Structured Review

Santa Cruz Biotechnology glyceraldehyde 3 phosphate dehydrogenase
HDAC4 is a miR-10a target during SMC differentiation from ESCs. Mouse ESCs were transfected with miR-10a mimic or mimic negative control ( NC ) and treated with RA for 6 days. A , cells were harvested at day 6, and cell lysate was used for the Western blot with an anti-HDAC4 antibody, or an <t>anti-glyceraldehyde-3-phosphate</t> dehydrogenase ( GAPDH ) antibody was used as the internal control. Representative Western blots are shown. B , either wild type or mutant HDAC4–3′-UTR reporter constructs were cotransfected into HEK 293 cells together with miR-10a mimic or mimic negative control ( NC ), as indicated. Forty-eight hours after transfection, cells were lysed, and luciferase activity was determined. Individual luciferase activity was normalized to the responding TK promoter- Renilla -luciferase activity. Relative luciferase activities were expressed as the mean ± S.D. Data shown are representative samples from at least three independent experiments, each done in triplicate. *, p
Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 323 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase/product/Santa Cruz Biotechnology
Average 99 stars, based on 323 article reviews
Price from $9.99 to $1999.99
glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-03
99/100 stars

Images

1) Product Images from "miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *"

Article Title: miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.095612

HDAC4 is a miR-10a target during SMC differentiation from ESCs. Mouse ESCs were transfected with miR-10a mimic or mimic negative control ( NC ) and treated with RA for 6 days. A , cells were harvested at day 6, and cell lysate was used for the Western blot with an anti-HDAC4 antibody, or an anti-glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) antibody was used as the internal control. Representative Western blots are shown. B , either wild type or mutant HDAC4–3′-UTR reporter constructs were cotransfected into HEK 293 cells together with miR-10a mimic or mimic negative control ( NC ), as indicated. Forty-eight hours after transfection, cells were lysed, and luciferase activity was determined. Individual luciferase activity was normalized to the responding TK promoter- Renilla -luciferase activity. Relative luciferase activities were expressed as the mean ± S.D. Data shown are representative samples from at least three independent experiments, each done in triplicate. *, p
Figure Legend Snippet: HDAC4 is a miR-10a target during SMC differentiation from ESCs. Mouse ESCs were transfected with miR-10a mimic or mimic negative control ( NC ) and treated with RA for 6 days. A , cells were harvested at day 6, and cell lysate was used for the Western blot with an anti-HDAC4 antibody, or an anti-glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) antibody was used as the internal control. Representative Western blots are shown. B , either wild type or mutant HDAC4–3′-UTR reporter constructs were cotransfected into HEK 293 cells together with miR-10a mimic or mimic negative control ( NC ), as indicated. Forty-eight hours after transfection, cells were lysed, and luciferase activity was determined. Individual luciferase activity was normalized to the responding TK promoter- Renilla -luciferase activity. Relative luciferase activities were expressed as the mean ± S.D. Data shown are representative samples from at least three independent experiments, each done in triplicate. *, p

Techniques Used: Transfection, Negative Control, Western Blot, Mutagenesis, Construct, Luciferase, Activity Assay

2) Product Images from "Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model"

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model

Journal: Neurotherapeutics

doi: 10.1007/s13311-017-0550-y

Western blot analysis after early long-term fingolimod treatment (ELTT). (a) Representative panel of Western blotting experiments on the effect of an ELTT with fingolimod (Fing.) on the expression level in the cortex, of phosphorylated (p) Akt; (b) phosphorylated mammalian target of rapamycin (p-mTOR); (c) and phosphorylated p70S6K (p-p70S6K). Columns represent mean relative protein levels normalized to control ( n  = 6 per group). Loading was normalized using glyceraldehyde 3-phosphate dehydrogenase (GADPH) levels. *Significantly different ( p
Figure Legend Snippet: Western blot analysis after early long-term fingolimod treatment (ELTT). (a) Representative panel of Western blotting experiments on the effect of an ELTT with fingolimod (Fing.) on the expression level in the cortex, of phosphorylated (p) Akt; (b) phosphorylated mammalian target of rapamycin (p-mTOR); (c) and phosphorylated p70S6K (p-p70S6K). Columns represent mean relative protein levels normalized to control ( n  = 6 per group). Loading was normalized using glyceraldehyde 3-phosphate dehydrogenase (GADPH) levels. *Significantly different ( p

Techniques Used: Western Blot, Expressing

Western blot analysis after subchronic fingolimod treatment. Quantitative Western blot analysis of phosphorylated p70S6K (p-p70S6K) levels in the cortex of Wistar Albino Glaxo/Rijswijk rats of 6 months of age subchronically treated with fingolimod. Columns represent mean relative protein levels normalized to control ( n  = 6 per group). Loading was normalized using glyceraldehyde 3-phosphate dehydrogenase (GADPH) levels. CTRL = control
Figure Legend Snippet: Western blot analysis after subchronic fingolimod treatment. Quantitative Western blot analysis of phosphorylated p70S6K (p-p70S6K) levels in the cortex of Wistar Albino Glaxo/Rijswijk rats of 6 months of age subchronically treated with fingolimod. Columns represent mean relative protein levels normalized to control ( n  = 6 per group). Loading was normalized using glyceraldehyde 3-phosphate dehydrogenase (GADPH) levels. CTRL = control

Techniques Used: Western Blot

3) Product Images from "Enhanced NF-?B Activity Impairs Vascular Function Through PARP-1-, SP-1-, and COX-2-Dependent Mechanisms in Type 2 Diabetes"

Article Title: Enhanced NF-?B Activity Impairs Vascular Function Through PARP-1-, SP-1-, and COX-2-Dependent Mechanisms in Type 2 Diabetes

Journal: Diabetes

doi: 10.2337/db12-1374

Western blot analysis and quantitative data in homogenized CA from control and type 2 diabetic mice (db − /db − ) treated with or without DHMEQ (DHM) or IKK-NBD (IKK), showing P-p65 and T-p65 ( A ), P-eNOS and T-eNOS ( B ), C-PARP-1 and and T-PARP-1 ( C ), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). $ P
Figure Legend Snippet: Western blot analysis and quantitative data in homogenized CA from control and type 2 diabetic mice (db − /db − ) treated with or without DHMEQ (DHM) or IKK-NBD (IKK), showing P-p65 and T-p65 ( A ), P-eNOS and T-eNOS ( B ), C-PARP-1 and and T-PARP-1 ( C ), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). $ P

Techniques Used: Western Blot, Mouse Assay, Digital Holographic Microscopy

4) Product Images from "VEGF (Vascular Endothelial Growth Factor) Induces NRP1 (Neuropilin-1) Cleavage via ADAMs (a Disintegrin and Metalloproteinase) 9 and 10 to Generate Novel Carboxy-Terminal NRP1 Fragments That Regulate Angiogenic Signaling"

Article Title: VEGF (Vascular Endothelial Growth Factor) Induces NRP1 (Neuropilin-1) Cleavage via ADAMs (a Disintegrin and Metalloproteinase) 9 and 10 to Generate Novel Carboxy-Terminal NRP1 Fragments That Regulate Angiogenic Signaling

Journal: Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/ATVBAHA.118.311118

Endothelial expression of C-terminal NRP1 (neuropilin-1) fragments.  A , Lysates of cytoplasmic (Cyt, C) and nuclear extracts (Nuc, N) of human umbilical vein endothelial cells (HUVECs) were immunoblotted with NRP1 antibody specific to the cytoplasmic domain of NRP1 (C-term; antibody C-19 from Santa Cruz Inc). This antibody recognized several low (30 kDa and below) molecular weight species predominantly in the cytoplasmic fraction.  B , HUVECs were transfected with control scrambled (siScr) and NRP1-specific siRNAs, and whole cell protein lysates immunoblotted with NRP1 antibody specific either to the cytoplasmic (C-term) or extracellular (N-term; antibody AF387) domains of NRP1. Knockdown of endogenous NRP1 using siRNA resulted in diminished expression of not only the full-length NRP1 band but also of the cytoplasmic fragments.  C , HUVECs were transduced with adenoviruses encoding wild-type (WT) NRP1 (WT), an NRP1ΔC mutant lacking the cytoplasmic domain (ΔC), or GFP (green fluorescent protein), and 48 h later cytoplasmic (C) or nuclear (N) cell lysates were immunoblotted with antibodies either specific for the NRP1 cytoplasmic domain (C-term), or specific to the NRP1 extracellular domain (N-term), or for β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; cytoplasmic marker), or lamin B (nuclear marker). Overexpression of WT NRP1 by an adenovirus (WT), but not of the NRP1ΔC mutant (lacking the cytoplasmic domain; ΔC) results in the generation of low molecular weight cytoplasmic fragments that can be detected only by antibody specific for the NRP1 cytoplasmic domain, but not by antibody specific for the NRP1 extracellular domain.
Figure Legend Snippet: Endothelial expression of C-terminal NRP1 (neuropilin-1) fragments. A , Lysates of cytoplasmic (Cyt, C) and nuclear extracts (Nuc, N) of human umbilical vein endothelial cells (HUVECs) were immunoblotted with NRP1 antibody specific to the cytoplasmic domain of NRP1 (C-term; antibody C-19 from Santa Cruz Inc). This antibody recognized several low (30 kDa and below) molecular weight species predominantly in the cytoplasmic fraction. B , HUVECs were transfected with control scrambled (siScr) and NRP1-specific siRNAs, and whole cell protein lysates immunoblotted with NRP1 antibody specific either to the cytoplasmic (C-term) or extracellular (N-term; antibody AF387) domains of NRP1. Knockdown of endogenous NRP1 using siRNA resulted in diminished expression of not only the full-length NRP1 band but also of the cytoplasmic fragments. C , HUVECs were transduced with adenoviruses encoding wild-type (WT) NRP1 (WT), an NRP1ΔC mutant lacking the cytoplasmic domain (ΔC), or GFP (green fluorescent protein), and 48 h later cytoplasmic (C) or nuclear (N) cell lysates were immunoblotted with antibodies either specific for the NRP1 cytoplasmic domain (C-term), or specific to the NRP1 extracellular domain (N-term), or for β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; cytoplasmic marker), or lamin B (nuclear marker). Overexpression of WT NRP1 by an adenovirus (WT), but not of the NRP1ΔC mutant (lacking the cytoplasmic domain; ΔC) results in the generation of low molecular weight cytoplasmic fragments that can be detected only by antibody specific for the NRP1 cytoplasmic domain, but not by antibody specific for the NRP1 extracellular domain.

