic diagram of the PEND protein showing the location of the partial polypeptides used in the experiments in (A) and (B). An extended zipper region consisting of two parts is shown here, but the second half of the zipper region is not conserved in the Brassica and Arabidopsis sequences.
Figure Legend Snippet: Intermolecular interaction of cbZIP domains. ( A ) Binding of GST fusion proteins to the immobilised MBP fusion proteins. The MBP fusion proteins along with MBP alone were separated by SDS–PAGE, and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with various GST fusion proteins as indicated. After washing, the GST was located by anti-GST antibody (goat) and anti-goat IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( B ) Binding of MBP–BZ to immobilized GST fusion proteins. The GST fusion proteins as well as GST were separated by SDS–PAGE and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with MBP–BZ fusion protein. After washing, the MBP was located by anti-MBP antibody (rabbit) and anti-rabbit IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( C ) Schematic diagram of the PEND protein showing the location of the partial polypeptides used in the experiments in (A) and (B). An extended zipper region consisting of two parts is shown here, but the second half of the zipper region is not conserved in the Brassica and Arabidopsis sequences.

Techniques Used: Binding Assay, SDS Page, Staining, Activity Assay

47) Product Images from "Isolation and Characterization of a Novel H1.2 Complex That Acts as a Repressor of p53-mediated Transcription *"

Article Title: Isolation and Characterization of a Novel H1.2 Complex That Acts as a Repressor of p53-mediated Transcription *

Journal:

doi: 10.1074/jbc.M708205200

Interaction of H1.2 with its associated factors. A , purification of GST-H1.2 fusion protein. GST or GST-H1.2 was purified as described under “Experimental Procedures.” The purity of the proteins was analyzed by 15% SDS-PAGE and Coomassie
Figure Legend Snippet: Interaction of H1.2 with its associated factors. A , purification of GST-H1.2 fusion protein. GST or GST-H1.2 was purified as described under “Experimental Procedures.” The purity of the proteins was analyzed by 15% SDS-PAGE and Coomassie

Techniques Used: Purification, SDS Page

Direct interaction of H1.2 with p53. A , p53 interaction with H1.2 in vitro . GST-H1.2 mutants ( lanes 1–4 ) or GST-p53 mutants ( lanes 5–7 ) were analyzed by SDS-PAGE and Coomassie staining analysis. For interaction studies, GST-H1.2 mutants
Figure Legend Snippet: Direct interaction of H1.2 with p53. A , p53 interaction with H1.2 in vitro . GST-H1.2 mutants ( lanes 1–4 ) or GST-p53 mutants ( lanes 5–7 ) were analyzed by SDS-PAGE and Coomassie staining analysis. For interaction studies, GST-H1.2 mutants

Techniques Used: In Vitro, SDS Page, Staining

48) Product Images from "Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿"

Article Title: Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿

Journal:

doi: 10.1128/IAI.01352-07

Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and
Figure Legend Snippet: Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and

Techniques Used: Purification, Recombinant

49) Product Images from "IgG glycan hydrolysis by a bacterial enzyme as a therapy against autoimmune conditions"

Article Title: IgG glycan hydrolysis by a bacterial enzyme as a therapy against autoimmune conditions

Journal:

doi: 10.1073/pnas.0711271105

EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)
Figure Legend Snippet: EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)

Techniques Used: Mouse Assay, Injection, SDS Page, Staining

EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)
Figure Legend Snippet: EndoS rescues mice from lethal IgG-mediated thrombocytopenia. ( A ) Survival plots of BALB/c mice injected with αPLT-IgG, followed by GST-EndoS ( n = 8) or GST ( n = 8) treatment 3 h after αPLT-IgG administration. ( B ) SDS/PAGE analysis (stain)

Techniques Used: Mouse Assay, Injection, SDS Page, Staining

50) Product Images from "PKC? is required for ?1?2/?3?2- and PKD-mediated transport to the cell surface and the organization of the Golgi apparatus"

Article Title: PKC? is required for ?1?2/?3?2- and PKD-mediated transport to the cell surface and the organization of the Golgi apparatus

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200412089

Expression of constitutively activated PKC η fragments the Golgi apparatus. HeLa cells were transfected with tagged versions of FLAG-PKCη wt (a and b), FLAG-PKCη constitutive active (c and d) and FLAG-PKCη constitutive active + GST-PKD kinase dead (e–h). The localization of the respective proteins was monitored by fluorescence microscopy using specific anti-tag antibodies. PKCη-wt is localized to the Golgi apparatus (a and b). The Golgi apparatus in cells expressing PKCη constitutive active is fragmented (c and d). The PKCη constitutive active–mediated Golgi fragmentation is inhibited upon expression of PKD kinase dead (e and f). Interestingly, PKD kinase dead and PKCη constitutive active colocalize both at the level of Golgi cisternae (g–h) and the emanating tubules (insets in g and h). CA denotes constitutively activated, and KD a kinase-dead form of the respective kinase.
Figure Legend Snippet: Expression of constitutively activated PKC η fragments the Golgi apparatus. HeLa cells were transfected with tagged versions of FLAG-PKCη wt (a and b), FLAG-PKCη constitutive active (c and d) and FLAG-PKCη constitutive active + GST-PKD kinase dead (e–h). The localization of the respective proteins was monitored by fluorescence microscopy using specific anti-tag antibodies. PKCη-wt is localized to the Golgi apparatus (a and b). The Golgi apparatus in cells expressing PKCη constitutive active is fragmented (c and d). The PKCη constitutive active–mediated Golgi fragmentation is inhibited upon expression of PKD kinase dead (e and f). Interestingly, PKD kinase dead and PKCη constitutive active colocalize both at the level of Golgi cisternae (g–h) and the emanating tubules (insets in g and h). CA denotes constitutively activated, and KD a kinase-dead form of the respective kinase.

Techniques Used: Expressing, Transfection, Fluorescence, Microscopy

Activation of PKC η by β 1 γ 2, and subsequent hyper phosphorylation of PKD in the activation loop. HeLa cells were cotransfected with the constructs listed. The cells were lysed and the extracts analyzed by Western blotting to monitor the phosphorylation status of FLAG-PKCη, GFP-PKCɛ, and GST-PKD, respectively. The blots were quantitated as described in Materials and methods. (A) For PKCη, the antibody used recognizes threonine 655 (T655). (B) Similar experimental procedure was used to monitor the effect of β1γ2 expression on the phosphorylation status of PKCɛ phosphorylation (Ser729). (C) Coexpression of β1γ2 and PKCη caused a fourfold increase in the phosphorylation of Ser744/748 (in the activation loop) of PKD without any appreciable change in the autophosphorylation of Ser916 (lane 2, shown in the Western blot and the bar graph). Values are means (±SD, vertical bars) of three separate experiments.
Figure Legend Snippet: Activation of PKC η by β 1 γ 2, and subsequent hyper phosphorylation of PKD in the activation loop. HeLa cells were cotransfected with the constructs listed. The cells were lysed and the extracts analyzed by Western blotting to monitor the phosphorylation status of FLAG-PKCη, GFP-PKCɛ, and GST-PKD, respectively. The blots were quantitated as described in Materials and methods. (A) For PKCη, the antibody used recognizes threonine 655 (T655). (B) Similar experimental procedure was used to monitor the effect of β1γ2 expression on the phosphorylation status of PKCɛ phosphorylation (Ser729). (C) Coexpression of β1γ2 and PKCη caused a fourfold increase in the phosphorylation of Ser744/748 (in the activation loop) of PKD without any appreciable change in the autophosphorylation of Ser916 (lane 2, shown in the Western blot and the bar graph). Values are means (±SD, vertical bars) of three separate experiments.

Techniques Used: Activation Assay, Construct, Western Blot, Expressing

Effect of PH domains on the β 1 γ 2-dependent Golgi fragmentation and PKD phosphorylation. (A) β1γ2-mediated Golgi fragmentation is inhibited by specific PH domains in intact cells. HeLa cells were transfected with FLAG-β1HA-γ2 and GFP-PH domains of proteins listed. The organization of the Golgi apparatus was monitored by fluorescence microscopy using anti-TGN46 and -GM130 (late and early Golgi specific markers) antibodies. 200 cells expressing FLAG-β1 were counted to determine the percentage of cells with fragmented Golgi membranes. Percentage of cells transfected and levels of protein expression for each PH domain was similar in all experiments as monitored by immunofluorescence and Western blotting with anti-GFP antibody, respectively. (B and C) Effect of β1γ2 on PKD phosphorylation in the activation loop. HeLa cells were cotransfected with the constructs listed. GST-PKD was immunoprecipitated and analyzed by Western blotting (B) with antibodies against GST,phospho-PKD (Ser916), phospho-PKD (Ser744–748), respectively, and quantitated by densitometric scan (C). Anti-FLAG antibodies were used to monitor the expression level of β1γ2 and β4γ2 in the respective cell extracts (B). Values are means (±SD, vertical bars) of three separate experiments.
Figure Legend Snippet: Effect of PH domains on the β 1 γ 2-dependent Golgi fragmentation and PKD phosphorylation. (A) β1γ2-mediated Golgi fragmentation is inhibited by specific PH domains in intact cells. HeLa cells were transfected with FLAG-β1HA-γ2 and GFP-PH domains of proteins listed. The organization of the Golgi apparatus was monitored by fluorescence microscopy using anti-TGN46 and -GM130 (late and early Golgi specific markers) antibodies. 200 cells expressing FLAG-β1 were counted to determine the percentage of cells with fragmented Golgi membranes. Percentage of cells transfected and levels of protein expression for each PH domain was similar in all experiments as monitored by immunofluorescence and Western blotting with anti-GFP antibody, respectively. (B and C) Effect of β1γ2 on PKD phosphorylation in the activation loop. HeLa cells were cotransfected with the constructs listed. GST-PKD was immunoprecipitated and analyzed by Western blotting (B) with antibodies against GST,phospho-PKD (Ser916), phospho-PKD (Ser744–748), respectively, and quantitated by densitometric scan (C). Anti-FLAG antibodies were used to monitor the expression level of β1γ2 and β4γ2 in the respective cell extracts (B). Values are means (±SD, vertical bars) of three separate experiments.

Techniques Used: Transfection, Fluorescence, Microscopy, Expressing, Immunofluorescence, Western Blot, Activation Assay, Construct, Immunoprecipitation

51) Product Images from "Phospholipase C ?3 is a key component in the G??/PKC?/PKD-mediated regulation of trans-Golgi network to plasma membrane transport"

Article Title: Phospholipase C ?3 is a key component in the G??/PKC?/PKD-mediated regulation of trans-Golgi network to plasma membrane transport

Journal: The Biochemical Journal

doi: 10.1042/BJ20070359

PLCβ3 siRNA blocks VSV-G transport and PKCη/PKD activation ( A ) Western blots showing the expression of PLCβ1 and PLCβ3 in normal cells (NT), siRNA-transfected cells, and siRNA-treated cells where the corresponding rat wild-type protein (ratPLCβ1 or 3 wt) was overexpressed for 24 h before cell lysate preparation. ( B ) Measurement of VSV-G transport in cells undergoing the same experimental conditions described in ( A ), shown as a percentage of GFP–VSV-G-expressing cells where this protein has reached the cell surface. Values are means (±S.D., vertical bars) for three separate experiments. ( C ) Measurement of PKCη activation (Phospho-PKCη Thr 655 ) in extracts proceeding from the cells described in ( A ). ( D ) Same as ( C ) but for PKD1 activation (Phospho-PKD1 Ser 744 /Ser 748 ). In order to determine activity of protein kinases in ( C , D ), cells were co-transfected with FLAG–β1–HA–γ2, FLAG–PKCη and GST–PKD1. All the experiments shown in ( A , C , D ) were repeated four times.
Figure Legend Snippet: PLCβ3 siRNA blocks VSV-G transport and PKCη/PKD activation ( A ) Western blots showing the expression of PLCβ1 and PLCβ3 in normal cells (NT), siRNA-transfected cells, and siRNA-treated cells where the corresponding rat wild-type protein (ratPLCβ1 or 3 wt) was overexpressed for 24 h before cell lysate preparation. ( B ) Measurement of VSV-G transport in cells undergoing the same experimental conditions described in ( A ), shown as a percentage of GFP–VSV-G-expressing cells where this protein has reached the cell surface. Values are means (±S.D., vertical bars) for three separate experiments. ( C ) Measurement of PKCη activation (Phospho-PKCη Thr 655 ) in extracts proceeding from the cells described in ( A ). ( D ) Same as ( C ) but for PKD1 activation (Phospho-PKD1 Ser 744 /Ser 748 ). In order to determine activity of protein kinases in ( C , D ), cells were co-transfected with FLAG–β1–HA–γ2, FLAG–PKCη and GST–PKD1. All the experiments shown in ( A , C , D ) were repeated four times.

Techniques Used: Activation Assay, Western Blot, Expressing, Transfection, Activity Assay

52) Product Images from "Activity-dependent SUMOylation of the brain-specific scaffolding protein GISP"

Article Title: Activity-dependent SUMOylation of the brain-specific scaffolding protein GISP

Journal: Biochemical and biophysical research communications

doi: 10.1016/j.bbrc.2011.05.060

GISP is a novel neuronal SUMOylation substrate. (A) GST-GISP truncation constructs were expressed in bacteria either with or without a plasmid expressing the SUMO machinery. Bands representing SUMOylated GISP fragments are indicated by arrows. (B) Samples
Figure Legend Snippet: GISP is a novel neuronal SUMOylation substrate. (A) GST-GISP truncation constructs were expressed in bacteria either with or without a plasmid expressing the SUMO machinery. Bands representing SUMOylated GISP fragments are indicated by arrows. (B) Samples

Techniques Used: Construct, Plasmid Preparation, Expressing

53) Product Images from "Development of a dimethylarginine dimethylaminohydrolase (DDAH) assay for high throughput chemical screening"

Article Title: Development of a dimethylarginine dimethylaminohydrolase (DDAH) assay for high throughput chemical screening

Journal: Journal of biomolecular screening

doi: 10.1177/1087057112441521

Western blot analysis showing the production of GST-DDAH (56.5kDa). Lanes 1,3: pre-induction; lane-2: post-induction sample of an empty vector; lane 4: IPTG induction of DDAH vector. Lane-M is SeeBlue Plus molecular weight marker.
Figure Legend Snippet: Western blot analysis showing the production of GST-DDAH (56.5kDa). Lanes 1,3: pre-induction; lane-2: post-induction sample of an empty vector; lane 4: IPTG induction of DDAH vector. Lane-M is SeeBlue Plus molecular weight marker.