Techniques Used: Expressing, Molecular Weight, Transfection, Transduction, Mutagenesis, Marker, Over Expression

5) Product Images from "A Resveratrol Analogue Promotes ERKMAPK"

Article Title: A Resveratrol Analogue Promotes ERKMAPK

Journal: Molecular Pharmacology

doi: 10.1124/mol.115.099093

Cmpd1 suppresses the expression of cell cycle and apoptotic regulatory genes, inhibits the cell cycle, and induces caspases and poly(ADP ribose) polymerase (PARP) cleavage. Immunoblotting analysis of whole-cell lysate preparation from U251MG cells untreated (0) or treated with 15  µ M Cmpd1 for 24 or 48 hours and probing for (A) survivin, myeloid cell leukemia 1, Bcl-xL, cyclin D1, cyclin B1, and  β -actin or (C) caspase 8, 9, or 3, PARP, and  β -actin. (B) Cell cycle distribution analysis of U251MG or NIH3T3 cells treated or untreated (dimethyl sulfoxide) with 15  µ M Cmpd1 for 24 or 72 hours, processed by propidium iodide staining, and analyzed by flow cytometry for DNA content, which is plotted. The positions of the proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and  β -actin or glyceraldehyde 3-phosphate dehydrogenase levels. Control lane (0) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations. Values are mean ± S.D.;  n  = 3–4. * P
Figure Legend Snippet: Cmpd1 suppresses the expression of cell cycle and apoptotic regulatory genes, inhibits the cell cycle, and induces caspases and poly(ADP ribose) polymerase (PARP) cleavage. Immunoblotting analysis of whole-cell lysate preparation from U251MG cells untreated (0) or treated with 15 µ M Cmpd1 for 24 or 48 hours and probing for (A) survivin, myeloid cell leukemia 1, Bcl-xL, cyclin D1, cyclin B1, and β -actin or (C) caspase 8, 9, or 3, PARP, and β -actin. (B) Cell cycle distribution analysis of U251MG or NIH3T3 cells treated or untreated (dimethyl sulfoxide) with 15 µ M Cmpd1 for 24 or 72 hours, processed by propidium iodide staining, and analyzed by flow cytometry for DNA content, which is plotted. The positions of the proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and β -actin or glyceraldehyde 3-phosphate dehydrogenase levels. Control lane (0) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations. Values are mean ± S.D.; n = 3–4. * P

Techniques Used: Expressing, Staining, Flow Cytometry, Cytometry, Labeling

Cmpd1-mediated inhibition of pYStat3 is associated with Erk1/2 MAPK  induction, which promotes pS727Stat3 and is reversed by the MEK inhibitor PD98059. Immunoblotting analysis of whole-cell lysate preparation from U251MG cells untreated (–) or treated with 15  µ M Cmpd1 for 15 or 30 minutes following pretreatment with or without 50  µ M PD98059 for the indicated times and probing for pYStat3, pS727Stat3, Stat3, pErk1/2 MAPK , Erk1/2 MAPK , and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The positions of the proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and GAPDH levels. Control lane (–) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations.
Figure Legend Snippet: Cmpd1-mediated inhibition of pYStat3 is associated with Erk1/2 MAPK induction, which promotes pS727Stat3 and is reversed by the MEK inhibitor PD98059. Immunoblotting analysis of whole-cell lysate preparation from U251MG cells untreated (–) or treated with 15 µ M Cmpd1 for 15 or 30 minutes following pretreatment with or without 50 µ M PD98059 for the indicated times and probing for pYStat3, pS727Stat3, Stat3, pErk1/2 MAPK , Erk1/2 MAPK , and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The positions of the proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and GAPDH levels. Control lane (–) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations.

Techniques Used: Inhibition, Labeling

Cmpd1 promotes phospho-Src, -Erk1/2 MAPK , -Akt, -mTOR, -p38, and -Hsp27 induction and has no significant effects on Jak2 and EGFR in glioma U251MG cells. Immunoblotting analysis of whole-cell lysate preparation from the human glioma U251MG cells untreated or treated with (A and D–J) 15  µ M Cmpd1, (B) 20  µ M resveratrol (Res), or (C) 100 nM dasatinib (Das) for 0–24 hours and probing for pY416Src, Src, pYStat3, Stat3, pJak2, Jak2, pY1173EGFR, EGFR, pErk1/2 MAPK , Erk1/2 MAPK , p-p38, p38, pmTOR, mTOR, pAkt, Akt, pHsp27, Hsp27,  β -actin, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The positions of proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and  β -actin or GAPDH levels. Control lane (0) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations.
Figure Legend Snippet: Cmpd1 promotes phospho-Src, -Erk1/2 MAPK , -Akt, -mTOR, -p38, and -Hsp27 induction and has no significant effects on Jak2 and EGFR in glioma U251MG cells. Immunoblotting analysis of whole-cell lysate preparation from the human glioma U251MG cells untreated or treated with (A and D–J) 15 µ M Cmpd1, (B) 20 µ M resveratrol (Res), or (C) 100 nM dasatinib (Das) for 0–24 hours and probing for pY416Src, Src, pYStat3, Stat3, pJak2, Jak2, pY1173EGFR, EGFR, pErk1/2 MAPK , Erk1/2 MAPK , p-p38, p38, pmTOR, mTOR, pAkt, Akt, pHsp27, Hsp27, β -actin, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The positions of proteins in the gel are labeled. Bands corresponding to the phospho-protein levels in the gel were quantified by ImageQuant and calculated as a percentage of control (dimethyl sulfoxide) relative to the total proteins and β -actin or GAPDH levels. Control lane (0) represents whole-cell lysates prepared from 0.025% dimethyl sulfoxide–treated cells. Data are representative of three independent determinations.

Techniques Used: Labeling

6) Product Images from "Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy"

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy

Journal: Molecular Vision

doi:

Connective tissue growth factor (CTGF) expression increased in retina of 8 and 12 week diabetic rats.  CTGF  mRNA expression in the retinas of non-diabetic and diabetic rats after 8 and 12 weeks of hyperglycemia were analyzed using real-time PCR and normalized to the housekeeping gene acidic ribosomal phosphoprotein P0 ( ARPP 0 ).  A :  CTGF  mRNA levels increased six- and sevenfold at both time points.  B : A representative western blot illustrating CTGF and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) protein expression in the retinas of diabetic rats after 8 and 12 weeks of hyperglycemia. Note the increased CTGF protein levels compared to the non-diabetic controls.  C : Densitometric analysis of three separate immunoblots indicates a 2.5 and 5.7 fold increase in the CTGF protein after 8 and 12 weeks of hyperglycemia, respectively. (*p
Figure Legend Snippet: Connective tissue growth factor (CTGF) expression increased in retina of 8 and 12 week diabetic rats. CTGF mRNA expression in the retinas of non-diabetic and diabetic rats after 8 and 12 weeks of hyperglycemia were analyzed using real-time PCR and normalized to the housekeeping gene acidic ribosomal phosphoprotein P0 ( ARPP 0 ). A : CTGF mRNA levels increased six- and sevenfold at both time points. B : A representative western blot illustrating CTGF and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) protein expression in the retinas of diabetic rats after 8 and 12 weeks of hyperglycemia. Note the increased CTGF protein levels compared to the non-diabetic controls. C : Densitometric analysis of three separate immunoblots indicates a 2.5 and 5.7 fold increase in the CTGF protein after 8 and 12 weeks of hyperglycemia, respectively. (*p

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Western Blot

siRNA treatment significantly decreased hyperglycemia-induced increase in connective tissue growth factor (CTGF) mRNA and protein, glial fibrillary acidic protein (GFAP), collagen IVα3 and laminin-β1 gene expression. mRNA expression for  CTGF  and selected genes in the retinas of the diabetic rats after 12 weeks of hyperglycemia were analyzed using real-time PCR and normalized to the TATA-binding protein ( TBP ).  A : Real-time PCR revealed that 3 days post intravitreal injection,  CTGF  siRNA induced a decrease in  CTGF  (33%),  GFAP  (44%), collagen IVα3 (71%), and laminin β1 (63%) mRNAs. In contrast,  CTGF  siRNA did not affect the level of fibronectin or vascular endothelial growth factor ( VEGF ).  B : Immunoblot analysis of CTGF levels in the retinas following a single intravitreal injection of  CTGF  siRNA or scrambled siRNA into left and right eye, respectively. The concentration of the CTGF protein is lower in eyes injected with  CTGF  siRNA.  C : Densitometric analysis of three independent experiments revealed a 54% decrease in CTGF protein in retinas injected with  CTGF  siRNA compared to retinas injected with a scrambled (non-specific) siRNA. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as loading control.  D : Real-time PCR showed that  CTGF  siRNA had no effect on  CTGF  expression 10 days after injection. (*p
Figure Legend Snippet: siRNA treatment significantly decreased hyperglycemia-induced increase in connective tissue growth factor (CTGF) mRNA and protein, glial fibrillary acidic protein (GFAP), collagen IVα3 and laminin-β1 gene expression. mRNA expression for CTGF and selected genes in the retinas of the diabetic rats after 12 weeks of hyperglycemia were analyzed using real-time PCR and normalized to the TATA-binding protein ( TBP ). A : Real-time PCR revealed that 3 days post intravitreal injection, CTGF siRNA induced a decrease in CTGF (33%), GFAP (44%), collagen IVα3 (71%), and laminin β1 (63%) mRNAs. In contrast, CTGF siRNA did not affect the level of fibronectin or vascular endothelial growth factor ( VEGF ). B : Immunoblot analysis of CTGF levels in the retinas following a single intravitreal injection of CTGF siRNA or scrambled siRNA into left and right eye, respectively. The concentration of the CTGF protein is lower in eyes injected with CTGF siRNA. C : Densitometric analysis of three independent experiments revealed a 54% decrease in CTGF protein in retinas injected with CTGF siRNA compared to retinas injected with a scrambled (non-specific) siRNA. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as loading control. D : Real-time PCR showed that CTGF siRNA had no effect on CTGF expression 10 days after injection. (*p

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Binding Assay, Injection, Concentration Assay

7) Product Images from "Gelidium elegans Extract Ameliorates Type 2 Diabetes via Regulation of MAPK and PI3K/Akt Signaling"

Article Title: Gelidium elegans Extract Ameliorates Type 2 Diabetes via Regulation of MAPK and PI3K/Akt Signaling

Journal: Nutrients

doi: 10.3390/nu10010051

Effect of GEE on GLUT4 protein expression in the skeletal muscle and liver of db/db mice. Five-week-old mice were administered with or without GEE (50 and 200 mg/kg/day) for five weeks. GLUT4 was quantified by western blotting in the skeletal muscle ( A ) and liver ( B ). Protein expression was quantified after normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using Image J software. Data were analyzed by a one-way ANOVA followed by Duncan’s test. Data are mean ± SD ( n  = 8 per group,  a p
Figure Legend Snippet: Effect of GEE on GLUT4 protein expression in the skeletal muscle and liver of db/db mice. Five-week-old mice were administered with or without GEE (50 and 200 mg/kg/day) for five weeks. GLUT4 was quantified by western blotting in the skeletal muscle ( A ) and liver ( B ). Protein expression was quantified after normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using Image J software. Data were analyzed by a one-way ANOVA followed by Duncan’s test. Data are mean ± SD ( n = 8 per group, a p

Techniques Used: Expressing, Mouse Assay, Western Blot, Software

8) Product Images from "Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia"

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

doi: 10.1158/1078-0432.CCR-07-5051

EPO reduces PARP cleavage in  ETV6/RUNX1 -positive leukemias exposed to prednisone. PARP cleavage was determined byWestern blot analysis in AT-2, REH, Nalm6, and SEM cells after exposure to prednisone and EPO for the indicated times. Glyceraldehyde 3-phosphate
Figure Legend Snippet: EPO reduces PARP cleavage in ETV6/RUNX1 -positive leukemias exposed to prednisone. PARP cleavage was determined byWestern blot analysis in AT-2, REH, Nalm6, and SEM cells after exposure to prednisone and EPO for the indicated times. Glyceraldehyde 3-phosphate

Techniques Used:

9) Product Images from "Stress-induced changes in gene interactions in human cells"