Techniques Used: Western Blot, Plasmid Preparation, Molecular Weight, Marker

54) Product Images from "DNA-binding specificity and dimerization of the DNA-binding domain of the PEND protein in the chloroplast envelope membrane"

Article Title: DNA-binding specificity and dimerization of the DNA-binding domain of the PEND protein in the chloroplast envelope membrane

Journal: Nucleic Acids Research

doi:

Intermolecular interaction of cbZIP domains. ( A ) Binding of GST fusion proteins to the immobilised MBP fusion proteins. The MBP fusion proteins along with MBP alone were separated by SDS–PAGE, and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with various GST fusion proteins as indicated. After washing, the GST was located by anti-GST antibody (goat) and anti-goat IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( B ) Binding of MBP–BZ to immobilized GST fusion proteins. The GST fusion proteins as well as GST were separated by SDS–PAGE and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with MBP–BZ fusion protein. After washing, the MBP was located by anti-MBP antibody (rabbit) and anti-rabbit IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( C ) Schematic diagram of the PEND protein showing the location of the partial polypeptides used in the experiments in (A) and (B). An extended zipper region consisting of two parts is shown here, but the second half of the zipper region is not conserved in the Brassica and Arabidopsis sequences.
Figure Legend Snippet: Intermolecular interaction of cbZIP domains. ( A ) Binding of GST fusion proteins to the immobilised MBP fusion proteins. The MBP fusion proteins along with MBP alone were separated by SDS–PAGE, and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with various GST fusion proteins as indicated. After washing, the GST was located by anti-GST antibody (goat) and anti-goat IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( B ) Binding of MBP–BZ to immobilized GST fusion proteins. The GST fusion proteins as well as GST were separated by SDS–PAGE and then transferred to a PVDF membrane. The first piece of membrane was stained with Coomassie Brilliant Blue to show protein bands. The other pieces were reacted with MBP–BZ fusion protein. After washing, the MBP was located by anti-MBP antibody (rabbit) and anti-rabbit IgG conjugated with alkaline phosphatase. The phosphatase activity was visualized by color reaction. The numbers on the left indicate molecular mass markers. ( C ) Schematic diagram of the PEND protein showing the location of the partial polypeptides used in the experiments in (A) and (B). An extended zipper region consisting of two parts is shown here, but the second half of the zipper region is not conserved in the Brassica and Arabidopsis sequences.

Techniques Used: Binding Assay, SDS Page, Staining, Activity Assay

55) Product Images from "CRISPR/Cas9-Mediated Knockout of DNAJC14 Verifies This Chaperone as a Pivotal Host Factor for RNA Replication of Pestiviruses"

Article Title: CRISPR/Cas9-Mediated Knockout of DNAJC14 Verifies This Chaperone as a Pivotal Host Factor for RNA Replication of Pestiviruses

Journal: Journal of Virology

doi: 10.1128/JVI.01714-18

Assessment of the capacity of the BVDV NS3-3′ replicon to support assembly of a minimal replicase and viral RNA replication in DNAJC14-KO and DNAJC14-KO GST-Jiv90 rescue cells by luciferase assay. (A) Schematic representation of the BVDV Bici-388 RLuc-NS3-3′ replicon. (B) In vitro -transcribed BVDV Bici-388 RLuc-NS3-3′/WT and BVDV Bici-388 RLuc-NS3-3′/GAA replicon RNA (2 μg) was electroporated into naive MDBK and MDBK DNAJC14-KO cells as well as MDBK DNAJC14-KO GST-Jiv90(WT) and MDBK DNAJC14-KO GST-Jiv90(W39A) rescue cells, and cells were collected at 2, 24, and 48 hpe to determine luciferase activity. Mean values from three independent experiments are shown. Error bars indicate standard deviations. Mock, no RNA electroporated; WT, wild type; GAA, polymerase-inactive mutant; RLUs, relative light units; RLuc, Renilla luciferase.
Figure Legend Snippet: Assessment of the capacity of the BVDV NS3-3′ replicon to support assembly of a minimal replicase and viral RNA replication in DNAJC14-KO and DNAJC14-KO GST-Jiv90 rescue cells by luciferase assay. (A) Schematic representation of the BVDV Bici-388 RLuc-NS3-3′ replicon. (B) In vitro -transcribed BVDV Bici-388 RLuc-NS3-3′/WT and BVDV Bici-388 RLuc-NS3-3′/GAA replicon RNA (2 μg) was electroporated into naive MDBK and MDBK DNAJC14-KO cells as well as MDBK DNAJC14-KO GST-Jiv90(WT) and MDBK DNAJC14-KO GST-Jiv90(W39A) rescue cells, and cells were collected at 2, 24, and 48 hpe to determine luciferase activity. Mean values from three independent experiments are shown. Error bars indicate standard deviations. Mock, no RNA electroporated; WT, wild type; GAA, polymerase-inactive mutant; RLUs, relative light units; RLuc, Renilla luciferase.

Techniques Used: Luciferase, In Vitro, Activity Assay, Mutagenesis

Generation and validation of MDBK and SK6 DNAJC14-KO rescue cell lines expressing GST-Jiv90(WT) or GST-Jiv90(W39A). (A) Scheme of the lentiviral expression constructs pWPI-GST-Jiv90(WT) and pWPI-GST-Jiv90(W39A). LTR, long terminal repeat. (B) Schematic of the experimental approach used for the generation of the MDBK and SK6 DNAJC14-KO rescue cells. (C) Analysis of GST-Jiv90 expression in MDBK DNAJC14-KO rescue cells by IF. DNAJC14-KO cells and DNAJC14-KO rescue cells expressing GST-Jiv90(WT) or GST-Jiv90(W39A) were stained with anti-DNAJC14 (recognizing epitope SARYCAECNR in the Jiv90 domain) or anti-GST-specific antibodies. Cell nuclei were counterstained with DAPI. (D) Western blot analysis of GST-Jiv90 expression in MDBK DNAJC14-KO rescue cells. Protein lysates obtained from naive MDBK and MDBK DNAJC14-KO cells and MDBK DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A) were separated by SDS-PAGE and analyzed with anti-GST (top) or anti-DNAJC14 (bottom). The positions of DNAJC14 GST-Jiv90(WT) and GST-Jiv90(W39A) are indicated on the right, and the protein marker positions are given on the left. (E) Analysis of GST-Jiv90 expression in SK6 DNAJC14-KO rescue cells by anti-GST- and anti-DNAJC14-specific IF. (F) Western blot analysis of GST-Jiv90 expression in SK6 DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A). Protein lysates obtained from naive SK6, SK6 DNAJC14-KO cells, and SK6 DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A) were separated by SDS-PAGE and analyzed with anti-GST (top) or anti-DNAJC14 (bottom). The positions of DNAJC14 GST-Jiv90(WT) and GST-Jiv90(W39A) are indicated on the right, and the protein marker positions are given on the left.
Figure Legend Snippet: Generation and validation of MDBK and SK6 DNAJC14-KO rescue cell lines expressing GST-Jiv90(WT) or GST-Jiv90(W39A). (A) Scheme of the lentiviral expression constructs pWPI-GST-Jiv90(WT) and pWPI-GST-Jiv90(W39A). LTR, long terminal repeat. (B) Schematic of the experimental approach used for the generation of the MDBK and SK6 DNAJC14-KO rescue cells. (C) Analysis of GST-Jiv90 expression in MDBK DNAJC14-KO rescue cells by IF. DNAJC14-KO cells and DNAJC14-KO rescue cells expressing GST-Jiv90(WT) or GST-Jiv90(W39A) were stained with anti-DNAJC14 (recognizing epitope SARYCAECNR in the Jiv90 domain) or anti-GST-specific antibodies. Cell nuclei were counterstained with DAPI. (D) Western blot analysis of GST-Jiv90 expression in MDBK DNAJC14-KO rescue cells. Protein lysates obtained from naive MDBK and MDBK DNAJC14-KO cells and MDBK DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A) were separated by SDS-PAGE and analyzed with anti-GST (top) or anti-DNAJC14 (bottom). The positions of DNAJC14 GST-Jiv90(WT) and GST-Jiv90(W39A) are indicated on the right, and the protein marker positions are given on the left. (E) Analysis of GST-Jiv90 expression in SK6 DNAJC14-KO rescue cells by anti-GST- and anti-DNAJC14-specific IF. (F) Western blot analysis of GST-Jiv90 expression in SK6 DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A). Protein lysates obtained from naive SK6, SK6 DNAJC14-KO cells, and SK6 DNAJC14-KO rescue cells expressing either GST-Jiv90(WT) or GST-Jiv90(W39A) were separated by SDS-PAGE and analyzed with anti-GST (top) or anti-DNAJC14 (bottom). The positions of DNAJC14 GST-Jiv90(WT) and GST-Jiv90(W39A) are indicated on the right, and the protein marker positions are given on the left.

Techniques Used: Expressing, Construct, Staining, Western Blot, SDS Page, Marker

56) Product Images from "Syndapin I, a Synaptic Dynamin-binding Protein that Associates with the Neural Wiskott-Aldrich Syndrome Protein"

Article Title: Syndapin I, a Synaptic Dynamin-binding Protein that Associates with the Neural Wiskott-Aldrich Syndrome Protein

Journal: Molecular Biology of the Cell

doi:

Identification of major binding partners of syndapin I as dynamin, synaptojanin, synapsin I, and N-WASP. Soluble proteins (S3) from rat brains after homogenization in buffer A were affinity purified onto either wild-type or mutant GST-SdpI-SH3 immobilized on glutathione-Sepharose. Material specifically bound to the beads was eluted with glutathione-containing buffer and analyzed on 4–15% SDS-PAGE. (A) Coomassie protein staining revealed a protein doublet at 100 kDa and a minor band at 145 kDa specifically coprecipitated with wild-type SdpI-SH3 but not with SdpI-SH3m harboring the P434L point mutation. (B) Precipitated material was analyzed by overlay with GST-SdpI and by Western blot analyses. Antibodies against dynamin, synaptojanin, and synapsin I demonstrate that the affinity-purified bands of 100, 145, and 80 and 75 kDa correspond to dynamin, synaptojanin, and synapsin Ia and Ib, respectively. N-WASP–specific antibodies revealed that syndapin I coprecipitated N-WASP because of an SH3 domain-dependent interaction.
Figure Legend Snippet: Identification of major binding partners of syndapin I as dynamin, synaptojanin, synapsin I, and N-WASP. Soluble proteins (S3) from rat brains after homogenization in buffer A were affinity purified onto either wild-type or mutant GST-SdpI-SH3 immobilized on glutathione-Sepharose. Material specifically bound to the beads was eluted with glutathione-containing buffer and analyzed on 4–15% SDS-PAGE. (A) Coomassie protein staining revealed a protein doublet at 100 kDa and a minor band at 145 kDa specifically coprecipitated with wild-type SdpI-SH3 but not with SdpI-SH3m harboring the P434L point mutation. (B) Precipitated material was analyzed by overlay with GST-SdpI and by Western blot analyses. Antibodies against dynamin, synaptojanin, and synapsin I demonstrate that the affinity-purified bands of 100, 145, and 80 and 75 kDa correspond to dynamin, synaptojanin, and synapsin Ia and Ib, respectively. N-WASP–specific antibodies revealed that syndapin I coprecipitated N-WASP because of an SH3 domain-dependent interaction.

Techniques Used: Binding Assay, Homogenization, Affinity Purification, Mutagenesis, SDS Page, Staining, Western Blot, IA

Overlay analysis of rat brain cytosol with various GST-syndapin I constructs. Rat brain cytosol (20 μg per lane) was separated on 4–15% SDS-PAGE gels, transferred to nitrocellulose membranes, and either overlaid with 1 μM GST fusion proteins of syndapin I (wild-type and P434L mutant of full-length syndapin I and SH3 domain only and SdpI-N, lacking the SH3 domain) or incubated with antibodies against synapsin I, dynamin (2072), and synaptojanin. Binding of GST fusion proteins was detected with affinity-purified anti-GST antibodies. Full-length syndapin I fusion protein (GST-SdpI) reveals major bands at 170 kDa, 145 kDa (comigrating with synaptojanin), 120 kDa, 100 kDa (comigrating with dynamin), 80 and 75 kDa (doublet comigrating with synapsin Ia and Ib), 65 kDa, and 55 kDa, whereas the SH3 domain showed a high preference for the 100-kDa band corresponding to dynamin (GST-SdpI-SH3).
Figure Legend Snippet: Overlay analysis of rat brain cytosol with various GST-syndapin I constructs. Rat brain cytosol (20 μg per lane) was separated on 4–15% SDS-PAGE gels, transferred to nitrocellulose membranes, and either overlaid with 1 μM GST fusion proteins of syndapin I (wild-type and P434L mutant of full-length syndapin I and SH3 domain only and SdpI-N, lacking the SH3 domain) or incubated with antibodies against synapsin I, dynamin (2072), and synaptojanin. Binding of GST fusion proteins was detected with affinity-purified anti-GST antibodies. Full-length syndapin I fusion protein (GST-SdpI) reveals major bands at 170 kDa, 145 kDa (comigrating with synaptojanin), 120 kDa, 100 kDa (comigrating with dynamin), 80 and 75 kDa (doublet comigrating with synapsin Ia and Ib), 65 kDa, and 55 kDa, whereas the SH3 domain showed a high preference for the 100-kDa band corresponding to dynamin (GST-SdpI-SH3).