Article Title: Stress-induced changes in gene interactions in human cells

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt999

THAP1  and  RAB35,  two ER stress-responsive genes and  PSMC3IP,  an IR stress-responsive gene identified in this study. ( A ) THAP1 protein levels are increased in response to ER stress induced by tunicamycin in primary human fibroblasts; results of biological triplicates. The ratio of THAP1 to glyceraldehyde 3-phosphate dehydrogenase is reported below each lane. ( B ) Knockdown of  THAP1  (average knockdown of 49%) ( P  = 0.03) resulted in attenuated induction of  ATF4  and  DDIT3 /CHOP ( P
Figure Legend Snippet: THAP1 and RAB35, two ER stress-responsive genes and PSMC3IP, an IR stress-responsive gene identified in this study. ( A ) THAP1 protein levels are increased in response to ER stress induced by tunicamycin in primary human fibroblasts; results of biological triplicates. The ratio of THAP1 to glyceraldehyde 3-phosphate dehydrogenase is reported below each lane. ( B ) Knockdown of THAP1 (average knockdown of 49%) ( P = 0.03) resulted in attenuated induction of ATF4 and DDIT3 /CHOP ( P

Techniques Used:

10) Product Images from "Notch signaling in the collecting duct regulates renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction in mice"

Article Title: Notch signaling in the collecting duct regulates renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction in mice

Journal: The Korean Journal of Internal Medicine

doi: 10.3904/kjim.2016.230

(A) TUNNEL (Terminal deoxynucleotide transferase dUTP Nick End Labeling) assay results and the quantification of TUNNEL-positive cells, (B) aquaporin 2 (AQP2) (blue) and TUNNEL (brown) double-staining is presented, with TUNNEL positive cell percentage in the collecting duct (%) and TUNNEL-positive cell number in non-collecting duct (/mm 2 ). (C) Analysis of c-Myc expression. Scale bars: 50 µm. The results are presented as mean ± standard error.  Mib1 f/f , mind bomb-1 ( Mib1 )-floxed mice; UUO, unilateral ureteral obstruction; CD, collecting duct; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.  a p
Figure Legend Snippet: (A) TUNNEL (Terminal deoxynucleotide transferase dUTP Nick End Labeling) assay results and the quantification of TUNNEL-positive cells, (B) aquaporin 2 (AQP2) (blue) and TUNNEL (brown) double-staining is presented, with TUNNEL positive cell percentage in the collecting duct (%) and TUNNEL-positive cell number in non-collecting duct (/mm 2 ). (C) Analysis of c-Myc expression. Scale bars: 50 µm. The results are presented as mean ± standard error. Mib1 f/f , mind bomb-1 ( Mib1 )-floxed mice; UUO, unilateral ureteral obstruction; CD, collecting duct; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. a p

Techniques Used: End Labeling, Double Staining, Expressing, Mouse Assay

(A) Immunohistochemical staining and representative result of immunoblot analysis showing (B) transforming growth factor β1 (TGF-β1) and (C) Smad4 expression. Scale bars: 50 µm. The results are represented as mean ± standard error.  Mib1 f/f , mind bomb-1 ( Mib1 )-f loxed mice;  AQP2 , aquaporin 2; UUO, unilateral ureteral obstruction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.  a p
Figure Legend Snippet: (A) Immunohistochemical staining and representative result of immunoblot analysis showing (B) transforming growth factor β1 (TGF-β1) and (C) Smad4 expression. Scale bars: 50 µm. The results are represented as mean ± standard error. Mib1 f/f , mind bomb-1 ( Mib1 )-f loxed mice; AQP2 , aquaporin 2; UUO, unilateral ureteral obstruction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. a p

Techniques Used: Immunohistochemistry, Staining, Expressing, Mouse Assay

(A) Representative fibronectin (FBN) immunoblot results. (B) Collagen IV immunostaining and the quantification of collagen IV deposition (mask area/field area %). Scale bars: 50 µm. (C) Fibroblast-specific protein 1 (FSP 1 ) immunostaining and the quantification of FSP1 deposition (mask area/field area %). Scale bars: 100 µm. The results are represented as mean ± standard error.  Mib1 f/f , mind bomb- 1 ( Mib1 )-f loxed mice;  AQP2 , aquaporin 2; UUO, unilateral ureteral obstruction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.  a p
Figure Legend Snippet: (A) Representative fibronectin (FBN) immunoblot results. (B) Collagen IV immunostaining and the quantification of collagen IV deposition (mask area/field area %). Scale bars: 50 µm. (C) Fibroblast-specific protein 1 (FSP 1 ) immunostaining and the quantification of FSP1 deposition (mask area/field area %). Scale bars: 100 µm. The results are represented as mean ± standard error. Mib1 f/f , mind bomb- 1 ( Mib1 )-f loxed mice; AQP2 , aquaporin 2; UUO, unilateral ureteral obstruction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. a p

Techniques Used: Immunostaining, Mouse Assay

11) Product Images from "Effect of bone marrow mesenchymal stem cell transplantation on acute hepatic failure in rats"

Article Title: Effect of bone marrow mesenchymal stem cell transplantation on acute hepatic failure in rats

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2014.1848

Levels of cluster of differentiation (CD)163 and interleukin (IL)-10 in liver tissue. At 24, 120 and 168 h following bone marrow mesenchymal stem cell (BMSC) transplantation, liver tissue was collected from rats of the normal, control, tail vein and portal vein group. Expression levels of CD163 and IL-10 in the liver tissue were analyzed by western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. (A) Representative western blot analysis results. (B) Quantitative results of the western blot analysis results. Experiments were conducted three times. Data are expressed as mean ± standard deviation.  * P
Figure Legend Snippet: Levels of cluster of differentiation (CD)163 and interleukin (IL)-10 in liver tissue. At 24, 120 and 168 h following bone marrow mesenchymal stem cell (BMSC) transplantation, liver tissue was collected from rats of the normal, control, tail vein and portal vein group. Expression levels of CD163 and IL-10 in the liver tissue were analyzed by western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. (A) Representative western blot analysis results. (B) Quantitative results of the western blot analysis results. Experiments were conducted three times. Data are expressed as mean ± standard deviation. * P

Techniques Used: Transplantation Assay, Expressing, Western Blot, Standard Deviation

12) Product Images from "Altered Response of Skeletal Muscle to IL-6 in Type 2 Diabetic Patients"

Article Title: Altered Response of Skeletal Muscle to IL-6 in Type 2 Diabetic Patients

Journal: Diabetes

doi: 10.2337/db11-1790

A : Abundance of phosphorylated STAT3 in skeletal muscle cells after stimulation with IL-6 ( n = 8 to 9). Note only IL-6–stimulated conditions were quantified because the basal STAT3 tyr705 phosphorylation level was below detection limit. B : Insulin-stimulated phosphorylation of Akt ser473 in skeletal muscle cells ( n = 4). Note all conditions are insulin-stimulated because the basal Akt ser473 phosphorylation level was below detection limit. C : Insulin-stimulated phosphorylation of GSK3α/β ser21/9 in skeletal muscle cells ( n = 3). D : IL-6R abundance ( n = 4). E : gp130 abundance ( n = 4). F : Abundance of SOCS3 in skeletal muscle cells ( n = 6 to 7). Pan-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are shown as markers of protein loading. P
Figure Legend Snippet: A : Abundance of phosphorylated STAT3 in skeletal muscle cells after stimulation with IL-6 ( n = 8 to 9). Note only IL-6–stimulated conditions were quantified because the basal STAT3 tyr705 phosphorylation level was below detection limit. B : Insulin-stimulated phosphorylation of Akt ser473 in skeletal muscle cells ( n = 4). Note all conditions are insulin-stimulated because the basal Akt ser473 phosphorylation level was below detection limit. C : Insulin-stimulated phosphorylation of GSK3α/β ser21/9 in skeletal muscle cells ( n = 3). D : IL-6R abundance ( n = 4). E : gp130 abundance ( n = 4). F : Abundance of SOCS3 in skeletal muscle cells ( n = 6 to 7). Pan-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are shown as markers of protein loading. P

Techniques Used:

13) Product Images from "?-Catenin is overexpressed in acute myeloid leukemia and promotes the stabilization and nuclear localization of ?-catenin"

Article Title: ?-Catenin is overexpressed in acute myeloid leukemia and promotes the stabilization and nuclear localization of ?-catenin

Journal: Leukemia

doi: 10.1038/leu.2012.221

γ-Catenin promotes TCF/LEF-mediated transcription in leukemic cells both directly and indirectly through stabilization of β-Cat. ( a ) Representative western blot showing the expression and localization of γ- and β-catenin protein in K562 cells transduced with empty vector (Cont), γ-Catenin or γ-catenin together with β-catenin small hairpin RNA (γ/β-Cat KO). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and histone H1 demonstrate relative protein loading and fraction purity. ( b ) Representative flow cytometric histograms showing TCF reporter activity in K562 cell lines. ( c ) Summary data showing the background-subtracted TCF reporter signal ( n =3). Data represents mean±1 s.d. Statistical significance is denoted by  † P
Figure Legend Snippet: γ-Catenin promotes TCF/LEF-mediated transcription in leukemic cells both directly and indirectly through stabilization of β-Cat. ( a ) Representative western blot showing the expression and localization of γ- and β-catenin protein in K562 cells transduced with empty vector (Cont), γ-Catenin or γ-catenin together with β-catenin small hairpin RNA (γ/β-Cat KO). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and histone H1 demonstrate relative protein loading and fraction purity. ( b ) Representative flow cytometric histograms showing TCF reporter activity in K562 cell lines. ( c ) Summary data showing the background-subtracted TCF reporter signal ( n =3). Data represents mean±1 s.d. Statistical significance is denoted by † P

Techniques Used: Western Blot, Expressing, Transduction, Plasmid Preparation, Flow Cytometry, Activity Assay

14) Product Images from "Effects of anti-vascular endothelial growth factor monoclonal antibody (bevacizumab) on lens epithelial cells"

Article Title: Effects of anti-vascular endothelial growth factor monoclonal antibody (bevacizumab) on lens epithelial cells

Journal: Clinical Ophthalmology (Auckland, N.Z.)

doi: 10.2147/OPTH.S103443

Effects of bevacizumab on cellular morphology and expression of factors related to EMT and proliferation. Notes: ( A ) Microscopic morphology of anterior capsular LECs for control and 2 mg/mL bevacizumab treatment in lens capsular bag after 120 hours cultivation. Capsular bag LECs showed decreased cell density (asterisks) and bleb-like morphological changes after cultivation in 2 mg/mL bevacizumab (arrowheads). ( B and C ) Western blot analysis after treatment with various bevacizumab concentrations in cultured cell and porcine lens capsular bags. TGF- β 2 is markedly increased in a dose-dependent manner in both systems. Western blot analysis of cultured cells revealed increase-peak-decrease patterns in PCNA and α -SMA expression around 0.5 mg/mL concentration. The expression pattern of PCNA is in agreement with results from the cell viability assay by cell counting kit-8 and the BrdU proliferation assay. Overall, MMP-9 showed a decrease in expression over 1 mg/mL treatment, whereas vimentin expression increased in a dose-dependent manner. Similarly, PCNA and α -SMA expression levels peaked at 1 mg/mL bevacizumab in the porcine lens capsular bag model. Abbreviations: LECs, lens epithelial cells; TGF- β 2, transforming growth factor- β 2; PCNA, proliferating cell nuclear antigen; α -SMA, α -smooth muscle actin; BrdU, 5-bromo-2′-deoxyuridine; MMP-9, matrix metalloproteinase-9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure Legend Snippet: Effects of bevacizumab on cellular morphology and expression of factors related to EMT and proliferation. Notes: ( A ) Microscopic morphology of anterior capsular LECs for control and 2 mg/mL bevacizumab treatment in lens capsular bag after 120 hours cultivation. Capsular bag LECs showed decreased cell density (asterisks) and bleb-like morphological changes after cultivation in 2 mg/mL bevacizumab (arrowheads). ( B and C ) Western blot analysis after treatment with various bevacizumab concentrations in cultured cell and porcine lens capsular bags. TGF- β 2 is markedly increased in a dose-dependent manner in both systems. Western blot analysis of cultured cells revealed increase-peak-decrease patterns in PCNA and α -SMA expression around 0.5 mg/mL concentration. The expression pattern of PCNA is in agreement with results from the cell viability assay by cell counting kit-8 and the BrdU proliferation assay. Overall, MMP-9 showed a decrease in expression over 1 mg/mL treatment, whereas vimentin expression increased in a dose-dependent manner. Similarly, PCNA and α -SMA expression levels peaked at 1 mg/mL bevacizumab in the porcine lens capsular bag model. Abbreviations: LECs, lens epithelial cells; TGF- β 2, transforming growth factor- β 2; PCNA, proliferating cell nuclear antigen; α -SMA, α -smooth muscle actin; BrdU, 5-bromo-2′-deoxyuridine; MMP-9, matrix metalloproteinase-9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Techniques Used: Expressing, Western Blot, Cell Culture, Concentration Assay, Viability Assay, Cell Counting, Proliferation Assay

15) Product Images from "VEGF (Vascular Endothelial Growth Factor) Induces NRP1 (Neuropilin-1) Cleavage via ADAMs (a Disintegrin and Metalloproteinase) 9 and 10 to Generate Novel Carboxy-Terminal NRP1 Fragments That Regulate Angiogenic Signaling"

Article Title: VEGF (Vascular Endothelial Growth Factor) Induces NRP1 (Neuropilin-1) Cleavage via ADAMs (a Disintegrin and Metalloproteinase) 9 and 10 to Generate Novel Carboxy-Terminal NRP1 Fragments That Regulate Angiogenic Signaling

Journal: Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/ATVBAHA.118.311118

Endothelial expression of C-terminal NRP1 (neuropilin-1) fragments.  A , Lysates of cytoplasmic (Cyt, C) and nuclear extracts (Nuc, N) of human umbilical vein endothelial cells (HUVECs) were immunoblotted with NRP1 antibody specific to the cytoplasmic domain of NRP1 (C-term; antibody C-19 from Santa Cruz Inc). This antibody recognized several low (30 kDa and below) molecular weight species predominantly in the cytoplasmic fraction.  B , HUVECs were transfected with control scrambled (siScr) and NRP1-specific siRNAs, and whole cell protein lysates immunoblotted with NRP1 antibody specific either to the cytoplasmic (C-term) or extracellular (N-term; antibody AF387) domains of NRP1. Knockdown of endogenous NRP1 using siRNA resulted in diminished expression of not only the full-length NRP1 band but also of the cytoplasmic fragments.  C , HUVECs were transduced with adenoviruses encoding wild-type (WT) NRP1 (WT), an NRP1ΔC mutant lacking the cytoplasmic domain (ΔC), or GFP (green fluorescent protein), and 48 h later cytoplasmic (C) or nuclear (N) cell lysates were immunoblotted with antibodies either specific for the NRP1 cytoplasmic domain (C-term), or specific to the NRP1 extracellular domain (N-term), or for β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; cytoplasmic marker), or lamin B (nuclear marker). Overexpression of WT NRP1 by an adenovirus (WT), but not of the NRP1ΔC mutant (lacking the cytoplasmic domain; ΔC) results in the generation of low molecular weight cytoplasmic fragments that can be detected only by antibody specific for the NRP1 cytoplasmic domain, but not by antibody specific for the NRP1 extracellular domain.
Figure Legend Snippet: Endothelial expression of C-terminal NRP1 (neuropilin-1) fragments. A , Lysates of cytoplasmic (Cyt, C) and nuclear extracts (Nuc, N) of human umbilical vein endothelial cells (HUVECs) were immunoblotted with NRP1 antibody specific to the cytoplasmic domain of NRP1 (C-term; antibody C-19 from Santa Cruz Inc). This antibody recognized several low (30 kDa and below) molecular weight species predominantly in the cytoplasmic fraction. B , HUVECs were transfected with control scrambled (siScr) and NRP1-specific siRNAs, and whole cell protein lysates immunoblotted with NRP1 antibody specific either to the cytoplasmic (C-term) or extracellular (N-term; antibody AF387) domains of NRP1. Knockdown of endogenous NRP1 using siRNA resulted in diminished expression of not only the full-length NRP1 band but also of the cytoplasmic fragments. C , HUVECs were transduced with adenoviruses encoding wild-type (WT) NRP1 (WT), an NRP1ΔC mutant lacking the cytoplasmic domain (ΔC), or GFP (green fluorescent protein), and 48 h later cytoplasmic (C) or nuclear (N) cell lysates were immunoblotted with antibodies either specific for the NRP1 cytoplasmic domain (C-term), or specific to the NRP1 extracellular domain (N-term), or for β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; cytoplasmic marker), or lamin B (nuclear marker). Overexpression of WT NRP1 by an adenovirus (WT), but not of the NRP1ΔC mutant (lacking the cytoplasmic domain; ΔC) results in the generation of low molecular weight cytoplasmic fragments that can be detected only by antibody specific for the NRP1 cytoplasmic domain, but not by antibody specific for the NRP1 extracellular domain.

Techniques Used: Expressing, Molecular Weight, Transfection, Transduction, Mutagenesis, Marker, Over Expression

16) Product Images from ""

Article Title:

Journal: The Journal of Pharmacology and Experimental Therapeutics

doi: 10.1124/jpet.114.219659

Inhibition of CDK1 completely abrogates SKI-178–induced Bcl-2 phosphorylation and caspase-7 activation after mitotic arrest. HL-60 cells were synchronized at G1/S phase transition using a double thymidine block and released into either vehicle (A) or SKI-178 (5  μ M) (B). Cells released into SKI-178 were subdivided into four additional treatments: (C) HL-60 cells released into SKI-178 and cotreated with AS601245 at the time of release; (D) HL-60 cells released into SKI-178 and cotreated with AS601245 14 hours after release; (E) HL-60 cells released into SKI-178 and cotreated with RO3306 14 hours after release. Whole cell lysates were collected at indicated time points and blot analysis was performed using antibodies for pBcl-2 (Ser70) or pHistone H3 (Ser10). (F) To directly compare pBcl-2 (Ser70), pHistone H3 (Ser10), and caspase cleavage between the various treatments, Western blot analysis was performed using indicated antibodies on the 26-hour time points from (A–E). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of at least three independent experiments.
Figure Legend Snippet: Inhibition of CDK1 completely abrogates SKI-178–induced Bcl-2 phosphorylation and caspase-7 activation after mitotic arrest. HL-60 cells were synchronized at G1/S phase transition using a double thymidine block and released into either vehicle (A) or SKI-178 (5 μ M) (B). Cells released into SKI-178 were subdivided into four additional treatments: (C) HL-60 cells released into SKI-178 and cotreated with AS601245 at the time of release; (D) HL-60 cells released into SKI-178 and cotreated with AS601245 14 hours after release; (E) HL-60 cells released into SKI-178 and cotreated with RO3306 14 hours after release. Whole cell lysates were collected at indicated time points and blot analysis was performed using antibodies for pBcl-2 (Ser70) or pHistone H3 (Ser10). (F) To directly compare pBcl-2 (Ser70), pHistone H3 (Ser10), and caspase cleavage between the various treatments, Western blot analysis was performed using indicated antibodies on the 26-hour time points from (A–E). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of at least three independent experiments.

Techniques Used: Inhibition, Activation Assay, Sublimation, Blocking Assay, Western Blot

SKI-178 induces sustained Bcl-2 phosphorylation during prolonged mitosis. (A and B) Bcl-2 phosphorylation dynamics during cell cycle progression of vehicle (DMSO) treated or SKI-178 (5  μ M) treated cells. HL-60 cells were synchronized at G1/S phase transition using a double thymidine block. Cells were released from the block into media containing vehicle (DMSO) (A) or SKI-178 (5  μ M) (B). Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using antibodies for pBcl-2 (Ser70), pHistone H3 (Ser10), or cleaved active caspase-7. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of at least three independent experiments.
Figure Legend Snippet: SKI-178 induces sustained Bcl-2 phosphorylation during prolonged mitosis. (A and B) Bcl-2 phosphorylation dynamics during cell cycle progression of vehicle (DMSO) treated or SKI-178 (5 μ M) treated cells. HL-60 cells were synchronized at G1/S phase transition using a double thymidine block. Cells were released from the block into media containing vehicle (DMSO) (A) or SKI-178 (5 μ M) (B). Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using antibodies for pBcl-2 (Ser70), pHistone H3 (Ser10), or cleaved active caspase-7. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of at least three independent experiments.

Techniques Used: Sublimation, Blocking Assay, Western Blot

SKI-178–induced CDK1 activation results in MCL-1 degradation. (A) Whole cell lysates from the indicated AML cell lines were subjected to Western blot analysis to assess expression of various antiapoptotic family members (Bcl-2, Bcl-xl, and Mcl-1). (B) HL-60 and HL-60/VCR cells treated for 24 hours with SKI-178, RO3306, or a combination of SKI-178 and RO3306. Western blot analysis was performed on whole cell lysates using indicated antibodies. (C) HL-60/VCR cells were synchronized at the G1/S phase transition using a double thymidine block and released into either vehicle or SKI-178. Cells released into SKI-178 were either maintained in SKI-178 alone or cotreated with RO3306 14 hours after release. Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using indicated antibodies. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control.
Figure Legend Snippet: SKI-178–induced CDK1 activation results in MCL-1 degradation. (A) Whole cell lysates from the indicated AML cell lines were subjected to Western blot analysis to assess expression of various antiapoptotic family members (Bcl-2, Bcl-xl, and Mcl-1). (B) HL-60 and HL-60/VCR cells treated for 24 hours with SKI-178, RO3306, or a combination of SKI-178 and RO3306. Western blot analysis was performed on whole cell lysates using indicated antibodies. (C) HL-60/VCR cells were synchronized at the G1/S phase transition using a double thymidine block and released into either vehicle or SKI-178. Cells released into SKI-178 were either maintained in SKI-178 alone or cotreated with RO3306 14 hours after release. Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using indicated antibodies. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control.

Techniques Used: Activation Assay, Western Blot, Expressing, Sublimation, Blocking Assay

SKI-178–induced Bcl-2 phosphorylation and caspase-7 activation are blocked by JNK and CDK1 inhibitors. (A) HL-60 cells treated for 24 hours with various MAPK inhibitors or vehicle (DMSO) alone or in combination with SKI-178 (5  μ M). Western blot analysis was performed on whole cell lysate using antibody for cleaved caspase-7. (B) HL-60 cells treated with SKI-178 (5  μ M) for indicated time intervals. Western blot analysis was performed on whole cell lysates with pJNK (Thr183/Tyr185) antibody or for the proteins indicated. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (C) HL-60 cells treated for 24 hours with vehicle (DMSO), SP600125, a JNK-specific inhibitor (AS601245), or a CDK1-specific inhibitor (RO3306) alone or in combination with SKI-178. Western blot analysis was performed on whole cell lysate using antibody for pBcl-2 (Ser70) and cleaved active caspase-7. GAPDH serves as a loading control. Results shown are representative of at least three independent experiments.
Figure Legend Snippet: SKI-178–induced Bcl-2 phosphorylation and caspase-7 activation are blocked by JNK and CDK1 inhibitors. (A) HL-60 cells treated for 24 hours with various MAPK inhibitors or vehicle (DMSO) alone or in combination with SKI-178 (5 μ M). Western blot analysis was performed on whole cell lysate using antibody for cleaved caspase-7. (B) HL-60 cells treated with SKI-178 (5 μ M) for indicated time intervals. Western blot analysis was performed on whole cell lysates with pJNK (Thr183/Tyr185) antibody or for the proteins indicated. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (C) HL-60 cells treated for 24 hours with vehicle (DMSO), SP600125, a JNK-specific inhibitor (AS601245), or a CDK1-specific inhibitor (RO3306) alone or in combination with SKI-178. Western blot analysis was performed on whole cell lysate using antibody for pBcl-2 (Ser70) and cleaved active caspase-7. GAPDH serves as a loading control. Results shown are representative of at least three independent experiments.