Techniques Used: Construct, SDS Page, Mutagenesis, Incubation, Binding Assay, Affinity Purification, IA

Syndapin I exists in a high molecular weight complex. Rat brain high-speed supernatant was analyzed by gel filtration over Superose 6. Aliquots of each fraction were resolved on 6–15% SDS-PAGE and blotted to nitrocellulose. Proteins were detected by antibody reaction and overlay analyses with GST-Ddyn(PRD) and GST-SdpI, and the staining intensities of the fractions were plotted. Some proteins eluted in sharp peaks, whereas others were more broadly distributed. The horizontal bars end at the position at which the concentration of the protein in a fraction was half-maximal and give an estimate of the distribution. Half-maximum widths are shown for endophilin, syndapin I, amphiphysin I, synaptojanin, dynamin I, synapsin I, and N-WASP. Standards for column calibration correspond to dextran 2000 (2000 kDa), thyroglobulin (669 kDa), ferritin (440 kDa), and catalase (232 kDa).
Figure Legend Snippet: Syndapin I exists in a high molecular weight complex. Rat brain high-speed supernatant was analyzed by gel filtration over Superose 6. Aliquots of each fraction were resolved on 6–15% SDS-PAGE and blotted to nitrocellulose. Proteins were detected by antibody reaction and overlay analyses with GST-Ddyn(PRD) and GST-SdpI, and the staining intensities of the fractions were plotted. Some proteins eluted in sharp peaks, whereas others were more broadly distributed. The horizontal bars end at the position at which the concentration of the protein in a fraction was half-maximal and give an estimate of the distribution. Half-maximum widths are shown for endophilin, syndapin I, amphiphysin I, synaptojanin, dynamin I, synapsin I, and N-WASP. Standards for column calibration correspond to dextran 2000 (2000 kDa), thyroglobulin (669 kDa), ferritin (440 kDa), and catalase (232 kDa).

Techniques Used: Molecular Weight, Filtration, SDS Page, Staining, Concentration Assay

Dynamin (PRD) overlays identify amphiphysin I, amphiphysin II, syndapin I, and endophilin. Overlay analysis of rat brain cytosol fractions with GST-Ddyn(PRD) reveals a 52-kDa protein, in addition to bands comigrating with amphiphysin I, amphiphysin II, and endophilin. Molecular weight markers on the left are in kilodaltons.
Figure Legend Snippet: Dynamin (PRD) overlays identify amphiphysin I, amphiphysin II, syndapin I, and endophilin. Overlay analysis of rat brain cytosol fractions with GST-Ddyn(PRD) reveals a 52-kDa protein, in addition to bands comigrating with amphiphysin I, amphiphysin II, and endophilin. Molecular weight markers on the left are in kilodaltons.

Techniques Used: Molecular Weight

57) Product Images from "Functional Multimerization of Human Telomerase Requires an RNA Interaction Domain in the N Terminus of the Catalytic Subunit"

Article Title: Functional Multimerization of Human Telomerase Requires an RNA Interaction Domain in the N Terminus of the Catalytic Subunit

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.22.4.1253-1265.2002

N-terminal mutants are not defective in physical multimerization. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL or yeast in the presence of hTR were mixed and incubated on ice, and telomerase complexes were immunoprecipitated (IP) using a GST antibody. Immunoprecipitated hTERT/GST-hTERT complexes were examined for telomerase activity by TRAP (top panels) and for immunoprecipitation of hTERT and GST-hTERT proteins. WT, wild type. (A) N-terminal mutants interact equally with GST-hTERT D868N expressed in yeast. Equal amounts of yeast-expressed GST-hTERT D868N and RRL-expressed hTERT mutants were mixed and immunoprecipitated. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and in the absence of a GST antibody (lane 2). IC, internal control. (Middle panel) Immunoprecipitated GST-hTERT D868N was detected by Western blotting with anti-hTERT. (Bottom panel) Coimmunoprecipitated [ 35 S]-labeled hTERT N-terminal mutants were detected by SDS-PAGE. (B) N-terminal mutants interact equally with GST-hTERT D868N expressed in RRL. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL in the presence of hTR and [ 35 S]methionine were mixed and immunoprecipitated. Control reactions (lanes 3 and 4) were performed as described for panel A. (Bottom panel) Immunoprecipitated GST-hTERT D868N and coprecipitated hTERT mutants were detected by SDS-PAGE. GST-hTERT D868N and wild-type hTERT present in crude RRL prior to immunoprecipitation are shown in lanes 1 and 2, respectively.
Figure Legend Snippet: N-terminal mutants are not defective in physical multimerization. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL or yeast in the presence of hTR were mixed and incubated on ice, and telomerase complexes were immunoprecipitated (IP) using a GST antibody. Immunoprecipitated hTERT/GST-hTERT complexes were examined for telomerase activity by TRAP (top panels) and for immunoprecipitation of hTERT and GST-hTERT proteins. WT, wild type. (A) N-terminal mutants interact equally with GST-hTERT D868N expressed in yeast. Equal amounts of yeast-expressed GST-hTERT D868N and RRL-expressed hTERT mutants were mixed and immunoprecipitated. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and in the absence of a GST antibody (lane 2). IC, internal control. (Middle panel) Immunoprecipitated GST-hTERT D868N was detected by Western blotting with anti-hTERT. (Bottom panel) Coimmunoprecipitated [ 35 S]-labeled hTERT N-terminal mutants were detected by SDS-PAGE. (B) N-terminal mutants interact equally with GST-hTERT D868N expressed in RRL. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL in the presence of hTR and [ 35 S]methionine were mixed and immunoprecipitated. Control reactions (lanes 3 and 4) were performed as described for panel A. (Bottom panel) Immunoprecipitated GST-hTERT D868N and coprecipitated hTERT mutants were detected by SDS-PAGE. GST-hTERT D868N and wild-type hTERT present in crude RRL prior to immunoprecipitation are shown in lanes 1 and 2, respectively.

Techniques Used: Synthesized, Incubation, Immunoprecipitation, Activity Assay, Western Blot, Labeling, SDS Page

Association of GST-hTERT mutants with wild-type and D868N hTERT. Yeast whole-cell extracts were made from S. cerevisiae expressing GST-hTERT fusion proteins (D868N, wild type [WT], and mutants, as indicated) in the presence of hTR. These extracts were mixed with RRL containing [ 35 S]-labeled hTERT proteins synthesized in the presence of hTR. hTERT/GST-hTERT complexes were immunoprecipitated (IP) using a GST antibody and were analyzed for telomerase activity by TRAP (top panels) and for coprecipitation of [ 35 S]-labeled hTERT by SDS-PAGE (bottom panels). IC, internal control. (A) GST-hTERT fusion proteins associate with wild-type hTERT. Extracts prepared from yeast expressing GST-hTERT N-terminal mutants or from the parental YPH499 strain and containing equal amounts of total cellular proteins were mixed with RRL expressing wild-type hTERT. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and to determine whether RRL containing only hTR could complement GST-hTERT D868N to reconstitute telomerase activity (lane 2). (B) GST-hTERT fusion proteins physically associate with D868N hTERT, but inactive N-terminal mutants cannot functionally complement the inactive D868N mutant to reconstitute telomerase activity. Extracts prepared from yeast expressing GST-hTERT mutants were mixed with [ 35 S]-labeled D868N hTERT synthesized in RRL and were analyzed as described above.
Figure Legend Snippet: Association of GST-hTERT mutants with wild-type and D868N hTERT. Yeast whole-cell extracts were made from S. cerevisiae expressing GST-hTERT fusion proteins (D868N, wild type [WT], and mutants, as indicated) in the presence of hTR. These extracts were mixed with RRL containing [ 35 S]-labeled hTERT proteins synthesized in the presence of hTR. hTERT/GST-hTERT complexes were immunoprecipitated (IP) using a GST antibody and were analyzed for telomerase activity by TRAP (top panels) and for coprecipitation of [ 35 S]-labeled hTERT by SDS-PAGE (bottom panels). IC, internal control. (A) GST-hTERT fusion proteins associate with wild-type hTERT. Extracts prepared from yeast expressing GST-hTERT N-terminal mutants or from the parental YPH499 strain and containing equal amounts of total cellular proteins were mixed with RRL expressing wild-type hTERT. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and to determine whether RRL containing only hTR could complement GST-hTERT D868N to reconstitute telomerase activity (lane 2). (B) GST-hTERT fusion proteins physically associate with D868N hTERT, but inactive N-terminal mutants cannot functionally complement the inactive D868N mutant to reconstitute telomerase activity. Extracts prepared from yeast expressing GST-hTERT mutants were mixed with [ 35 S]-labeled D868N hTERT synthesized in RRL and were analyzed as described above.

Techniques Used: Expressing, Labeling, Synthesized, Immunoprecipitation, Activity Assay, SDS Page, Mutagenesis

. Data identifying hTR interaction domains (RID1 and RID2) and regions required for trans complementation of the catalytically inactive RT domain mutant GST-hTERT D868N were derived from this study.
Figure Legend Snippet: . Data identifying hTR interaction domains (RID1 and RID2) and regions required for trans complementation of the catalytically inactive RT domain mutant GST-hTERT D868N were derived from this study.

Techniques Used: Mutagenesis, Derivative Assay

58) Product Images from "MCM7 Interacts with Androgen Receptor"

Article Title: MCM7 Interacts with Androgen Receptor

Journal:

doi: 10.2353/ajpath.2008.080363

Identification of sequence motifs required for AR and MCM7 interaction. A: Schematic diagram of GST-MCM7n and its deletion mutants. B: Binding of AR with GST-MCM7n deletion mutants. The GST-MCM7n fusion protein or its mutants were purified from glutathione
Figure Legend Snippet: Identification of sequence motifs required for AR and MCM7 interaction. A: Schematic diagram of GST-MCM7n and its deletion mutants. B: Binding of AR with GST-MCM7n deletion mutants. The GST-MCM7n fusion protein or its mutants were purified from glutathione

Techniques Used: Sequencing, Binding Assay, Purification

59) Product Images from "Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿"

Article Title: Immunogenic and Plasminogen-Binding Surface-Associated ?-Enolase of Trichomonas vaginalis ▿

Journal:

doi: 10.1128/IAI.01352-07

Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and
Figure Legend Snippet: Purification of tv-rENO1 and antibody for tv-ENO1 in patient sera. (A) Recombinant GST::tv-ENO1 fusion protein (lane 1) and fusion protein digested with thrombin (lane 2) were electrophoresed on an SDS-polacrylamide gel with 10% acrylamide and

Techniques Used: Purification, Recombinant

60) Product Images from "Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy *Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy * S⃞"

Article Title: Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy *Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy * S⃞

Journal:

doi: 10.1074/jbc.M801166200

In vitro binding of Cib2 to different integrin isoforms. A , binding of integrins α7B, β1D, α7A, and β1A to GST-Cib2 or BSA (control) coated wells. Each value is the mean of 16 wells. A significant interaction between
Figure Legend Snippet: In vitro binding of Cib2 to different integrin isoforms. A , binding of integrins α7B, β1D, α7A, and β1A to GST-Cib2 or BSA (control) coated wells. Each value is the mean of 16 wells. A significant interaction between

Techniques Used: In Vitro, Binding Assay

61) Product Images from "A role for caveolin-1 in desmoglein binding and desmosome dynamics"

Article Title: A role for caveolin-1 in desmoglein binding and desmosome dynamics

Journal: Oncogene

doi: 10.1038/onc.2011.346

Cav-1 is a binding partner of desmogleins. ( A ) Coomasie staining of purified GST and GST fusion proteins with intracellular domains of Dsg1 (GST-Dsg1) or Dsg2 (GST-Dsg2). ( B ) Immunoblotting of GST, GST-Dsg1 and GST-Dsg2 using antibodies H-145 and DG3.10. H-145 recognized Dsg2 only, while DG3.10 recognized both Dsg1 and Dsg2. ( C ) These fusion proteins were used in a GST pull-down assay with A431 cell lysates. While A431 cells expressed both γ-catenin and β-catenin, Dsg1 and Dsg2 were able to pull down γ-catenin but not β-catenin. ( D ) GST pull-down assay with GST, GST-Dsg1 and GST-Dsg2 and A431 cell lysates, followed by Western blotting for Cav-1. Cav-1 was detected in the pull-down with Dsg1 and Dsg2 but not GST. ( E ) Immunoprecipitation assay further confirms that Dsg2 binds to Cav-1. Tx-soluble (S) and -insoluble (I) proteins were extracted from A431 cells and subjected to immunoprecipitation for Dsg2 (antibody 10D2). The precipitated products were immunoblotted for Dsg2 (Ab H-145), Cav-1 and mouse IgG (for equal antibody loading). Panels to the right are overexposed. I, Tx-insoluble; Tx, Triton X-100; S, Tx-soluble.
Figure Legend Snippet: Cav-1 is a binding partner of desmogleins. ( A ) Coomasie staining of purified GST and GST fusion proteins with intracellular domains of Dsg1 (GST-Dsg1) or Dsg2 (GST-Dsg2). ( B ) Immunoblotting of GST, GST-Dsg1 and GST-Dsg2 using antibodies H-145 and DG3.10. H-145 recognized Dsg2 only, while DG3.10 recognized both Dsg1 and Dsg2. ( C ) These fusion proteins were used in a GST pull-down assay with A431 cell lysates. While A431 cells expressed both γ-catenin and β-catenin, Dsg1 and Dsg2 were able to pull down γ-catenin but not β-catenin. ( D ) GST pull-down assay with GST, GST-Dsg1 and GST-Dsg2 and A431 cell lysates, followed by Western blotting for Cav-1. Cav-1 was detected in the pull-down with Dsg1 and Dsg2 but not GST. ( E ) Immunoprecipitation assay further confirms that Dsg2 binds to Cav-1. Tx-soluble (S) and -insoluble (I) proteins were extracted from A431 cells and subjected to immunoprecipitation for Dsg2 (antibody 10D2). The precipitated products were immunoblotted for Dsg2 (Ab H-145), Cav-1 and mouse IgG (for equal antibody loading). Panels to the right are overexposed. I, Tx-insoluble; Tx, Triton X-100; S, Tx-soluble.