Techniques Used: Activation Assay, Western Blot

SKI-178 induces sustained CDK1 activation during mitosis. HL-60 cells were treated with either vehicle or SKI-178 (5  μ M) for the indicated time points. Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using antibodies for pCDK1 (Tyr15). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of three independent experiments.
Figure Legend Snippet: SKI-178 induces sustained CDK1 activation during mitosis. HL-60 cells were treated with either vehicle or SKI-178 (5 μ M) for the indicated time points. Whole cell lysates were collected at indicated time points, and Western blot analysis was performed using antibodies for pCDK1 (Tyr15). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as a loading control. Results shown are representative of three independent experiments.

Techniques Used: Activation Assay, Western Blot

17) Product Images from "Smac mimetic and demethylating agents synergistically trigger cell death in acute myeloid leukemia cells and overcome apoptosis resistance by inducing necroptosis"

Article Title: Smac mimetic and demethylating agents synergistically trigger cell death in acute myeloid leukemia cells and overcome apoptosis resistance by inducing necroptosis

Journal: Cell Death & Disease

doi: 10.1038/cddis.2013.320

BV6/DAC-induced cell death is partly TNF α -dependent. ( a ) Cells were treated for 24 and 48 h (MV4-11) or for 36 and 48 h (NB4) with BV6 and/or DAC (MV4-11: 600 nM BV6, 30 nM DAC; NB4: 100 nM BV6, 50 nM DAC). Protein levels of cIAP1, cIAP2 and XIAP was assessed by western blotting. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as loading control. ( b ) MV4-11 and NB4 cells were treated for 48 h with BV6 and/or DAC in the presence or absence of 100  μ g/ml Enbrel. Cell death was determined by FSC/SSC analysis. Mean and SD of three experiments performed in triplicate are shown. * P
Figure Legend Snippet: BV6/DAC-induced cell death is partly TNF α -dependent. ( a ) Cells were treated for 24 and 48 h (MV4-11) or for 36 and 48 h (NB4) with BV6 and/or DAC (MV4-11: 600 nM BV6, 30 nM DAC; NB4: 100 nM BV6, 50 nM DAC). Protein levels of cIAP1, cIAP2 and XIAP was assessed by western blotting. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as loading control. ( b ) MV4-11 and NB4 cells were treated for 48 h with BV6 and/or DAC in the presence or absence of 100  μ g/ml Enbrel. Cell death was determined by FSC/SSC analysis. Mean and SD of three experiments performed in triplicate are shown. * P

Techniques Used: Western Blot

18) Product Images from ""

Article Title:

Journal: The Journal of Pharmacology and Experimental Therapeutics

doi: 10.1124/jpet.113.212076

Effects of SIRT1 and -2 inhibitors and siRNA on EGFR and PDGFR β phosphorylation. Cultured NRK-49F cells were treated with sirtinol (0–50 μ M), EX527 (0–100 μ M), or AGK2 (0–100 μ M) for 36 hours (A–F) or cells were transfected with siRNA targeting SIRT1 and SIRT2 or scrambled siRNA and then cultured for 48 hours (G and H). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-EGFR (pEGFR; Tyr1068), phospho-PDGFR β (pPDGFR β ; Tyr751), EGFR, PDGFR β , glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or α -tubulin (A, C, E, and G). Representative immunoblots from three experiments are shown. The phosphorylated and total levels of EGFR and PDGFR β were quantified by densitometry and phosphorylated protein levels were normalized to total protein levels (B, D, F, and H). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–c) are significantly different from one another ( P
Figure Legend Snippet: Effects of SIRT1 and -2 inhibitors and siRNA on EGFR and PDGFR β phosphorylation. Cultured NRK-49F cells were treated with sirtinol (0–50 μ M), EX527 (0–100 μ M), or AGK2 (0–100 μ M) for 36 hours (A–F) or cells were transfected with siRNA targeting SIRT1 and SIRT2 or scrambled siRNA and then cultured for 48 hours (G and H). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-EGFR (pEGFR; Tyr1068), phospho-PDGFR β (pPDGFR β ; Tyr751), EGFR, PDGFR β , glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or α -tubulin (A, C, E, and G). Representative immunoblots from three experiments are shown. The phosphorylated and total levels of EGFR and PDGFR β were quantified by densitometry and phosphorylated protein levels were normalized to total protein levels (B, D, F, and H). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–c) are significantly different from one another ( P

Techniques Used: Cell Culture, Transfection, Western Blot

Knockdown of SIRT1 and SIRT2 inhibits renal fibroblast activation. NRK-49F cells were transfected with siRNA targeting SIRT1 and SIRT2 or scrambled siRNA and then incubated in normal culture medium with 5% fetal bovine serum. At 48 hours after transfection, cell lysates were prepared for immunoblot analysis with antibodies against SIRT1, SIRT2, acetyl-H3K9 (Ac-H3K9), α -SMA, collagen I, fibronectin, PCNA, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; A and B). The levels of SIRT1, SIRT2, α -SMA, collagen I, fibronectin, and PCNA were quantified by densitometry and normalized with GAPDH (C–E). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–c) are significantly different from one another ( P
Figure Legend Snippet: Knockdown of SIRT1 and SIRT2 inhibits renal fibroblast activation. NRK-49F cells were transfected with siRNA targeting SIRT1 and SIRT2 or scrambled siRNA and then incubated in normal culture medium with 5% fetal bovine serum. At 48 hours after transfection, cell lysates were prepared for immunoblot analysis with antibodies against SIRT1, SIRT2, acetyl-H3K9 (Ac-H3K9), α -SMA, collagen I, fibronectin, PCNA, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; A and B). The levels of SIRT1, SIRT2, α -SMA, collagen I, fibronectin, and PCNA were quantified by densitometry and normalized with GAPDH (C–E). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–c) are significantly different from one another ( P

Techniques Used: Activation Assay, Transfection, Incubation

Sirtinol inhibits renal fibroblast proliferation. NRK-49F cells were cultured in medium with 5% fetal bovine serum and treated with sirtinol (0–50 μ M) for 36 hours (A–E). Cells were randomly photographed in bright field (200×) (A) and cell proliferation was measured by counting cell number (B) or the MTT assay (C). To measure cell death, cultured NRK-49F cells were exposed to the same concentrations (0–50 μ M) of sirtinol for 48 hours or treated with 1 mM H 2 O 2 for 3 hours as positive control. Cell lysates were subjected to immunoblot analysis for cleaved caspase-3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; D). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for PCNA, cyclin D1, cyclin E, or α -tubulin (E). Representative immunoblots from three experiments are shown. The levels of PCNA, cyclin D1, and cyclin E were quantified by densitometry and normalized with α -tubulin (F). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–e) are significantly different from one another ( P
Figure Legend Snippet: Sirtinol inhibits renal fibroblast proliferation. NRK-49F cells were cultured in medium with 5% fetal bovine serum and treated with sirtinol (0–50 μ M) for 36 hours (A–E). Cells were randomly photographed in bright field (200×) (A) and cell proliferation was measured by counting cell number (B) or the MTT assay (C). To measure cell death, cultured NRK-49F cells were exposed to the same concentrations (0–50 μ M) of sirtinol for 48 hours or treated with 1 mM H 2 O 2 for 3 hours as positive control. Cell lysates were subjected to immunoblot analysis for cleaved caspase-3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; D). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for PCNA, cyclin D1, cyclin E, or α -tubulin (E). Representative immunoblots from three experiments are shown. The levels of PCNA, cyclin D1, and cyclin E were quantified by densitometry and normalized with α -tubulin (F). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–e) are significantly different from one another ( P

Techniques Used: Cell Culture, MTT Assay, Positive Control, Western Blot

SIRT1 and SIRT2 inhibitors suppress renal fibroblast activation. The cell lysates prepared from cultured NRK-49F cells were subjected to immunoblot analysis for the expression of SIRT1 and SIRT2 (A). NRK-49F cells were treated with EX527 (0–100 μ M) and AGK2 (0–100 μ M) for 36 hours. Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies for acetyl-H3K9 (Ac-H3K9), α -SMA, collagen I, fibronectin, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; B and D). Representative immunoblots from three experiments are shown. The levels of α -SMA, collagen I, and fibronectin were quantified by densitometry and normalized with GAPDH (C and E). SIRT1 and SIRT2 activity was measured in NRK-49F cells treated with EX527 and AGK2 by an enzymatic assay kit with fluorescence-labeled acetylated peptide as substrate. The value was expressed as the percentage of inhibition in each sample relative to controls (F and G). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–d) are significantly different from one another ( P
Figure Legend Snippet: SIRT1 and SIRT2 inhibitors suppress renal fibroblast activation. The cell lysates prepared from cultured NRK-49F cells were subjected to immunoblot analysis for the expression of SIRT1 and SIRT2 (A). NRK-49F cells were treated with EX527 (0–100 μ M) and AGK2 (0–100 μ M) for 36 hours. Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies for acetyl-H3K9 (Ac-H3K9), α -SMA, collagen I, fibronectin, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; B and D). Representative immunoblots from three experiments are shown. The levels of α -SMA, collagen I, and fibronectin were quantified by densitometry and normalized with GAPDH (C and E). SIRT1 and SIRT2 activity was measured in NRK-49F cells treated with EX527 and AGK2 by an enzymatic assay kit with fluorescence-labeled acetylated peptide as substrate. The value was expressed as the percentage of inhibition in each sample relative to controls (F and G). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–d) are significantly different from one another ( P

Techniques Used: Activation Assay, Cell Culture, Expressing, Western Blot, Activity Assay, Enzymatic Assay, Fluorescence, Labeling, Inhibition

Effects of SIRT1 and SIRT2 inhibitors on renal fibroblast proliferation. NRK-49F cells were cultured in medium with 5% fetal bovine serum and treated with EX527 (0–100 μ M) and AGK2 (0–100 μ M) for 36 hours (A–F). Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies for PCNA, cyclin D1, cyclin E, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; A and B). Representative immunoblots from three experiments are shown. The levels of PCNA, cyclin D1, and cyclin E were quantified by densitometry and normalized with GAPDH (C and D). NRK-49F cells were treated with the indicated concentration of EX527 and AGK2 for 36 hours, cells were randomly photographed in bright field (200×), and cell proliferation was measured by cell counting (E) or the MTT assay (F). To measure cell death, cultured NRK-49F cells were exposed to the same concentrations (0–100 μ M) of EX527 or AGK2 for 48 hours or treated with 1 mM H 2 O 2 for 3 hours as positive control. Cell lysates were subjected to immunoblot analysis for cleaved caspase-3 and GAPDH (G and H). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–e) are significantly different from one another ( P
Figure Legend Snippet: Effects of SIRT1 and SIRT2 inhibitors on renal fibroblast proliferation. NRK-49F cells were cultured in medium with 5% fetal bovine serum and treated with EX527 (0–100 μ M) and AGK2 (0–100 μ M) for 36 hours (A–F). Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies for PCNA, cyclin D1, cyclin E, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; A and B). Representative immunoblots from three experiments are shown. The levels of PCNA, cyclin D1, and cyclin E were quantified by densitometry and normalized with GAPDH (C and D). NRK-49F cells were treated with the indicated concentration of EX527 and AGK2 for 36 hours, cells were randomly photographed in bright field (200×), and cell proliferation was measured by cell counting (E) or the MTT assay (F). To measure cell death, cultured NRK-49F cells were exposed to the same concentrations (0–100 μ M) of EX527 or AGK2 for 48 hours or treated with 1 mM H 2 O 2 for 3 hours as positive control. Cell lysates were subjected to immunoblot analysis for cleaved caspase-3 and GAPDH (G and H). Values are the means ± S.D. of three independent experiments. Bars with different letters (a–e) are significantly different from one another ( P

Techniques Used: Cell Culture, Western Blot, Concentration Assay, Cell Counting, MTT Assay, Positive Control

19) Product Images from "Low-Level Laser Therapy (LLLT) in Dystrophin-Deficient Muscle Cells: Effects on Regeneration Capacity, Inflammation Response and Oxidative Stress"

Article Title: Low-Level Laser Therapy (LLLT) in Dystrophin-Deficient Muscle Cells: Effects on Regeneration Capacity, Inflammation Response and Oxidative Stress

Journal: PLoS ONE

doi: 10.1371/journal.pone.0128567

Analysis of inflammation in control and dystrophic muscle cells. Immunoblot analysis of TNF-α (A) and NF-κB (B). Graphs show protein level in the muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P
Figure Legend Snippet: Analysis of inflammation in control and dystrophic muscle cells. Immunoblot analysis of TNF-α (A) and NF-κB (B). Graphs show protein level in the muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P

Techniques Used:

Analysis of oxidative stress in control and dystrophic muscle cells. In (A), immunoblot analysis shows several bands of 4-HNE-protein adducts, ranging from 17 to 170 kDa. Graphs show protein level in the muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. In (B), quantification of H 2 O 2 production in the muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). In (C) analysis of glutathione levels in the muscle cells from normal (Ctrl) and dystrophic culture cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). All the experiments were performed in triplicate and data expressed as mean ± SD. The relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P
Figure Legend Snippet: Analysis of oxidative stress in control and dystrophic muscle cells. In (A), immunoblot analysis shows several bands of 4-HNE-protein adducts, ranging from 17 to 170 kDa. Graphs show protein level in the muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. In (B), quantification of H 2 O 2 production in the muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). In (C) analysis of glutathione levels in the muscle cells from normal (Ctrl) and dystrophic culture cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). All the experiments were performed in triplicate and data expressed as mean ± SD. The relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P

Techniques Used:

MyoD and Myosin Heavy Chain analysis in control and dystrophic muscle cells. Immunoblot analysis of MyoD (A) and Myosin Heavy Chain (B) and graphs showing protein level in the primary muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P
Figure Legend Snippet: MyoD and Myosin Heavy Chain analysis in control and dystrophic muscle cells. Immunoblot analysis of MyoD (A) and Myosin Heavy Chain (B) and graphs showing protein level in the primary muscle cells from normal (Ctrl) and dystrophic primary muscle cells untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P

Techniques Used:

Morphology and cell proliferation in control and dystrophic muscle cells. In (A), morphology of normal (Ctrl) and dystrophic primary muscle cultures untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Day 1 shows undifferentiated dystrophin-deficient ( mdx ) muscle cells; day 3 shows maturation process in mdx muscle cells and day 6 shows complete morphological maturation with organized sarcomeric structures. In (B), immunoblot analysis of dystrophin and graph showing protein level in the primary muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. In (C), cell proliferation was assessed by measurement of MTT assay in the primary muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. In (D), diameter myotubes from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P
Figure Legend Snippet: Morphology and cell proliferation in control and dystrophic muscle cells. In (A), morphology of normal (Ctrl) and dystrophic primary muscle cultures untreated ( mdx untreated) and LLLT treatment analyzed after 24 hours ( mdx LA 24) and 48 hours ( mdx LA 48). Day 1 shows undifferentiated dystrophin-deficient ( mdx ) muscle cells; day 3 shows maturation process in mdx muscle cells and day 6 shows complete morphological maturation with organized sarcomeric structures. In (B), immunoblot analysis of dystrophin and graph showing protein level in the primary muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. In (C), cell proliferation was assessed by measurement of MTT assay in the primary muscle cells from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. In (D), diameter myotubes from Ctrl, mdx untreated, mdx LA 24 and mdx LA 48. All the experiments were performed in triplicate, and the relative value of the band intensity was quantified and normalized by the corresponding Ctrl. a P

Techniques Used: MTT Assay

20) Product Images from "Krüppel-Like Factor 5 Mediates Proinflammatory Cytokine Expression in Lipopolysaccharide-Induced Acute Lung Injury through Upregulation of Nuclear Factor-κB Phosphorylation In Vitro and In Vivo"

Article Title: Krüppel-Like Factor 5 Mediates Proinflammatory Cytokine Expression in Lipopolysaccharide-Induced Acute Lung Injury through Upregulation of Nuclear Factor-κB Phosphorylation In Vitro and In Vivo

Journal: Mediators of Inflammation

doi: 10.1155/2014/281984

Effects ofKrüppel-like factor 5 (KLF5) overexpression or silencing on p65 phosphorylation and nuclear factor-kappaB (NF- κ B) activity. (a) Cells from the HBEC line were pretreated with the pKLF5 plasmid or transfected with KLF5 small interfering RNA (siRNA) for 48 h, and KLF5, p65, phospho-p65 (Ser276), and phospho-p65 (Ser536) protein expression were measured using western blotting. (b) NF- κ B activity was measured using an electrophoretic mobility shift assay, and (c) the proinflammatory cytokines tumor necrosis factor- α (TNF- α ), interleukin- (IL-) 1 β , and IL-6 were evaluated using western blotting. (d) Cells from the HBEC line were pretreated with N-acetylcysteine (NAC; 10 mM) or pyrrolidine dithiocarbamate (PDTC; 100 μ M) for 1 h and then treated with lipopolysaccharide (LPS; 5 μ g/mL) for 1 h. KLF5 protein expression was evaluated using western blotting. Silencing of KLF5 messenger RNA (mRNA) expression reduced LPS-induced p65 accumulation in the nucleus. (a) Compared with that in the control group, cells treated with LPS alone, or cells transfected with KLF5-specific small interfering RNA (siRNA), NF- κ B binding activity in cells transfected with the KLF5 plasmid increased in response to LPS. (b) Compared with those in the control group, cells treated with LPS alone, or cells transfected with KLF5-specific siRNA, levels of the proinflammatory cytokines TNF- α , IL-1 β , and IL-6 in cells transfected with the KLF5 plasmid were increased. (c) Cells pretreated with the NF- κ B inhibitor PDTC (100 μ M) for 1 h exhibited no reduction in KLF5 protein expression after LPS exposure. (d) Data are presented as means ± SEM from 3 independent experiments. Each bar graph shows summarized data (mean ± SEM) from 3 separate densitometry experiments after normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; an internal control for nuclear protein). * P
Figure Legend Snippet: Effects ofKrüppel-like factor 5 (KLF5) overexpression or silencing on p65 phosphorylation and nuclear factor-kappaB (NF- κ B) activity. (a) Cells from the HBEC line were pretreated with the pKLF5 plasmid or transfected with KLF5 small interfering RNA (siRNA) for 48 h, and KLF5, p65, phospho-p65 (Ser276), and phospho-p65 (Ser536) protein expression were measured using western blotting. (b) NF- κ B activity was measured using an electrophoretic mobility shift assay, and (c) the proinflammatory cytokines tumor necrosis factor- α (TNF- α ), interleukin- (IL-) 1 β , and IL-6 were evaluated using western blotting. (d) Cells from the HBEC line were pretreated with N-acetylcysteine (NAC; 10 mM) or pyrrolidine dithiocarbamate (PDTC; 100 μ M) for 1 h and then treated with lipopolysaccharide (LPS; 5 μ g/mL) for 1 h. KLF5 protein expression was evaluated using western blotting. Silencing of KLF5 messenger RNA (mRNA) expression reduced LPS-induced p65 accumulation in the nucleus. (a) Compared with that in the control group, cells treated with LPS alone, or cells transfected with KLF5-specific small interfering RNA (siRNA), NF- κ B binding activity in cells transfected with the KLF5 plasmid increased in response to LPS. (b) Compared with those in the control group, cells treated with LPS alone, or cells transfected with KLF5-specific siRNA, levels of the proinflammatory cytokines TNF- α , IL-1 β , and IL-6 in cells transfected with the KLF5 plasmid were increased. (c) Cells pretreated with the NF- κ B inhibitor PDTC (100 μ M) for 1 h exhibited no reduction in KLF5 protein expression after LPS exposure. (d) Data are presented as means ± SEM from 3 independent experiments. Each bar graph shows summarized data (mean ± SEM) from 3 separate densitometry experiments after normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; an internal control for nuclear protein). * P

Techniques Used: Over Expression, Activity Assay, Plasmid Preparation, Transfection, Small Interfering RNA, Expressing, Western Blot, Electrophoretic Mobility Shift Assay, Binding Assay

21) Product Images from "Calpeptin Increases the Activity of Upstream Stimulatory Factor and Induces High Level Globin Gene Expression in Erythroid Cells *"

Article Title: Calpeptin Increases the Activity of Upstream Stimulatory Factor and Induces High Level Globin Gene Expression in Erythroid Cells *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.001461

Calpeptin increases the levels of USF and stimulates high level globin gene expression in MEL cells. A , Western blot analysis of USF1, USF2, and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) expression in MEL cells incubated with 30 μ m calpeptin
Figure Legend Snippet: Calpeptin increases the levels of USF and stimulates high level globin gene expression in MEL cells. A , Western blot analysis of USF1, USF2, and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) expression in MEL cells incubated with 30 μ m calpeptin

Techniques Used: Expressing, Western Blot, Incubation

22) Product Images from "Suramin Inhibits Renal Fibrosis in Chronic Kidney Disease"

Article Title: Suramin Inhibits Renal Fibrosis in Chronic Kidney Disease

Journal: Journal of the American Society of Nephrology : JASN

doi: 10.1681/ASN.2010090956

Suramin blocks on UUO-induced α-SMA and fibronectin expression. (A) Kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against α-SMA, fibronectin, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Expression
Figure Legend Snippet: Suramin blocks on UUO-induced α-SMA and fibronectin expression. (A) Kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against α-SMA, fibronectin, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Expression

Techniques Used: Expressing

23) Product Images from "Glycogen Synthase Kinase 3β Dictates Podocyte Motility and Focal Adhesion Turnover by Modulating Paxillin Activity"

Article Title: Glycogen Synthase Kinase 3β Dictates Podocyte Motility and Focal Adhesion Turnover by Modulating Paxillin Activity