Techniques Used: Binding Assay, Staining, Purification, Pull Down Assay, Western Blot, Immunoprecipitation

62) Product Images from "Proteomic and 3D structure analyses highlight the C/D box snoRNP assembly mechanism and its control"

Article Title: Proteomic and 3D structure analyses highlight the C/D box snoRNP assembly mechanism and its control

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201404160

hBCD1 identifies a new snoRNP assembly factor. (A) GFP-hBCD1 was purified from more and less extractable fractions of U2OS cells, and pellets were analyzed by SILAC proteomic. X axis: protein abundance (Log 10 ); Y axis: SILAC ratios (specific vs. control IP). LC, liquid chromatography; H/L, heavy/light; MW, molecular weight. (B) Yeast two-hybrid assays with ZNHIT3, hBCD1, and snoRNP assembly factors and core proteins. Alix is used as a negative control. Fib, Fibrillarin; Nter, N terminal; Cter, C terminal. (C) Co-IP assays between NUFIP and ZNHIT3. Extracts from 293T cells stably expressing GST-NUFIP and GST-ZNHIT3 were purified on glutathione beads and analyzed by Western blots (WB). (D) Intracellular localization of GFP-ZNHIT3. Microscopy images of HeLa cells transfected with a GFP-ZNHIT3 expression vector and labeled with DAPI to stain nuclei. Bar, 10 µm.
Figure Legend Snippet: hBCD1 identifies a new snoRNP assembly factor. (A) GFP-hBCD1 was purified from more and less extractable fractions of U2OS cells, and pellets were analyzed by SILAC proteomic. X axis: protein abundance (Log 10 ); Y axis: SILAC ratios (specific vs. control IP). LC, liquid chromatography; H/L, heavy/light; MW, molecular weight. (B) Yeast two-hybrid assays with ZNHIT3, hBCD1, and snoRNP assembly factors and core proteins. Alix is used as a negative control. Fib, Fibrillarin; Nter, N terminal; Cter, C terminal. (C) Co-IP assays between NUFIP and ZNHIT3. Extracts from 293T cells stably expressing GST-NUFIP and GST-ZNHIT3 were purified on glutathione beads and analyzed by Western blots (WB). (D) Intracellular localization of GFP-ZNHIT3. Microscopy images of HeLa cells transfected with a GFP-ZNHIT3 expression vector and labeled with DAPI to stain nuclei. Bar, 10 µm.

Techniques Used: Purification, Liquid Chromatography, Molecular Weight, Negative Control, Co-Immunoprecipitation Assay, Stable Transfection, Expressing, Western Blot, Microscopy, Transfection, Plasmid Preparation, Labeling, Staining

63) Product Images from "mTORC1-Activated S6K1 Phosphorylates Rictor on Threonine 1135 and Regulates mTORC2 Signaling ▿"

Article Title: mTORC1-Activated S6K1 Phosphorylates Rictor on Threonine 1135 and Regulates mTORC2 Signaling ▿

Journal:

doi: 10.1128/MCB.00601-09

S6K1 phosphorylates Rictor on Thr1135 in vitro . (A) S6K1 was immunoprecipitated from HEK293 cells stimulated with insulin (100 nM) and incubated in a kinase reaction with [γ- 32 P]ATP with GST-Rictor fusion proteins containing wild-type and T1135A
Figure Legend Snippet: S6K1 phosphorylates Rictor on Thr1135 in vitro . (A) S6K1 was immunoprecipitated from HEK293 cells stimulated with insulin (100 nM) and incubated in a kinase reaction with [γ- 32 P]ATP with GST-Rictor fusion proteins containing wild-type and T1135A

Techniques Used: In Vitro, Immunoprecipitation, Incubation

64) Product Images from "A role for G?12/G?13 in p120ctn regulation"

Article Title: A role for G?12/G?13 in p120ctn regulation

Journal:

doi: 10.1073/pnas.0401366101

Gα 12 Q231L and Gα 13 Q226L, but not Gα i3 Q204L, coimmunoprecipitates with purified GST-p120 ctn in vitro . ( A ) Purified, immobilized GST or GST-p1201A catenin were separated on SDS/PAGE, and the gel was stained with Coomassie brilliant
Figure Legend Snippet: Gα 12 Q231L and Gα 13 Q226L, but not Gα i3 Q204L, coimmunoprecipitates with purified GST-p120 ctn in vitro . ( A ) Purified, immobilized GST or GST-p1201A catenin were separated on SDS/PAGE, and the gel was stained with Coomassie brilliant

Techniques Used: Purification, In Vitro, SDS Page, Staining

65) Product Images from "Human GTSE-1 Regulates p21CIP1/WAF1 Stability Conferring Resistance to Paclitaxel Treatment *"

Article Title: Human GTSE-1 Regulates p21CIP1/WAF1 Stability Conferring Resistance to Paclitaxel Treatment *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.045948

Interaction of hGTSE-1 with p21 and the co-chaperone WISp39. A , U2OS extracts were resolved by gel filtration on a Superose 6 column, and the fractions were analyzed by immunoblotting. B , in vitro binding assay using recombinant GST or GST-hGTSE-1 fusion
Figure Legend Snippet: Interaction of hGTSE-1 with p21 and the co-chaperone WISp39. A , U2OS extracts were resolved by gel filtration on a Superose 6 column, and the fractions were analyzed by immunoblotting. B , in vitro binding assay using recombinant GST or GST-hGTSE-1 fusion

Techniques Used: Filtration, In Vitro, Binding Assay, Recombinant

66) Product Images from "Skeletrophin, a Novel Ubiquitin Ligase to the Intracellular Region of Jagged-2, Is Aberrantly Expressed in Multiple Myeloma"

Article Title: Skeletrophin, a Novel Ubiquitin Ligase to the Intracellular Region of Jagged-2, Is Aberrantly Expressed in Multiple Myeloma

Journal: The American Journal of Pathology

doi:

Skeletrophin binds and enhances ubiquitination toward the intracellular region of Jagged-2. A: The homology of deduced amino acids of human skeletrophin and human DIP-1/mib is 36.0%. B: The GST pull-down assay demonstrated the co-precipitation of skeletrophin with the GST-fused intracellular region of Jagged-2 by GT-Sepharose beads. Note the band detected by Western immunoblotting using anti-skeletrophin antibody. This figure represents the three independent experiments, all of which demonstrated the binding of skeletrophin to Jagged-2, but not to Delta-1, -3, -4, or Jagged-1. C: Skeletrophin mediates the ubiquitination of the intracellular region of Jagged-2 in the presence of E1 and E2. Note the slowly migrating band observed by Western immunoblotting using anti-GST antibody. An identical band was also detected by anti-FLAG antibody, which highlighted the presence of the intracellular region of Jagged-2 labeled by FLAG ubiquitin (see Materials and Methods). In contrast, the only significant band that represented the nonubiquitinized intracellular region of Jagged-2 was observed with the RING-mutated skeletrophin (C969S-skeletrophin).
Figure Legend Snippet: Skeletrophin binds and enhances ubiquitination toward the intracellular region of Jagged-2. A: The homology of deduced amino acids of human skeletrophin and human DIP-1/mib is 36.0%. B: The GST pull-down assay demonstrated the co-precipitation of skeletrophin with the GST-fused intracellular region of Jagged-2 by GT-Sepharose beads. Note the band detected by Western immunoblotting using anti-skeletrophin antibody. This figure represents the three independent experiments, all of which demonstrated the binding of skeletrophin to Jagged-2, but not to Delta-1, -3, -4, or Jagged-1. C: Skeletrophin mediates the ubiquitination of the intracellular region of Jagged-2 in the presence of E1 and E2. Note the slowly migrating band observed by Western immunoblotting using anti-GST antibody. An identical band was also detected by anti-FLAG antibody, which highlighted the presence of the intracellular region of Jagged-2 labeled by FLAG ubiquitin (see Materials and Methods). In contrast, the only significant band that represented the nonubiquitinized intracellular region of Jagged-2 was observed with the RING-mutated skeletrophin (C969S-skeletrophin).

Techniques Used: Pull Down Assay, Western Blot, Binding Assay, Labeling

67) Product Images from "The last CTD repeat of the mammalian RNA polymerase II large subunit is important for its stability"

Article Title: The last CTD repeat of the mammalian RNA polymerase II large subunit is important for its stability

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkh172

CTD52 is phosphorylated by CKII in vivo . ( A ) Polyclonal antibodies were raised against peptides encoding CTD52 (DEEN) and a phosphorylated version thereof (DEEP). The monoclonal antibody 8WG16 recognizes the CTD consensus sequence, YSPTSPS. ( B ) DEEN and DEEP antibodies discriminate between non-phosphorylated and CKII-phosphorylated CTD: CKII-treated and non-treated GST–CTD were examined following western blot for their reactivity against DEEN and DEEP antibodies. The reactivity with 8WG16 is included as a loading control. ( C ) The immunoreactivity of Pol II from HeLa cells following DRB, actinomycin D (ActD) or heat shock (HS) treatment (∅ = non-treated control). The monoclonal antibody POL 3/3 recognizes all forms of the Pol II LS since it recognizes an epitope outside of the CTD. ( D ) Treatment with alkaline phosphatase regenerates DEEN activity: cytosolic (Cytosol-X) and nuclear (Nuclear-X) HeLa cell extracts were treated with increasing amounts of alkaline phosphatase, and their reactivity, along with that of whole extract (Whole-X), against DEEN and POL 3/3 antibodies was compared following western blotting.
Figure Legend Snippet: CTD52 is phosphorylated by CKII in vivo . ( A ) Polyclonal antibodies were raised against peptides encoding CTD52 (DEEN) and a phosphorylated version thereof (DEEP). The monoclonal antibody 8WG16 recognizes the CTD consensus sequence, YSPTSPS. ( B ) DEEN and DEEP antibodies discriminate between non-phosphorylated and CKII-phosphorylated CTD: CKII-treated and non-treated GST–CTD were examined following western blot for their reactivity against DEEN and DEEP antibodies. The reactivity with 8WG16 is included as a loading control. ( C ) The immunoreactivity of Pol II from HeLa cells following DRB, actinomycin D (ActD) or heat shock (HS) treatment (∅ = non-treated control). The monoclonal antibody POL 3/3 recognizes all forms of the Pol II LS since it recognizes an epitope outside of the CTD. ( D ) Treatment with alkaline phosphatase regenerates DEEN activity: cytosolic (Cytosol-X) and nuclear (Nuclear-X) HeLa cell extracts were treated with increasing amounts of alkaline phosphatase, and their reactivity, along with that of whole extract (Whole-X), against DEEN and POL 3/3 antibodies was compared following western blotting.

Techniques Used: In Vivo, Sequencing, Western Blot, Activity Assay

68) Product Images from "Involvement of ASK1 in Ca2+-induced p38 MAP kinase activation"

Article Title: Involvement of ASK1 in Ca2+-induced p38 MAP kinase activation

Journal: EMBO Reports

doi: 10.1038/sj.embor.7400072

CaMKII activates ASK1. ( A ) CaMKII phosphorylates ASK1. GST-tagged kinase negative ASK1 (GST-ASK1KN) and/or CaMKII purified from rat forebrain (purchased from Upstate Bio) were incubated in a kinase buffer in the presence of 2 mM CaCl 2 /2.4 μM calmodulin and [γ- 32 P]ATP. Samples were subjected to SDS–PAGE followed by autoradiography (top panel) and immunoblotting with anti-GST (middle panel) and anti-phospho-CaMKII (bottom panel) antibodies. ( B ) CaMKII does not directly phosphorylate Thr 845 of ASK1. GST-ASK1 bound to glutathione sepharose beads was first treated with Lambda Protein Phosphatase (λPPase; purchased from NEB) to reduce the basal phosphorylation of Thr 845. After washing with PBS including PPase inhibitors, the beads were incubated with purified CaMKII in a kinase buffer in the presence of 2 mM CaCl 2 /2.4 μM calmodulin. Samples were subjected to SDS–PAGE followed by immunoblotting with anti-phospho-ASK1 (top panel), anti-GST (middle panel) and anti-phospho-CaMKII (bottom panel) antibodies. ( C ) CaMKII binds ASK1 and induces activating phosphorylation of ASK1 in the immune complex. HEK-293 cells were transfected with HA-tagged kinase negative ASK1 (HA-ASK1KN) and/or Flag-CaMKII. Cell lysates were immunoprecipitated with anti-Flag antibody. An immune complex kinase assay was performed in the presence of either 2 mM EGTA (Ca 2+ /CaM−) or 2 mM CaCl 2 /2.4 μM calmodulin (Ca 2+ /CaM+). The activated state and the amount of co-purified ASK1KN with CaMKII were detected by immunoblotting with anti-phospho-ASK1 (P-ASK1) and anti-HA antibodies, respectively (upper two panels). The immunoprecipitated Flag-CaMKII and the expression level of HA-ASK1KN were confirmed by immunoblotting with anti-Flag and anti-HA antibodies (lower two panels). ( D ) Activating phosphorylation of ASK1 by CaMKII is dependent on the kinase activity of CaMKII. HEK-293 cells were transfected with the indicated combination of HA-ASK1KN, Flag-CaMKII and Flag-tagged kinase negative CaMKII (Flag-CaMKIIKN). Cell lysates were immunoprecipitated with anti-Flag antibody followed by an immune complex kinase assay as described in (C). The activated state and the amount of co-purified ASK1KN with CaMKII were detected by immunoblotting with anti-phospho-ASK1 (P-ASK1) and anti-HA antibodies, respectively (upper two panels). The immunoprecipitated Flag-CaMKII and its activated state were confirmed by immunoblotting with anti-Flag and anti-phospho-CaMKII antibodies (lower two panels).
Figure Legend Snippet: CaMKII activates ASK1. ( A ) CaMKII phosphorylates ASK1. GST-tagged kinase negative ASK1 (GST-ASK1KN) and/or CaMKII purified from rat forebrain (purchased from Upstate Bio) were incubated in a kinase buffer in the presence of 2 mM CaCl 2 /2.4 μM calmodulin and [γ- 32 P]ATP. Samples were subjected to SDS–PAGE followed by autoradiography (top panel) and immunoblotting with anti-GST (middle panel) and anti-phospho-CaMKII (bottom panel) antibodies. ( B ) CaMKII does not directly phosphorylate Thr 845 of ASK1. GST-ASK1 bound to glutathione sepharose beads was first treated with Lambda Protein Phosphatase (λPPase; purchased from NEB) to reduce the basal phosphorylation of Thr 845. After washing with PBS including PPase inhibitors, the beads were incubated with purified CaMKII in a kinase buffer in the presence of 2 mM CaCl 2 /2.4 μM calmodulin. Samples were subjected to SDS–PAGE followed by immunoblotting with anti-phospho-ASK1 (top panel), anti-GST (middle panel) and anti-phospho-CaMKII (bottom panel) antibodies. ( C ) CaMKII binds ASK1 and induces activating phosphorylation of ASK1 in the immune complex. HEK-293 cells were transfected with HA-tagged kinase negative ASK1 (HA-ASK1KN) and/or Flag-CaMKII. Cell lysates were immunoprecipitated with anti-Flag antibody. An immune complex kinase assay was performed in the presence of either 2 mM EGTA (Ca 2+ /CaM−) or 2 mM CaCl 2 /2.4 μM calmodulin (Ca 2+ /CaM+). The activated state and the amount of co-purified ASK1KN with CaMKII were detected by immunoblotting with anti-phospho-ASK1 (P-ASK1) and anti-HA antibodies, respectively (upper two panels). The immunoprecipitated Flag-CaMKII and the expression level of HA-ASK1KN were confirmed by immunoblotting with anti-Flag and anti-HA antibodies (lower two panels). ( D ) Activating phosphorylation of ASK1 by CaMKII is dependent on the kinase activity of CaMKII. HEK-293 cells were transfected with the indicated combination of HA-ASK1KN, Flag-CaMKII and Flag-tagged kinase negative CaMKII (Flag-CaMKIIKN). Cell lysates were immunoprecipitated with anti-Flag antibody followed by an immune complex kinase assay as described in (C). The activated state and the amount of co-purified ASK1KN with CaMKII were detected by immunoblotting with anti-phospho-ASK1 (P-ASK1) and anti-HA antibodies, respectively (upper two panels). The immunoprecipitated Flag-CaMKII and its activated state were confirmed by immunoblotting with anti-Flag and anti-phospho-CaMKII antibodies (lower two panels).

Techniques Used: Purification, Incubation, SDS Page, Autoradiography, Transfection, Immunoprecipitation, Immune Complex Kinase Assay, Chick Chorioallantoic Membrane Assay, Expressing, Activity Assay

69) Product Images from "Control of mitochondrial homeostasis by endocytic regulatory proteins"

Article Title: Control of mitochondrial homeostasis by endocytic regulatory proteins

Journal: Journal of Cell Science

doi: 10.1242/jcs.204537

EHD1 interacts with Mul1. (A) Model for the potential role of EHD1 in regulating mitochondrial dynamics via Mul1. Under normal conditions, the ubiquitin ligase Mul1 is released from an interaction with VPS35 and the retromer components (including EHD1), and relocates to the mitochondrial membrane, where it ubiquitylates Mfn2, inducing its proteasomal degradation and promoting normal mitochondrial fission. Upon EHD1 depletion, Mul1 would be retained in association with VPS35 and the retromer, preventing Mfn2 degradation and thus enhancing mitochondrial membrane fusion. (B) GST pulldown from bovine brain cytosol was performed with GST only, a GST-tagged EH domain of EHD1 (GST–EH1) and GST–EHD1. Eluates were immunoblotted with antibodies against MICAL-L1 (top panel), as a positive interactor with EHD1, and Mul1 (middle panel). GST fusion protein samples were immunoblotted with anti-GST (bottom panel). (C) Co-immunoprecipitation (IP) of proteins from a HeLa cell lysate using anti-Mul1 (αMul1), and immunoblotted with anti-Vps26 and anti-rabankyrin-5 antibodies. 25 kDa immunoglobulin light chains detected by the secondary anti-light chain antibody are indicated in the bottom panel.
Figure Legend Snippet: EHD1 interacts with Mul1. (A) Model for the potential role of EHD1 in regulating mitochondrial dynamics via Mul1. Under normal conditions, the ubiquitin ligase Mul1 is released from an interaction with VPS35 and the retromer components (including EHD1), and relocates to the mitochondrial membrane, where it ubiquitylates Mfn2, inducing its proteasomal degradation and promoting normal mitochondrial fission. Upon EHD1 depletion, Mul1 would be retained in association with VPS35 and the retromer, preventing Mfn2 degradation and thus enhancing mitochondrial membrane fusion. (B) GST pulldown from bovine brain cytosol was performed with GST only, a GST-tagged EH domain of EHD1 (GST–EH1) and GST–EHD1. Eluates were immunoblotted with antibodies against MICAL-L1 (top panel), as a positive interactor with EHD1, and Mul1 (middle panel). GST fusion protein samples were immunoblotted with anti-GST (bottom panel). (C) Co-immunoprecipitation (IP) of proteins from a HeLa cell lysate using anti-Mul1 (αMul1), and immunoblotted with anti-Vps26 and anti-rabankyrin-5 antibodies. 25 kDa immunoglobulin light chains detected by the secondary anti-light chain antibody are indicated in the bottom panel.

Techniques Used: Immunoprecipitation

70) Product Images from "Functional Multimerization of Human Telomerase Requires an RNA Interaction Domain in the N Terminus of the Catalytic Subunit"

Article Title: Functional Multimerization of Human Telomerase Requires an RNA Interaction Domain in the N Terminus of the Catalytic Subunit

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.22.4.1253-1265.2002

N-terminal mutants are not defective in physical multimerization. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL or yeast in the presence of hTR were mixed and incubated on ice, and telomerase complexes were immunoprecipitated (IP) using a GST antibody. Immunoprecipitated hTERT/GST-hTERT complexes were examined for telomerase activity by TRAP (top panels) and for immunoprecipitation of hTERT and GST-hTERT proteins. WT, wild type. (A) N-terminal mutants interact equally with GST-hTERT D868N expressed in yeast. Equal amounts of yeast-expressed GST-hTERT D868N and RRL-expressed hTERT mutants were mixed and immunoprecipitated. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and in the absence of a GST antibody (lane 2). IC, internal control. (Middle panel) Immunoprecipitated GST-hTERT D868N was detected by Western blotting with anti-hTERT. (Bottom panel) Coimmunoprecipitated [ 35 S]-labeled hTERT N-terminal mutants were detected by SDS-PAGE. (B) N-terminal mutants interact equally with GST-hTERT D868N expressed in RRL. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL in the presence of hTR and [ 35 S]methionine were mixed and immunoprecipitated. Control reactions (lanes 3 and 4) were performed as described for panel A. (Bottom panel) Immunoprecipitated GST-hTERT D868N and coprecipitated hTERT mutants were detected by SDS-PAGE. GST-hTERT D868N and wild-type hTERT present in crude RRL prior to immunoprecipitation are shown in lanes 1 and 2, respectively.
Figure Legend Snippet: N-terminal mutants are not defective in physical multimerization. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL or yeast in the presence of hTR were mixed and incubated on ice, and telomerase complexes were immunoprecipitated (IP) using a GST antibody. Immunoprecipitated hTERT/GST-hTERT complexes were examined for telomerase activity by TRAP (top panels) and for immunoprecipitation of hTERT and GST-hTERT proteins. WT, wild type. (A) N-terminal mutants interact equally with GST-hTERT D868N expressed in yeast. Equal amounts of yeast-expressed GST-hTERT D868N and RRL-expressed hTERT mutants were mixed and immunoprecipitated. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and in the absence of a GST antibody (lane 2). IC, internal control. (Middle panel) Immunoprecipitated GST-hTERT D868N was detected by Western blotting with anti-hTERT. (Bottom panel) Coimmunoprecipitated [ 35 S]-labeled hTERT N-terminal mutants were detected by SDS-PAGE. (B) N-terminal mutants interact equally with GST-hTERT D868N expressed in RRL. Equal amounts of GST-hTERT D868N and hTERT mutants synthesized separately in RRL in the presence of hTR and [ 35 S]methionine were mixed and immunoprecipitated. Control reactions (lanes 3 and 4) were performed as described for panel A. (Bottom panel) Immunoprecipitated GST-hTERT D868N and coprecipitated hTERT mutants were detected by SDS-PAGE. GST-hTERT D868N and wild-type hTERT present in crude RRL prior to immunoprecipitation are shown in lanes 1 and 2, respectively.

Techniques Used: Synthesized, Incubation, Immunoprecipitation, Activity Assay, Western Blot, Labeling, SDS Page

Association of GST-hTERT mutants with wild-type and D868N hTERT. Yeast whole-cell extracts were made from S. cerevisiae expressing GST-hTERT fusion proteins (D868N, wild type [WT], and mutants, as indicated) in the presence of hTR. These extracts were mixed with RRL containing [ 35 S]-labeled hTERT proteins synthesized in the presence of hTR. hTERT/GST-hTERT complexes were immunoprecipitated (IP) using a GST antibody and were analyzed for telomerase activity by TRAP (top panels) and for coprecipitation of [ 35 S]-labeled hTERT by SDS-PAGE (bottom panels). IC, internal control. (A) GST-hTERT fusion proteins associate with wild-type hTERT. Extracts prepared from yeast expressing GST-hTERT N-terminal mutants or from the parental YPH499 strain and containing equal amounts of total cellular proteins were mixed with RRL expressing wild-type hTERT. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and to determine whether RRL containing only hTR could complement GST-hTERT D868N to reconstitute telomerase activity (lane 2). (B) GST-hTERT fusion proteins physically associate with D868N hTERT, but inactive N-terminal mutants cannot functionally complement the inactive D868N mutant to reconstitute telomerase activity. Extracts prepared from yeast expressing GST-hTERT mutants were mixed with [ 35 S]-labeled D868N hTERT synthesized in RRL and were analyzed as described above.
Figure Legend Snippet: Association of GST-hTERT mutants with wild-type and D868N hTERT. Yeast whole-cell extracts were made from S. cerevisiae expressing GST-hTERT fusion proteins (D868N, wild type [WT], and mutants, as indicated) in the presence of hTR. These extracts were mixed with RRL containing [ 35 S]-labeled hTERT proteins synthesized in the presence of hTR. hTERT/GST-hTERT complexes were immunoprecipitated (IP) using a GST antibody and were analyzed for telomerase activity by TRAP (top panels) and for coprecipitation of [ 35 S]-labeled hTERT by SDS-PAGE (bottom panels). IC, internal control. (A) GST-hTERT fusion proteins associate with wild-type hTERT. Extracts prepared from yeast expressing GST-hTERT N-terminal mutants or from the parental YPH499 strain and containing equal amounts of total cellular proteins were mixed with RRL expressing wild-type hTERT. Control reactions were performed to detect nonspecific immunoprecipitation of wild-type hTERT in the absence of GST-hTERT (lane 1) and to determine whether RRL containing only hTR could complement GST-hTERT D868N to reconstitute telomerase activity (lane 2). (B) GST-hTERT fusion proteins physically associate with D868N hTERT, but inactive N-terminal mutants cannot functionally complement the inactive D868N mutant to reconstitute telomerase activity. Extracts prepared from yeast expressing GST-hTERT mutants were mixed with [ 35 S]-labeled D868N hTERT synthesized in RRL and were analyzed as described above.

Techniques Used: Expressing, Labeling, Synthesized, Immunoprecipitation, Activity Assay, SDS Page, Mutagenesis

. Data identifying hTR interaction domains (RID1 and RID2) and regions required for trans complementation of the catalytically inactive RT domain mutant GST-hTERT D868N were derived from this study.
Figure Legend Snippet: . Data identifying hTR interaction domains (RID1 and RID2) and regions required for trans complementation of the catalytically inactive RT domain mutant GST-hTERT D868N were derived from this study.