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2014.06.027

Lithium counteracts the Adriamycin (ADR; doxorubicin)-induced GSK3β overactivity and paxillin hyperphosphorylation in glomeruli and reinstates actin cytoskeleton integrity in glomerular podocytes. A: Glomeruli were isolated from kidneys from differently treated animals by the magnetic beads–based approach and were homogenized for immunoblot analysis for phosphorylated GSK3β, phosphorylated paxillin, total GSK3β, total paxillin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). B: Densitometric Western blot analysis estimates the relative levels of phosphorylated GSK3β/total GSK3β ratios and phosphorylated paxillin/total paxillin ratios in isolated glomeruli from different groups. C: Frozen kidney sections procured on day 14 were subjected to phalloidin labeling of F-actin (red) as well as immunofluorescence staining for synaptopodin (green), a podocyte marker. Confocal microscopy images. ADR injury not only reduces synaptopodin expression but also diminishes the integrated pixel density of the merged areas (yellow), where F-actin co-localizes with synaptopodin, suggesting a disorganized actin cytoskeletal network in the remnant intact podocytes. Computerized morphometric analysis of the ratios of integrated pixel densities between yellow signal to green signal in immunofluorescence micrographs obtained in C and D . Data are given as means ± SD. n = 6 ( B and D ). ∗ P
Figure Legend Snippet: Lithium counteracts the Adriamycin (ADR; doxorubicin)-induced GSK3β overactivity and paxillin hyperphosphorylation in glomeruli and reinstates actin cytoskeleton integrity in glomerular podocytes. A: Glomeruli were isolated from kidneys from differently treated animals by the magnetic beads–based approach and were homogenized for immunoblot analysis for phosphorylated GSK3β, phosphorylated paxillin, total GSK3β, total paxillin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). B: Densitometric Western blot analysis estimates the relative levels of phosphorylated GSK3β/total GSK3β ratios and phosphorylated paxillin/total paxillin ratios in isolated glomeruli from different groups. C: Frozen kidney sections procured on day 14 were subjected to phalloidin labeling of F-actin (red) as well as immunofluorescence staining for synaptopodin (green), a podocyte marker. Confocal microscopy images. ADR injury not only reduces synaptopodin expression but also diminishes the integrated pixel density of the merged areas (yellow), where F-actin co-localizes with synaptopodin, suggesting a disorganized actin cytoskeletal network in the remnant intact podocytes. Computerized morphometric analysis of the ratios of integrated pixel densities between yellow signal to green signal in immunofluorescence micrographs obtained in C and D . Data are given as means ± SD. n = 6 ( B and D ). ∗ P

Techniques Used: Isolation, Magnetic Beads, Western Blot, Labeling, Immunofluorescence, Staining, Marker, Confocal Microscopy, Expressing

24) Product Images from "Genome-wide RNAi screening identifies TMIGD3 isoform1 as a suppressor of NF-κB and osteosarcoma progression"

Article Title: Genome-wide RNAi screening identifies TMIGD3 isoform1 as a suppressor of NF-κB and osteosarcoma progression

Journal: Nature Communications

doi: 10.1038/ncomms13561

Regulation of the NF-κB pathway by TMIGD3 i1 and A3AR. ( a ) Immunofluorescence for NF-κB (p65), β-catenin and p-Erk1/2 using SJSA-1 cells infected with lentiviral vectors encoding non-silencing control ( C ),  T6U  (TMIGD3) or  A2a  (A3AR) shRNAs. Scale bar, 50 μm. ( b ) Immunoblots for p65, Lamin B and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), using nuclear and cytoplasmic extracts of SJSA-1 cells with or without downregulation of TMIGD3 ( T6U ) or A3AR ( A2a ). ( c ) Immunofluorescence for phosphorylated p65 (p-p65) at serine 536 (S536) using SJSA-1 cells with or without downregulation of TMIGD3 or A3AR. Scale bar, 50 μm. ( d ) Luciferase assays for measuring the NF-κB activity in SJSA-1 cells downregulated for TMIGD3 or A3AR. Graph showing relative luciferase activity normalized to that of SJSA-1 cells infected with non-silencing control lentiviral vector. Error bars: means±s.d. ( n =3 independent experiments). ** P
Figure Legend Snippet: Regulation of the NF-κB pathway by TMIGD3 i1 and A3AR. ( a ) Immunofluorescence for NF-κB (p65), β-catenin and p-Erk1/2 using SJSA-1 cells infected with lentiviral vectors encoding non-silencing control ( C ), T6U (TMIGD3) or A2a (A3AR) shRNAs. Scale bar, 50 μm. ( b ) Immunoblots for p65, Lamin B and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), using nuclear and cytoplasmic extracts of SJSA-1 cells with or without downregulation of TMIGD3 ( T6U ) or A3AR ( A2a ). ( c ) Immunofluorescence for phosphorylated p65 (p-p65) at serine 536 (S536) using SJSA-1 cells with or without downregulation of TMIGD3 or A3AR. Scale bar, 50 μm. ( d ) Luciferase assays for measuring the NF-κB activity in SJSA-1 cells downregulated for TMIGD3 or A3AR. Graph showing relative luciferase activity normalized to that of SJSA-1 cells infected with non-silencing control lentiviral vector. Error bars: means±s.d. ( n =3 independent experiments). ** P

Techniques Used: Immunofluorescence, Infection, Western Blot, Luciferase, Activity Assay, Plasmid Preparation

25) Product Images from "Nitric oxide increases cyclic GMP levels, AMP-activated protein kinase (AMPK)?1-specific activity and glucose transport in human skeletal muscle"

Article Title: Nitric oxide increases cyclic GMP levels, AMP-activated protein kinase (AMPK)?1-specific activity and glucose transport in human skeletal muscle

Journal: Diabetologia

doi: 10.1007/s00125-010-1716-x

Effect of spermine nitric oxide donor on intracellular signalling. Skeletal muscle strips from seven healthy participants were incubated in the absence (basal) or presence of spermine NONOate (Spe-NO, nitric oxide donor; 5 mmol/l) or insulin (120 nmol/l). a Representative immunoblots of protein phosphorylation and abundance. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Bar graphs show quantification for ( b ) pAkt (Ser 473 ), ( c ) pTBC1D1/D4, ( d ) pGSK3α/β (Ser 21/9 ) and ( e ) pCaMK II (Thr 286 ). Results ( b – e ) are mean ± SEM arbitrary units. ** p
Figure Legend Snippet: Effect of spermine nitric oxide donor on intracellular signalling. Skeletal muscle strips from seven healthy participants were incubated in the absence (basal) or presence of spermine NONOate (Spe-NO, nitric oxide donor; 5 mmol/l) or insulin (120 nmol/l). a Representative immunoblots of protein phosphorylation and abundance. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Bar graphs show quantification for ( b ) pAkt (Ser 473 ), ( c ) pTBC1D1/D4, ( d ) pGSK3α/β (Ser 21/9 ) and ( e ) pCaMK II (Thr 286 ). Results ( b – e ) are mean ± SEM arbitrary units. ** p

Techniques Used: Incubation, Western Blot

26) Product Images from "A novel mouse model carrying a human cytoplasmic dynein mutation shows motor behavior deficits consistent with Charcot-Marie-Tooth type 2O disease"

Article Title: A novel mouse model carrying a human cytoplasmic dynein mutation shows motor behavior deficits consistent with Charcot-Marie-Tooth type 2O disease

Journal: Scientific Reports

doi: 10.1038/s41598-018-20081-1

Dynein complex protein levels in wild type and H304R/+ brain tissue. Western blots of brain tissue high speed supernatant from wild-type (lanes 1 and 3) and H304R/+ (lanes 2 and 4) mice were probed for the dynein intermediate chain (lanes 1 and 2) or glyceraldehyde-3-phosphate dehydrogenase (lanes 3 and 4, loading control). The data were statistically compared between wild-type and H304R/+ using the Students t- test (two-tailed distribution, p = 0.23).
Figure Legend Snippet: Dynein complex protein levels in wild type and H304R/+ brain tissue. Western blots of brain tissue high speed supernatant from wild-type (lanes 1 and 3) and H304R/+ (lanes 2 and 4) mice were probed for the dynein intermediate chain (lanes 1 and 2) or glyceraldehyde-3-phosphate dehydrogenase (lanes 3 and 4, loading control). The data were statistically compared between wild-type and H304R/+ using the Students t- test (two-tailed distribution, p = 0.23).

Techniques Used: Western Blot, Mouse Assay, Two Tailed Test

27) Product Images from "The impact of TEL-AML1 (ETV6-RUNX1) expression in precursor B cells and implications for leukaemia using three different genome-wide screening methods"

Article Title: The impact of TEL-AML1 (ETV6-RUNX1) expression in precursor B cells and implications for leukaemia using three different genome-wide screening methods

Journal: Blood Cancer Journal

doi: 10.1038/bcj.2013.48

TEL-AML1 antibody design and specificity testing. ( a ) Design strategy for the TEL-AML1 antibody. The immunization peptide spanning the fusion site between the TEL (white) and AML1 (black) fusion partners is indicated. ( b ) Specificity of the TEL-AML1 antibody. Western blots (WB) of the parental BA/F3 cell line (TA−) and stable cell lines carrying the inducible TEL-AML1 fusion construct (TA+) are treated with mifepristone as indicated. TEL-AML1 was specifically detected only in the induced cell lines, whereas the AML and TEL antibodies (right panels) detected both, the fusion protein and the native protein. Please note that the TEL antibody also detects numerous unspecific bands in the whole-cell lysates. ( c ) Detection of TEL-AML1 fusion protein by fluorescence-activated cell sorting (FACS) analysis. Induction with mifepriston resulted in on average 93.5±0.7% ( n =15;±1 s.d.) cells carrying the TEL-AML1 fusion protein in FACS analysis using the TEL-AML1 antibody. A representative example is shown. Tightness of the induction system is shown in comparison to parental BA/F3 cells treated with mifepriston. Abbreviations: FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: TEL-AML1 antibody design and specificity testing. ( a ) Design strategy for the TEL-AML1 antibody. The immunization peptide spanning the fusion site between the TEL (white) and AML1 (black) fusion partners is indicated. ( b ) Specificity of the TEL-AML1 antibody. Western blots (WB) of the parental BA/F3 cell line (TA−) and stable cell lines carrying the inducible TEL-AML1 fusion construct (TA+) are treated with mifepristone as indicated. TEL-AML1 was specifically detected only in the induced cell lines, whereas the AML and TEL antibodies (right panels) detected both, the fusion protein and the native protein. Please note that the TEL antibody also detects numerous unspecific bands in the whole-cell lysates. ( c ) Detection of TEL-AML1 fusion protein by fluorescence-activated cell sorting (FACS) analysis. Induction with mifepriston resulted in on average 93.5±0.7% ( n =15;±1 s.d.) cells carrying the TEL-AML1 fusion protein in FACS analysis using the TEL-AML1 antibody. A representative example is shown. Tightness of the induction system is shown in comparison to parental BA/F3 cells treated with mifepriston. Abbreviations: FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Western Blot, Stable Transfection, Construct, Fluorescence, FACS

28) Product Images from "Generation of Novel Thyroid Cancer Stem-Like Cell Clones"

Article Title: Generation of Novel Thyroid Cancer Stem-Like Cell Clones

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2016.02.003

Tumorigenicity increases with in vivo passaging. A: Tumor growth rate of Aldefluor (ALD) + THJ-16T cells passaged in vivo . B: RT-PCR results for stem cell marker expression of ALD − and in vivo passaged ALD + (ALD + P1-ALD + P3) tumors. Samples normalized to 18S. C: RT-PCR results of CMET and epidermal growth factor receptor (EGFR) expression of in vivo passaged (P1 to P3) ALD + tumors compared with unsorted parental THJ-16T cells grown in RPMI 1640 media with 10% fetal bovine serum (10% P1). Samples normalized to 18S. D: Western blot of Oct4 and Nanog expression from ALD − tumors compared with in vivo passaged ALD + tumors. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. ∗ P
Figure Legend Snippet: Tumorigenicity increases with in vivo passaging. A: Tumor growth rate of Aldefluor (ALD) + THJ-16T cells passaged in vivo . B: RT-PCR results for stem cell marker expression of ALD − and in vivo passaged ALD + (ALD + P1-ALD + P3) tumors. Samples normalized to 18S. C: RT-PCR results of CMET and epidermal growth factor receptor (EGFR) expression of in vivo passaged (P1 to P3) ALD + tumors compared with unsorted parental THJ-16T cells grown in RPMI 1640 media with 10% fetal bovine serum (10% P1). Samples normalized to 18S. D: Western blot of Oct4 and Nanog expression from ALD − tumors compared with in vivo passaged ALD + tumors. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. ∗ P