Techniques Used: Mutagenesis, Derivative Assay

71) Product Images from "Complex Formation of Yeast Rev1 and Rev7 Proteins: a Novel Role for the Polymerase-Associated Domain"

Article Title: Complex Formation of Yeast Rev1 and Rev7 Proteins: a Novel Role for the Polymerase-Associated Domain

Journal:

doi: 10.1128/MCB.25.21.9734-9740.2005

Purification of Rev1-Rev7 complex. (A) Rev1 copurifies with the Rev7 protein. N-terminal GST-Rev1 fusion protein was overexpressed in a wild-type yeast strain and was purified first on glutathione-Sepharose beads and then on an S-Sepharose column. (i)
Figure Legend Snippet: Purification of Rev1-Rev7 complex. (A) Rev1 copurifies with the Rev7 protein. N-terminal GST-Rev1 fusion protein was overexpressed in a wild-type yeast strain and was purified first on glutathione-Sepharose beads and then on an S-Sepharose column. (i)

Techniques Used: Purification

72) Product Images from "Misfolding of Proteins with a Polyglutamine Expansion Is Facilitated by Proteasomal Chaperones *Misfolding of Proteins with a Polyglutamine Expansion Is Facilitated by Proteasomal Chaperones * S⃞"

Article Title: Misfolding of Proteins with a Polyglutamine Expansion Is Facilitated by Proteasomal Chaperones *Misfolding of Proteins with a Polyglutamine Expansion Is Facilitated by Proteasomal Chaperones * S⃞

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M806256200

The 19S enhances mutant Htt aggregation in vitro . A , time course of proteolysis of GST-Htt50ΔC with or without 19S and ATPγS. 0.5 μ m GST-Htt50Δ was cleaved with 10 units of thrombin in the absence or presence of 70 n m 19S and 15 m m ATPγS. Aliquots of the reaction were analyzed after 3.5, 6, or 8 h at 37 °C by SDS-PAGE stained with Coomassie Brilliant Blue. Note that GST and Htt50Δ co-migrate. B , samples shown in A were analyzed by filter retardation assays and revealed with Htt antibodies.
Figure Legend Snippet: The 19S enhances mutant Htt aggregation in vitro . A , time course of proteolysis of GST-Htt50ΔC with or without 19S and ATPγS. 0.5 μ m GST-Htt50Δ was cleaved with 10 units of thrombin in the absence or presence of 70 n m 19S and 15 m m ATPγS. Aliquots of the reaction were analyzed after 3.5, 6, or 8 h at 37 °C by SDS-PAGE stained with Coomassie Brilliant Blue. Note that GST and Htt50Δ co-migrate. B , samples shown in A were analyzed by filter retardation assays and revealed with Htt antibodies.

Techniques Used: Mutagenesis, In Vitro, SDS Page, Staining

73) Product Images from "Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment"

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

Journal: Traffic (Copenhagen, Denmark)

doi: 10.1111/j.1600-0854.2011.01226.x

Annexin A2, but not Annexins A1 or A6, interacts with APPL proteins A and B) HEK293 cells were co-transfected with the plasmid encoding bacterial biotin-protein ligase (BirA) and one of the plasmids encoding GFP, APPL2 or APPL1 tagged with a BirA target sequence (pBT-GFP, pBT-APPL2, pBT-mycAPPL2 or pBT-mycAPPL1). Forty-eight hours after transfection, cells were lysed and affinity purification of APPL-interacting proteins was performed with streptavidine-conjugated magnetic beads. A) Binding of Annexin A2 to in vivo biotinylated APPL1 or APPL2 proteins is shown. Samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for Annexin A2 (upper panel). B) Binding of Annexin A1 and Annexin A6 to in vivo biotinylated APPL1 or APPL2 proteins was tested. Samples were resolved on 10% SDS–PAGE and immunoblotted for Annexin A1 and Annexin A6, with Annexin A2 serving as a positive control. C) Migration of Annexins A1 and A6 in the OptiPrep density gradient. PNS sample adjusted to the final OptiPrep concentration 40.6% (w/v) was underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. Twenty-five fractions of equal volume (500 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2, Annexin A6, Annexin A1 and Annexin A2. D–F) GST pull-downs were performed with wild-type GST–Annexin A2 (GST–ANXA2) or GST alone with lysates from HEK293 cells overexpressing HA-APPL1 (D) and HA-APPL2 (E) or in vitro translated APPL2 (F). All samples were resolved on 8% SDS–PAGE and immunoblotted for APPL1 or APPL2, as indicated. As controls, 1 µL of cell lysates (1% of the input) was loaded in (D) and (E), and 1 µL in vitro translated protein (2% of the input) was loaded in F. G) GST pull-downs were performed with GST–Annexin A2 wild-type (GST–ANXA2) or mutants (TCM, Y23D, Y23A, CTΔ9, CTΔ13), or GST alone using lysates from HEK293 cells overexpressing HA-APPL2. All samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for APPL2 (upper panel). As a control, 1 µL of cell lysate (1% of the input) was loaded. MW, lane with a molecular weight marker.
Figure Legend Snippet: Annexin A2, but not Annexins A1 or A6, interacts with APPL proteins A and B) HEK293 cells were co-transfected with the plasmid encoding bacterial biotin-protein ligase (BirA) and one of the plasmids encoding GFP, APPL2 or APPL1 tagged with a BirA target sequence (pBT-GFP, pBT-APPL2, pBT-mycAPPL2 or pBT-mycAPPL1). Forty-eight hours after transfection, cells were lysed and affinity purification of APPL-interacting proteins was performed with streptavidine-conjugated magnetic beads. A) Binding of Annexin A2 to in vivo biotinylated APPL1 or APPL2 proteins is shown. Samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for Annexin A2 (upper panel). B) Binding of Annexin A1 and Annexin A6 to in vivo biotinylated APPL1 or APPL2 proteins was tested. Samples were resolved on 10% SDS–PAGE and immunoblotted for Annexin A1 and Annexin A6, with Annexin A2 serving as a positive control. C) Migration of Annexins A1 and A6 in the OptiPrep density gradient. PNS sample adjusted to the final OptiPrep concentration 40.6% (w/v) was underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. Twenty-five fractions of equal volume (500 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2, Annexin A6, Annexin A1 and Annexin A2. D–F) GST pull-downs were performed with wild-type GST–Annexin A2 (GST–ANXA2) or GST alone with lysates from HEK293 cells overexpressing HA-APPL1 (D) and HA-APPL2 (E) or in vitro translated APPL2 (F). All samples were resolved on 8% SDS–PAGE and immunoblotted for APPL1 or APPL2, as indicated. As controls, 1 µL of cell lysates (1% of the input) was loaded in (D) and (E), and 1 µL in vitro translated protein (2% of the input) was loaded in F. G) GST pull-downs were performed with GST–Annexin A2 wild-type (GST–ANXA2) or mutants (TCM, Y23D, Y23A, CTΔ9, CTΔ13), or GST alone using lysates from HEK293 cells overexpressing HA-APPL2. All samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for APPL2 (upper panel). As a control, 1 µL of cell lysate (1% of the input) was loaded. MW, lane with a molecular weight marker.

Techniques Used: Transfection, Plasmid Preparation, Sequencing, Affinity Purification, Magnetic Beads, Binding Assay, In Vivo, SDS Page, Staining, Positive Control, Migration, Concentration Assay, In Vitro, Molecular Weight, Marker

74) Product Images from "Chlamydophila felis CF0218 Is a Novel TMH Family Protein with Potential as a Diagnostic Antigen for Diagnosis of C. felis Infection ▿ Infection ▿ †"

Article Title: Chlamydophila felis CF0218 Is a Novel TMH Family Protein with Potential as a Diagnostic Antigen for Diagnosis of C. felis Infection ▿ Infection ▿ †

Journal:

doi: 10.1128/CVI.00134-08

Production of recombinant CF0218 and its immunogenicity. (A) Purified GST alone, GST-CF0218, and GST-cleaved CF0218 were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). (B to E) Equal amounts of recombinant CF0218 shown in panel
Figure Legend Snippet: Production of recombinant CF0218 and its immunogenicity. (A) Purified GST alone, GST-CF0218, and GST-cleaved CF0218 were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). (B to E) Equal amounts of recombinant CF0218 shown in panel

Techniques Used: Recombinant, Purification, SDS Page, Staining

75) Product Images from "Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy *Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy * S⃞"

Article Title: Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy *Cib2 Binds Integrin ?7B?1D and Is Reduced in Laminin ?2 Chain-deficient Muscular Dystrophy * S⃞

Journal:

doi: 10.1074/jbc.M801166200

In vitro binding of Cib2 to different integrin isoforms. A , binding of integrins α7B, β1D, α7A, and β1A to GST-Cib2 or BSA (control) coated wells. Each value is the mean of 16 wells. A significant interaction between
Figure Legend Snippet: In vitro binding of Cib2 to different integrin isoforms. A , binding of integrins α7B, β1D, α7A, and β1A to GST-Cib2 or BSA (control) coated wells. Each value is the mean of 16 wells. A significant interaction between

Techniques Used: In Vitro, Binding Assay

Related Articles

Centrifugation:

Article Title: The disintegrin domain of ADAM9: a ligand for multiple ?1 renal integrins
Article Snippet: The renal cortices were homogenized using a Polytron tissue homogenizer, tissue debris was removed by centrifugation at 250 g for 30 min at 4 °C, and the cortical extract was then frozen overnight at –70 °C. .. Rat cortical protein (200 μg≈100 μl) was added to 10 μg of DIS-GST, CYS-GST or GST alone (≈10 μl) in a final volume of 500 μl and incubated on ice for 4 h. This mixture was incubated with the glutathione-coupled Sepharose 4B matrix (Amersham Biosciences) overnight on a shaker at 4 °C.

Luciferase:

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: For SRC-1 Western blotting in parallel to luciferase assays, cells were lysed in cold lysis buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 5 mM EDTA [pH 8.0]), 0.5% NP-40, protease inhibitors as above). .. Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA).

Construct:

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity
Article Snippet: Full-length cDNAs of Bcl-xL, Bcl-xγ, and TCTP were previously fused in-frame to the C-terminus of GST by subcloning into the GST vector pGEX-3X (Amersham Biosciences, Piscataway, NJ, USA) ( ). .. A GST-TCTP N-terminal domain mutant was constructed from the WT pGEX-3X-TCTP vector using a QuickChange Site-directed Mutagenesis kit (Stratagene, La Jolla, CA, USA).

Incubation:

Article Title: The disintegrin domain of ADAM9: a ligand for multiple ?1 renal integrins
Article Snippet: .. Rat cortical protein (200 μg≈100 μl) was added to 10 μg of DIS-GST, CYS-GST or GST alone (≈10 μl) in a final volume of 500 μl and incubated on ice for 4 h. This mixture was incubated with the glutathione-coupled Sepharose 4B matrix (Amersham Biosciences) overnight on a shaker at 4 °C. .. The following day, the beads were separated by centrifugation at 1000 g , washed four times with PBS containing 1% Triton X-100 and eluted with reducing SDS sample buffer.

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer
Article Snippet: His-STK25, GST-GOLPH3, and GST were expressed and purified in accordance with the manufacturer’s instructions (Amersham). .. Then, 10 μg of His-STK25 was mixed with 10 μg of GST-GOLPH3 or GST and incubated with glutathione sepharose 4B beads (GE Healthcare) and Ni-NTA agarose (QIAGEN), respectively, for the GST pull-down and His-tag pull-down assays.

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens
Article Snippet: .. The supernatants were incubated with GST, GST-CPE-(116–319), GST-CPE-(194–319), or GST-CPE-(194–309) bound to glutathione-Sepharose beads (GE Healthcare) in mini columns (MoBiTec, Göttingen, Germany) for 30 min on a shaker at 4 °C. .. Beads were centrifuged (2 min, 500 × g , 4 °C) and the flow-through (unbound fraction) collected.

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences). .. GST and GST-Pin1 were incubated with the lysates overnight at 4°C, washed three times, and then separated by SDS-PAGE on 4–20% acrylamide gels.

Expressing:

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: Paragraph title: GST-Pin1 Protein Expression and Pulldown Assays ... GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences).

Western Blot:

Article Title: The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)
Article Snippet: GST pull-down and in vitro kinase assay In cells, GST and GST-SND1 or HA-PIM1 or HA-K67M were purified with glutathione-sepharose 4B beads (GE Healthcare, Little Chalfont, UK). .. Then, Western blot analysis was carried out to analyze the protein through the use of anti-HA and anti-GST.

Article Title: Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation
Article Snippet: Paragraph title: Western immunoblot analysis ... Dock7, as previously described , c-Met (c-12; Santa Cruz), Gab1 (Cell Signaling Technology, Inc.), GST (GE Healthcare, Piscataway, NJ, USA).

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer
Article Snippet: His-STK25, GST-GOLPH3, and GST were expressed and purified in accordance with the manufacturer’s instructions (Amersham). .. The bound proteins were loaded onto a 12% SDS-polyacrylamide gel and examined by western blot with anti-GST and anti-His tag (Beijing Zhongshan Golden Bridge Biotechnology Co Ltd., China).

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The pulled-down proteins were separated on 12% SDS-PAGE gels and detected by western blot using anti-MBP antibody (Abcam).

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Paragraph title: 2.4 Western blotting ... Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA).

Kinase Assay:

Article Title: The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)
Article Snippet: .. GST pull-down and in vitro kinase assay In cells, GST and GST-SND1 or HA-PIM1 or HA-K67M were purified with glutathione-sepharose 4B beads (GE Healthcare, Little Chalfont, UK). ..

Transfection:

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens
Article Snippet: Two to 3 days after transfection, cells were washed with ice-cold PBS, with Ca2+ and Mg2+ , scraped, harvested (300 × g , 5 min, 4 °C), and quick frozen in liquid nitrogen. .. The supernatants were incubated with GST, GST-CPE-(116–319), GST-CPE-(194–319), or GST-CPE-(194–309) bound to glutathione-Sepharose beads (GE Healthcare) in mini columns (MoBiTec, Göttingen, Germany) for 30 min on a shaker at 4 °C.

Protease Inhibitor:

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens
Article Snippet: The cells were lysed (1% Triton X-100 in PBS, EDTA-free protease inhibitor mixture (Roche), 0.1 m m phenylmethylsulfonyl fluoride), incubated on ice for 10 min, and centrifuged (5 min, 10,000 × g , 4 °C). .. The supernatants were incubated with GST, GST-CPE-(116–319), GST-CPE-(194–319), or GST-CPE-(194–309) bound to glutathione-Sepharose beads (GE Healthcare) in mini columns (MoBiTec, Göttingen, Germany) for 30 min on a shaker at 4 °C.

Generated:

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA). .. For detection of phosphorylated T1426, a rabbit polyclonal antibody raised against the peptide CPTSGPQ(pT)PQAQQ was generated and epitope purified by Bethyl Laboratories (Montgomery, TX).

other:

Article Title: Y-box protein-associated acidic protein (YBAP1/C1QBP) affects the localization and cytoplasmic functions of YB-1
Article Snippet: Antibodies against PABP (Novus), eIF4E (Santa Cruz), FLAG (mouse monoclonal clone M2 and rabbit polyclonal antibodies, Sigma) and GST (GE Healthcare) were purchased from the indicated suppliers.

Polymerase Chain Reaction:

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity
Article Snippet: Full-length cDNAs of Bcl-xL, Bcl-xγ, and TCTP were previously fused in-frame to the C-terminus of GST by subcloning into the GST vector pGEX-3X (Amersham Biosciences, Piscataway, NJ, USA) ( ). .. Full-length TCTP was prepared by using a high-fidelity PCR (BD Clontech) with the TCTP cDNA as the template and two TCTP primers, including the sense primer GST-TCTP5 specific for the 5′ end of the TCTP ORF and the antisense primer GST-TCTP3 specific for the 3′ end of the TCTP ORF (5′ GGCCGGGAATTC TTAACATTTCTCCATCTCTAAG CCATC3′).

Recombinant:

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: .. Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The pulled-down proteins were separated on 12% SDS-PAGE gels and detected by western blot using anti-MBP antibody (Abcam).

Immunofluorescence:

Article Title: A role for nuclear lamins in nuclear envelope assembly
Article Snippet: Paragraph title: Immunofluorescence techniques ... GST fusion proteins were detected with an mAb directed against GST (Amersham Pharmacia Biotech).

Nucleic Acid Electrophoresis:

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose membrane. .. Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA).

Pull Down Assay:

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: .. Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The pulled-down proteins were separated on 12% SDS-PAGE gels and detected by western blot using anti-MBP antibody (Abcam).

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens
Article Snippet: Paragraph title: Pull-down Assay ... The supernatants were incubated with GST, GST-CPE-(116–319), GST-CPE-(194–319), or GST-CPE-(194–309) bound to glutathione-Sepharose beads (GE Healthcare) in mini columns (MoBiTec, Göttingen, Germany) for 30 min on a shaker at 4 °C.

Mutagenesis:

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity
Article Snippet: Full-length cDNAs of Bcl-xL, Bcl-xγ, and TCTP were previously fused in-frame to the C-terminus of GST by subcloning into the GST vector pGEX-3X (Amersham Biosciences, Piscataway, NJ, USA) ( ). .. A GST-TCTP N-terminal domain mutant was constructed from the WT pGEX-3X-TCTP vector using a QuickChange Site-directed Mutagenesis kit (Stratagene, La Jolla, CA, USA).

Subcloning:

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity
Article Snippet: .. Full-length cDNAs of Bcl-xL, Bcl-xγ, and TCTP were previously fused in-frame to the C-terminus of GST by subcloning into the GST vector pGEX-3X (Amersham Biosciences, Piscataway, NJ, USA) ( ). .. Full-length TCTP was prepared by using a high-fidelity PCR (BD Clontech) with the TCTP cDNA as the template and two TCTP primers, including the sense primer GST-TCTP5 specific for the 5′ end of the TCTP ORF and the antisense primer GST-TCTP3 specific for the 3′ end of the TCTP ORF (5′ GGCCGGGAATTC TTAACATTTCTCCATCTCTAAG CCATC3′).

Flow Cytometry:

Article Title: Molecular Determinants of the Interaction between Clostridium perfringens
Article Snippet: The supernatants were incubated with GST, GST-CPE-(116–319), GST-CPE-(194–319), or GST-CPE-(194–309) bound to glutathione-Sepharose beads (GE Healthcare) in mini columns (MoBiTec, Göttingen, Germany) for 30 min on a shaker at 4 °C. .. Beads were centrifuged (2 min, 500 × g , 4 °C) and the flow-through (unbound fraction) collected.

Purification:

Article Title: The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)
Article Snippet: .. GST pull-down and in vitro kinase assay In cells, GST and GST-SND1 or HA-PIM1 or HA-K67M were purified with glutathione-sepharose 4B beads (GE Healthcare, Little Chalfont, UK). ..

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer
Article Snippet: .. His-STK25, GST-GOLPH3, and GST were expressed and purified in accordance with the manufacturer’s instructions (Amersham). .. Then, 10 μg of His-STK25 was mixed with 10 μg of GST-GOLPH3 or GST and incubated with glutathione sepharose 4B beads (GE Healthcare) and Ni-NTA agarose (QIAGEN), respectively, for the GST pull-down and His-tag pull-down assays.

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: .. Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The pulled-down proteins were separated on 12% SDS-PAGE gels and detected by western blot using anti-MBP antibody (Abcam).

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: .. GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences). .. Purified GST and GST-Pin (20 mg of each) were then used in GST-pulldown assays from rat brain lysates.

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA). .. For detection of phosphorylated T1426, a rabbit polyclonal antibody raised against the peptide CPTSGPQ(pT)PQAQQ was generated and epitope purified by Bethyl Laboratories (Montgomery, TX).

Blocking Assay:

Article Title: The disintegrin domain of ADAM9: a ligand for multiple ?1 renal integrins
Article Snippet: Rat cortical protein (200 μg≈100 μl) was added to 10 μg of DIS-GST, CYS-GST or GST alone (≈10 μl) in a final volume of 500 μl and incubated on ice for 4 h. This mixture was incubated with the glutathione-coupled Sepharose 4B matrix (Amersham Biosciences) overnight on a shaker at 4 °C. .. The membranes were blocked in PBS containing 0.5% casein and 0.5% Tween for 4 h at 4 °C and washed with blocking buffer.

Polyacrylamide Gel Electrophoresis:

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose membrane. .. Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA).

Staining:

Article Title: A role for nuclear lamins in nuclear envelope assembly
Article Snippet: GST fusion proteins were detected with an mAb directed against GST (Amersham Pharmacia Biotech). .. Membranes were stained with the lipophilic dye DiOC6 (2.5 μg/ml) ( ).

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The GST and GST fusion proteins were detected by Coomassie Brilliant Blue stain.

SDS Page:

Article Title: Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors
Article Snippet: Pull-down Assay The recombinant GST and MBP tag proteins were purified using GST- (GE Healthcare) or MBP-Trap ( New England Biolabs ) according to the manufacturer’s instructions. .. The pulled-down proteins were separated on 12% SDS-PAGE gels and detected by western blot using anti-MBP antibody (Abcam).

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences). .. GST and GST-Pin1 were incubated with the lysates overnight at 4°C, washed three times, and then separated by SDS-PAGE on 4–20% acrylamide gels.

Plasmid Preparation:

Article Title: An N-terminal region of translationally controlled tumor protein is required for its antiapoptotic activity
Article Snippet: .. Full-length cDNAs of Bcl-xL, Bcl-xγ, and TCTP were previously fused in-frame to the C-terminus of GST by subcloning into the GST vector pGEX-3X (Amersham Biosciences, Piscataway, NJ, USA) ( ). .. Full-length TCTP was prepared by using a high-fidelity PCR (BD Clontech) with the TCTP cDNA as the template and two TCTP primers, including the sense primer GST-TCTP5 specific for the 5′ end of the TCTP ORF and the antisense primer GST-TCTP3 specific for the 3′ end of the TCTP ORF (5′ GGCCGGGAATTC TTAACATTTCTCCATCTCTAAG CCATC3′).

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer
Article Snippet: The pGEX-4 T-1-GOLPH3 plasmid has been described [ ]. .. His-STK25, GST-GOLPH3, and GST were expressed and purified in accordance with the manufacturer’s instructions (Amersham).

Software:

Article Title: Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation
Article Snippet: Dock7, as previously described , c-Met (c-12; Santa Cruz), Gab1 (Cell Signaling Technology, Inc.), GST (GE Healthcare, Piscataway, NJ, USA). .. Films were scanned and bands quantified by densitometry using the ImageJ software.

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA). .. Band intensity was measured using ImageJ software version 1.40g ( ).

Positron Emission Tomography:

Article Title: STK25-induced inhibition of aerobic glycolysis via GOLPH3-mTOR pathway suppresses cell proliferation in colorectal cancer
Article Snippet: GST pull-down and his-tag pull-down assays Human STK25 was inserted into the pET-28a(+) vector. .. His-STK25, GST-GOLPH3, and GST were expressed and purified in accordance with the manufacturer’s instructions (Amersham).

In Vitro:

Article Title: The Oncogene PIM1 Contributes to Cellular Senescence by Phosphorylating Staphylococcal Nuclease Domain-Containing Protein 1 (SND1)
Article Snippet: .. GST pull-down and in vitro kinase assay In cells, GST and GST-SND1 or HA-PIM1 or HA-K67M were purified with glutathione-sepharose 4B beads (GE Healthcare, Little Chalfont, UK). ..

Immunoprecipitation:

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences). .. Rat brain lysates, 10%, were prepared in immunoprecipitation (IP) lysis buffer containing 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 5 mg/ml leupeptin, 2 mg/ml aprotinin, 5 mg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride (PMSF) described previously ( ).

Lysis:

Article Title: Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Article Snippet: GST and GST-Pin1 were expressed in Escherichia coli and purified according to the manufacturer's instructions (Amersham Biosciences). .. Rat brain lysates, 10%, were prepared in immunoprecipitation (IP) lysis buffer containing 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 5 mg/ml leupeptin, 2 mg/ml aprotinin, 5 mg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride (PMSF) described previously ( ).

Article Title: REGULATION OF PROGESTERONE RECEPTOR ACTIVITY BY CYCLIN DEPENDENT KINASES 1 AND 2 OCCURS IN PART BY PHOSPHORYLATION OF THE SRC-1 CARBOXYL-TERMINUS
Article Snippet: For SRC-1 Western blotting in parallel to luciferase assays, cells were lysed in cold lysis buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 5 mM EDTA [pH 8.0]), 0.5% NP-40, protease inhibitors as above). .. Primary antibodies used were: PR 1294 (provided by Dr. Dean Edwards, Baylor College of Medicine, described in ( )), actin (Chemicon, Temecula, CA), Cdk2 (Santa Cruz Biotechnology, Santa Cruz, CA), Cdk1 (Cell Signaling Technology, Danvers, MA), GST (GE Healthcare, Buckinghamshire, England), SRC-1 (BD Biosciences, San Jose, CA), FLAG (Sigma, St Louis, MO) and beta-tubulin (Upstate, Billerica, MA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    GE Healthcare gst tag
    Western blot analysis of recombinant <t>VCAM-1-GST</t> protein. M – prestained protein marker; 2 – anti-GST antibody as the first antibody
    Gst Tag, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 692 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst tag/product/GE Healthcare
    Average 99 stars, based on 692 article reviews
    Price from $9.99 to $1999.99
    gst tag - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    GE Healthcare gst column
    Quantitative measurement confirms that BD 245 work together to create high affinity to H3K14ac. (A) The indicated <t>GST</t> ‐ BD constructs of PBRM 1 were expressed and purified from <t>Escherichia</t> coli , pulled down by the indicated peptides, and immunoblotted with anti‐ GST antibody. (B) The bands in (A) were quantified with NIH ImageJ, and the ratios of bands associated with H3K14ac/H3 were calculated from three experiments. The P ‐values were calculated using the two‐tailed Student's t ‐test. *: P
    Gst Column, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst column/product/GE Healthcare
    Average 93 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    gst column - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    GE Healthcare gst tagged gli1 deletion proteins
    <t>GLI1</t> interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e <t>GST</t> pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6
    Gst Tagged Gli1 Deletion Proteins, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst tagged gli1 deletion proteins/product/GE Healthcare
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst tagged gli1 deletion proteins - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    95
    GE Healthcare gst tagged erα
    Ajuba interacts with <t>ERα</t> independent of the conserved NR boxes. ( A ) The three conserved NR-boxes in Ajuba were shown on the upper panel. Plasmids were transiently transfected into 293T cells and the co-IP assay was carried out with Myc antibody. * IgG-heavy chain. ( B ) Flag-ERα and Myc-Ajuba plasmids were transfected into 293T cells and co-IP assay was performed by using Flag-M2-beads. ( C ) The preLIM and LIM regions of Ajuba were illustrated on the upper panel. The full length or truncations of Ajuba were transiently co-transfected into 293T cells together with Flag-ERα plasmid. The co-IP assay was performed by using Flag antibody. ( D ) The functional domains of ERα were shown on the upper panel. The interaction between full-length or truncations of ERα with Ajuba in 293T cells was detected by co-IP assay and western blotting. The relative amount of co-eluted Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( E ) The plasmids encoding Ajuba, LIMD1, Zyxin, Wtip and Lpp were respectively co-transfected with Flag-ERα plasmid into 293T cells and co-IP assay was performed. ( F ) The plasmids encoding Flag-ERα and Myc-Ajuba were transfected into 293T cells, and the resulting cells were cultured in phenol-red free media containing 5% charcoal stripped FBS for 2 days and then treated with E2 (20 or 100 nM) or ethanol for 12 h. The co-IP assay was performed by using Flag-M2 beads. The relative amount of immunoprecipitated Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( G ) <t>GST-ERα</t> and His-Ajuba proteins were expressed in E. coli BL21, and GST-pulldown assay was performed in the presence of E2 (100 nM) or ethanol. The relative amount of pulled-down His-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( H ) T47D cells treated with 100 nM E2 or ethanol for 12 h were harvested and co-IP assay was performed by using ERα antibody or IgG control. The relative amount of immunoprecipitated Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled.
    Gst Tagged Erα, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst tagged erα/product/GE Healthcare
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gst tagged erα - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Western blot analysis of recombinant VCAM-1-GST protein. M – prestained protein marker; 2 – anti-GST antibody as the first antibody

    Journal: Journal of Veterinary Research

    Article Title: Expression of Vascular Cell Adhesion Molecule 1 (VCAM-1) in the Mammary Lymph Nodes of Cows with Subclinical Mastitis

    doi: 10.1515/jvetres-2017-0026

    Figure Lengend Snippet: Western blot analysis of recombinant VCAM-1-GST protein. M – prestained protein marker; 2 – anti-GST antibody as the first antibody

    Article Snippet: Purification of the recombinant VCAM-1 protein Recombinant VCAM-1 protein with the His tag was purified using His GraviTrap (GE Biosciences, Sweden) and recombinant VCAM-1 protein with the GST tag was purified using Gluthathione-Sepharose 4B (GE Healthcare, USA), following kit protocols for both purifications.

    Techniques: Western Blot, Recombinant, Marker

    Western blot analysis of VCAM-1-His Polyclonal antibody to identify recombinant VCAM-1-GST protein. M – prestained protein marker; 1 – GST; 2 – VCAM-1-GST

    Journal: Journal of Veterinary Research

    Article Title: Expression of Vascular Cell Adhesion Molecule 1 (VCAM-1) in the Mammary Lymph Nodes of Cows with Subclinical Mastitis

    doi: 10.1515/jvetres-2017-0026

    Figure Lengend Snippet: Western blot analysis of VCAM-1-His Polyclonal antibody to identify recombinant VCAM-1-GST protein. M – prestained protein marker; 1 – GST; 2 – VCAM-1-GST

    Article Snippet: Purification of the recombinant VCAM-1 protein Recombinant VCAM-1 protein with the His tag was purified using His GraviTrap (GE Biosciences, Sweden) and recombinant VCAM-1 protein with the GST tag was purified using Gluthathione-Sepharose 4B (GE Healthcare, USA), following kit protocols for both purifications.

    Techniques: Western Blot, Recombinant, Marker

    Expression of GST-VCAM-1 analysed by 12% SDS–PAGE. Lane1 – whole lysate of cells harbouring pGEX-4T-1-VCAM-1 without IPTG induction; Lanes 2 and 3 – whole lysate of cells harbouring pGEX-4T-1-VCAM-1 after IPTG induction

    Journal: Journal of Veterinary Research

    Article Title: Expression of Vascular Cell Adhesion Molecule 1 (VCAM-1) in the Mammary Lymph Nodes of Cows with Subclinical Mastitis

    doi: 10.1515/jvetres-2017-0026

    Figure Lengend Snippet: Expression of GST-VCAM-1 analysed by 12% SDS–PAGE. Lane1 – whole lysate of cells harbouring pGEX-4T-1-VCAM-1 without IPTG induction; Lanes 2 and 3 – whole lysate of cells harbouring pGEX-4T-1-VCAM-1 after IPTG induction

    Article Snippet: Purification of the recombinant VCAM-1 protein Recombinant VCAM-1 protein with the His tag was purified using His GraviTrap (GE Biosciences, Sweden) and recombinant VCAM-1 protein with the GST tag was purified using Gluthathione-Sepharose 4B (GE Healthcare, USA), following kit protocols for both purifications.

    Techniques: Expressing, SDS Page

    Quantitative measurement confirms that BD 245 work together to create high affinity to H3K14ac. (A) The indicated GST ‐ BD constructs of PBRM 1 were expressed and purified from Escherichia coli , pulled down by the indicated peptides, and immunoblotted with anti‐ GST antibody. (B) The bands in (A) were quantified with NIH ImageJ, and the ratios of bands associated with H3K14ac/H3 were calculated from three experiments. The P ‐values were calculated using the two‐tailed Student's t ‐test. *: P

    Journal: Molecular Oncology

    Article Title: High affinity binding of H3K14ac through collaboration of bromodomains 2, 4 and 5 is critical for the molecular and tumor suppressor functions of PBRM1

    doi: 10.1002/1878-0261.12434

    Figure Lengend Snippet: Quantitative measurement confirms that BD 245 work together to create high affinity to H3K14ac. (A) The indicated GST ‐ BD constructs of PBRM 1 were expressed and purified from Escherichia coli , pulled down by the indicated peptides, and immunoblotted with anti‐ GST antibody. (B) The bands in (A) were quantified with NIH ImageJ, and the ratios of bands associated with H3K14ac/H3 were calculated from three experiments. The P ‐values were calculated using the two‐tailed Student's t ‐test. *: P

    Article Snippet: 2.2 Protein expression and purification Polybromo‐1 constructs consisting of BD2, BD4, BD234, and BD245 were subcloned into pGST parallel expression vectors (Sheffield et al ., ) individually expressed in Escherichia coli strain BL21, purified over a GST column (GE Healthcare, Pittsburgh, PA, USA; Catalog #17‐5130‐01), eluted with 10 mm reduced glutathione, and dialyzed against 2 L of dialysis buffer (25 mm Tris/HCl, 500 mm NaCl, pH 8.0) to remove glutathione.

    Techniques: Construct, Purification, Two Tailed Test

    GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

    Journal: Communications Biology

    Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

    doi: 10.1038/s42003-018-0275-4

    Figure Lengend Snippet: GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

    Article Snippet: To generate GST-tagged GLI1 deletion proteins, GLI1 cDNA fragments were subcloned by PCR and inserted into the pGEX-6P-1 vector (GE Healthcare).

    Techniques: Activation Assay, Transfection, Plasmid Preparation, Immunoprecipitation, Binding Assay, Incubation

    MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. 4 . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

    Journal: Communications Biology

    Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

    doi: 10.1038/s42003-018-0275-4

    Figure Lengend Snippet: MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. 4 . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

    Article Snippet: To generate GST-tagged GLI1 deletion proteins, GLI1 cDNA fragments were subcloned by PCR and inserted into the pGEX-6P-1 vector (GE Healthcare).

    Techniques: Methylation, Stable Transfection, Recombinant, Transfection, Cell Culture, Immunoprecipitation, In Vitro, Expressing, Plasmid Preparation, Incubation, Mutagenesis, Staining

    Ajuba interacts with ERα independent of the conserved NR boxes. ( A ) The three conserved NR-boxes in Ajuba were shown on the upper panel. Plasmids were transiently transfected into 293T cells and the co-IP assay was carried out with Myc antibody. * IgG-heavy chain. ( B ) Flag-ERα and Myc-Ajuba plasmids were transfected into 293T cells and co-IP assay was performed by using Flag-M2-beads. ( C ) The preLIM and LIM regions of Ajuba were illustrated on the upper panel. The full length or truncations of Ajuba were transiently co-transfected into 293T cells together with Flag-ERα plasmid. The co-IP assay was performed by using Flag antibody. ( D ) The functional domains of ERα were shown on the upper panel. The interaction between full-length or truncations of ERα with Ajuba in 293T cells was detected by co-IP assay and western blotting. The relative amount of co-eluted Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( E ) The plasmids encoding Ajuba, LIMD1, Zyxin, Wtip and Lpp were respectively co-transfected with Flag-ERα plasmid into 293T cells and co-IP assay was performed. ( F ) The plasmids encoding Flag-ERα and Myc-Ajuba were transfected into 293T cells, and the resulting cells were cultured in phenol-red free media containing 5% charcoal stripped FBS for 2 days and then treated with E2 (20 or 100 nM) or ethanol for 12 h. The co-IP assay was performed by using Flag-M2 beads. The relative amount of immunoprecipitated Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( G ) GST-ERα and His-Ajuba proteins were expressed in E. coli BL21, and GST-pulldown assay was performed in the presence of E2 (100 nM) or ethanol. The relative amount of pulled-down His-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( H ) T47D cells treated with 100 nM E2 or ethanol for 12 h were harvested and co-IP assay was performed by using ERα antibody or IgG control. The relative amount of immunoprecipitated Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled.

    Journal: Nucleic Acids Research

    Article Title: The LIM protein Ajuba recruits DBC1 and CBP/p300 to acetylate ERα and enhances ERα target gene expression in breast cancer cells

    doi: 10.1093/nar/gky1306

    Figure Lengend Snippet: Ajuba interacts with ERα independent of the conserved NR boxes. ( A ) The three conserved NR-boxes in Ajuba were shown on the upper panel. Plasmids were transiently transfected into 293T cells and the co-IP assay was carried out with Myc antibody. * IgG-heavy chain. ( B ) Flag-ERα and Myc-Ajuba plasmids were transfected into 293T cells and co-IP assay was performed by using Flag-M2-beads. ( C ) The preLIM and LIM regions of Ajuba were illustrated on the upper panel. The full length or truncations of Ajuba were transiently co-transfected into 293T cells together with Flag-ERα plasmid. The co-IP assay was performed by using Flag antibody. ( D ) The functional domains of ERα were shown on the upper panel. The interaction between full-length or truncations of ERα with Ajuba in 293T cells was detected by co-IP assay and western blotting. The relative amount of co-eluted Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( E ) The plasmids encoding Ajuba, LIMD1, Zyxin, Wtip and Lpp were respectively co-transfected with Flag-ERα plasmid into 293T cells and co-IP assay was performed. ( F ) The plasmids encoding Flag-ERα and Myc-Ajuba were transfected into 293T cells, and the resulting cells were cultured in phenol-red free media containing 5% charcoal stripped FBS for 2 days and then treated with E2 (20 or 100 nM) or ethanol for 12 h. The co-IP assay was performed by using Flag-M2 beads. The relative amount of immunoprecipitated Myc-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( G ) GST-ERα and His-Ajuba proteins were expressed in E. coli BL21, and GST-pulldown assay was performed in the presence of E2 (100 nM) or ethanol. The relative amount of pulled-down His-Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled. ( H ) T47D cells treated with 100 nM E2 or ethanol for 12 h were harvested and co-IP assay was performed by using ERα antibody or IgG control. The relative amount of immunoprecipitated Ajuba was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled.

    Article Snippet: GST-tagged ERα or DBC1and His tagged Ajuba were expressed in BL21 respectively, and purified by Glutathione Sepharose beads (17-0756-01, GE Healthcare) or Ni-beads (17-5318-06, GE Healthcare).

    Techniques: Transfection, Co-Immunoprecipitation Assay, Plasmid Preparation, Functional Assay, Western Blot, Labeling, Cell Culture, Immunoprecipitation, GST Pulldown Assay

    Ajuba recruits DBC1 to enhance ERα transcriptional activity. (A, B) plasmids encoding DBC1 and Ajuba were transfected into 293T cells and co-IP assay was performed by using Myc antibody ( A ) or Flag-M2-beads ( B ). ( C ) The endogenous interaction between DBC1 and Ajuba was detected in T47D cells by co-IP assay. ( D ) GST-DBC1 and His-Ajuba was respectively expressed in E. coli BL21, and in vitro binding assay was performed. ( E ) The plasmids of full-length and truncations of Ajuba protein were co-transfected into 293T cells with DBC1 plasmids and co-IP assay was carried out. ( F ) Increasing amount of plasmids encoding Ajuba were co-expressed along with DBC1 and ERα in 293T cells and co-IP assay showed that Ajuba enhanced the interaction between DBC1 and ERα (the relative amount of immunoprecipitated HA-DBC1 was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled). ( G ) TFF1 promoter driven luciferase reporter assay was performed in 293T cells and the transfected cells were treated with 20 nM E2 before detecting luciferase activity and the value was normalized to β-gal (three repeats, * means P

    Journal: Nucleic Acids Research

    Article Title: The LIM protein Ajuba recruits DBC1 and CBP/p300 to acetylate ERα and enhances ERα target gene expression in breast cancer cells

    doi: 10.1093/nar/gky1306

    Figure Lengend Snippet: Ajuba recruits DBC1 to enhance ERα transcriptional activity. (A, B) plasmids encoding DBC1 and Ajuba were transfected into 293T cells and co-IP assay was performed by using Myc antibody ( A ) or Flag-M2-beads ( B ). ( C ) The endogenous interaction between DBC1 and Ajuba was detected in T47D cells by co-IP assay. ( D ) GST-DBC1 and His-Ajuba was respectively expressed in E. coli BL21, and in vitro binding assay was performed. ( E ) The plasmids of full-length and truncations of Ajuba protein were co-transfected into 293T cells with DBC1 plasmids and co-IP assay was carried out. ( F ) Increasing amount of plasmids encoding Ajuba were co-expressed along with DBC1 and ERα in 293T cells and co-IP assay showed that Ajuba enhanced the interaction between DBC1 and ERα (the relative amount of immunoprecipitated HA-DBC1 was semi-quantified by grayscale analysis and the mean values of the three repeats were labeled). ( G ) TFF1 promoter driven luciferase reporter assay was performed in 293T cells and the transfected cells were treated with 20 nM E2 before detecting luciferase activity and the value was normalized to β-gal (three repeats, * means P

    Article Snippet: GST-tagged ERα or DBC1and His tagged Ajuba were expressed in BL21 respectively, and purified by Glutathione Sepharose beads (17-0756-01, GE Healthcare) or Ni-beads (17-5318-06, GE Healthcare).

    Techniques: Activity Assay, Transfection, Co-Immunoprecipitation Assay, In Vitro, Binding Assay, Immunoprecipitation, Labeling, Luciferase, Reporter Assay