Techniques Used: In Vivo, Passaging, Reverse Transcription Polymerase Chain Reaction, Marker, Expressing, Western Blot

29) Product Images from "RyR1-mediated Ca2+ Leak and Ca2+ Entry Determine Resting Intracellular Ca2+ in Skeletal Myotubes *"

Article Title: RyR1-mediated Ca2+ Leak and Ca2+ Entry Determine Resting Intracellular Ca2+ in Skeletal Myotubes *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M110.107300

Expression of Ca 2+ -handling proteins in Wt and RyR-null primary myotubes. Left , representative Western blots using antibodies directed against RyR1, PMCA, NCX3, SERCA1, myosin (to demonstrate similar differentiation state), and glyceraldehyde-3-phosphate
Figure Legend Snippet: Expression of Ca 2+ -handling proteins in Wt and RyR-null primary myotubes. Left , representative Western blots using antibodies directed against RyR1, PMCA, NCX3, SERCA1, myosin (to demonstrate similar differentiation state), and glyceraldehyde-3-phosphate

Techniques Used: Expressing, Western Blot

30) Product Images from "Downregulation of α-Melanocyte-Stimulating Hormone-Induced Activation of the Pax3-MITF-Tyrosinase Axis by Sorghum Ethanolic Extract in B16F10 Melanoma Cells"

Article Title: Downregulation of α-Melanocyte-Stimulating Hormone-Induced Activation of the Pax3-MITF-Tyrosinase Axis by Sorghum Ethanolic Extract in B16F10 Melanoma Cells

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19061640

Effect of sorghum ethanolic extract (SEE) on the suppression of alpha-melanocyte-stimulating hormone (α-MSH)-induced tyrosinase (TYR) expression. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–24 h) and cell lysates were subjected to immunoblotting using antibodies against TYR. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. T/G, tyrosinase/GAPDH ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 12 h, cell lysates were prepared, and immunoblotting was performed using antibodies against TYR. The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative TYR intensity was normalized to that of GAPDH and visualized in the blot. T/G, TYR/GAPDH. ( C , D ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 6 h, total RNA was isolated and TYR mRNA was measured by RT-PCR ( C ) and quantitative real-time PCR ( D ). The GAPDH mRNA level was examined as an internal control. ( E ) B16F10 cells were treated with vehicle (DMSO) or SEE (50 μg/mL) in the absence or presence of 100 nM α-MSH. After 12 h, the cells were fixed and incubated with antibodies against TYR for 2 h, followed by incubation with Alexa Fluor 555-conjugated (red signal) secondary antibodies for 30 min. Nuclear DNA was stained with 1 μg/mL Hoechst 33258 for 10 min (blue signal). The dotted box indicates the region of higher magnification in images.
Figure Legend Snippet: Effect of sorghum ethanolic extract (SEE) on the suppression of alpha-melanocyte-stimulating hormone (α-MSH)-induced tyrosinase (TYR) expression. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–24 h) and cell lysates were subjected to immunoblotting using antibodies against TYR. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. T/G, tyrosinase/GAPDH ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 12 h, cell lysates were prepared, and immunoblotting was performed using antibodies against TYR. The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative TYR intensity was normalized to that of GAPDH and visualized in the blot. T/G, TYR/GAPDH. ( C , D ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 6 h, total RNA was isolated and TYR mRNA was measured by RT-PCR ( C ) and quantitative real-time PCR ( D ). The GAPDH mRNA level was examined as an internal control. ( E ) B16F10 cells were treated with vehicle (DMSO) or SEE (50 μg/mL) in the absence or presence of 100 nM α-MSH. After 12 h, the cells were fixed and incubated with antibodies against TYR for 2 h, followed by incubation with Alexa Fluor 555-conjugated (red signal) secondary antibodies for 30 min. Nuclear DNA was stained with 1 μg/mL Hoechst 33258 for 10 min (blue signal). The dotted box indicates the region of higher magnification in images.

Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Incubation, Staining

Effect of SEE on the inhibition of α-MSH-induced  MITF  promoter activity. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–120 min), and cell lysates were subjected to immunoblotting using an antibody against phospho-cAMP response element-binding protein (CREB) (Ser133). The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 or 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 30 min, cell lysates were subjected to immunoblotting using an antibody against phospho-CREB (Ser133). The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative p-CREB intensity was normalized to that of GAPDH and visualized in the blot. pC/G, p-CREB/GAPDH. ( C ) B16F10 cells were transfected with 0.2 µg of a series of 5′-deletion constructs of the  MITF  gene promoter reporter plasmids. Forty-eight hours later, the cells were treated with either vehicle (DMSO), 100 nM α-MSH, or α-MSH plus 50 μg/mL SEE for 8 h, and the luciferase activities were measured. The data shown represent the mean ± SD ( n  = 3). ****  p
Figure Legend Snippet: Effect of SEE on the inhibition of α-MSH-induced MITF promoter activity. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–120 min), and cell lysates were subjected to immunoblotting using an antibody against phospho-cAMP response element-binding protein (CREB) (Ser133). The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 or 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 30 min, cell lysates were subjected to immunoblotting using an antibody against phospho-CREB (Ser133). The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative p-CREB intensity was normalized to that of GAPDH and visualized in the blot. pC/G, p-CREB/GAPDH. ( C ) B16F10 cells were transfected with 0.2 µg of a series of 5′-deletion constructs of the MITF gene promoter reporter plasmids. Forty-eight hours later, the cells were treated with either vehicle (DMSO), 100 nM α-MSH, or α-MSH plus 50 μg/mL SEE for 8 h, and the luciferase activities were measured. The data shown represent the mean ± SD ( n = 3). **** p

Techniques Used: Inhibition, Activity Assay, Binding Assay, Transfection, Construct, Luciferase

31) Product Images from "Silibinin treatment prevents endotoxin-induced uveitis in rats in vivo and in vitro"

Article Title: Silibinin treatment prevents endotoxin-induced uveitis in rats in vivo and in vitro

Journal: PLoS ONE

doi: 10.1371/journal.pone.0174971

Silibinin inhibits Lipopolysaccharide (LPS)-induced Nitric Oxide Synthase (iNOS), Cyclooxygenase (COX-2), and Intercellular Adhesion Molecule (ICAM-1) expression in RAW cells by suppressing NF-kB activation. Cells were pretreated with 50 and 100 μM of silibinin for 18 h and then were cotreated with 100 ng/mL of LPS for 24 h. The cell lysates were collected to measure the expression of iNOS (A), COX-2 (B), and ICAM-1 (C) protein by western blotting. The optical density of the protein bands for iNOS, COX-2, ICAM-1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was analyzed. The results are presented as the mean ± SD of three independent experiments. The differences in the iNOS, COX-2, and ICAM-1 protein levels in RAW cells from the groups were compared using an ANOVA followed by Tukey’s post hoc test. ns, not significant; ***  P
Figure Legend Snippet: Silibinin inhibits Lipopolysaccharide (LPS)-induced Nitric Oxide Synthase (iNOS), Cyclooxygenase (COX-2), and Intercellular Adhesion Molecule (ICAM-1) expression in RAW cells by suppressing NF-kB activation. Cells were pretreated with 50 and 100 μM of silibinin for 18 h and then were cotreated with 100 ng/mL of LPS for 24 h. The cell lysates were collected to measure the expression of iNOS (A), COX-2 (B), and ICAM-1 (C) protein by western blotting. The optical density of the protein bands for iNOS, COX-2, ICAM-1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was analyzed. The results are presented as the mean ± SD of three independent experiments. The differences in the iNOS, COX-2, and ICAM-1 protein levels in RAW cells from the groups were compared using an ANOVA followed by Tukey’s post hoc test. ns, not significant; *** P

Techniques Used: Expressing, Activation Assay, Western Blot

Effects of silibinin on Lipopolysaccharide (LPS)-induced Nitric Oxide Synthase (iNOS) (A) and Cyclooxygenase (COX)-2 (B) protein expression in the Iris-Ciliary Body (ICB) of rats. For each group, the rat ICBs were collected and rat ICB lysates were prepared and analyzed by immunoblotting/western blotting using antibodies against iNOS, COX-2, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; to normalize protein expression). The optical density of the protein bands for iNOS, COX-2, and GAPDH were analyzed. The data are presented as mean ± SD of four rats per group. The differences in the iNOS and COX-2 protein levels in ICBs of rats from the groups were compared using an ANOVA, followed by Tukey’s post hoc test. **  P
Figure Legend Snippet: Effects of silibinin on Lipopolysaccharide (LPS)-induced Nitric Oxide Synthase (iNOS) (A) and Cyclooxygenase (COX)-2 (B) protein expression in the Iris-Ciliary Body (ICB) of rats. For each group, the rat ICBs were collected and rat ICB lysates were prepared and analyzed by immunoblotting/western blotting using antibodies against iNOS, COX-2, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; to normalize protein expression). The optical density of the protein bands for iNOS, COX-2, and GAPDH were analyzed. The data are presented as mean ± SD of four rats per group. The differences in the iNOS and COX-2 protein levels in ICBs of rats from the groups were compared using an ANOVA, followed by Tukey’s post hoc test. ** P

Techniques Used: Expressing, Western Blot

32) Product Images from "Inhibition of aldose reductase prevents colon cancer metastasis"

Article Title: Inhibition of aldose reductase prevents colon cancer metastasis

Journal: Carcinogenesis

doi: 10.1093/carcin/bgr102

Inhibition of AR prevents expression of metastatic markers during colon cancer metastatic growth in nude mice liver. ( A ) Equal amounts of liver homogenates were subjected to western blot analysis using antibodies against AR, CD34, MMP2, cyclin D1, phospho-p65, total-p65 and Glyceraldehyde-3- phosphate dehydrogenase. Equal amounts of total RNA from liver were analyzed by reverse transcription–PCR for measuring messenger RNA levels of MMP2, cyclin D1 and Glyceraldehyde-3- phosphate dehydrogenase. ( B ) Cross sections of metastatic tumors were stained with anti-AR, anti-CD34, anti-CD31, anti-MMP2, anti-cyclin D1 and anti-phospho-p65. Immunoreactivity is evident as a dark brown stain, whereas non-reactive areas display only the background color. Original magnification: ×400. ( C ) Percent staining was determined by measuring positive immunoreactivity per unit area. Arrows represent the area for positive staining for an antigen. The intensity of antigen staining was quantified by digital image analysis. Bars represent mean ± SEM ( n = 4); * P
Figure Legend Snippet: Inhibition of AR prevents expression of metastatic markers during colon cancer metastatic growth in nude mice liver. ( A ) Equal amounts of liver homogenates were subjected to western blot analysis using antibodies against AR, CD34, MMP2, cyclin D1, phospho-p65, total-p65 and Glyceraldehyde-3- phosphate dehydrogenase. Equal amounts of total RNA from liver were analyzed by reverse transcription–PCR for measuring messenger RNA levels of MMP2, cyclin D1 and Glyceraldehyde-3- phosphate dehydrogenase. ( B ) Cross sections of metastatic tumors were stained with anti-AR, anti-CD34, anti-CD31, anti-MMP2, anti-cyclin D1 and anti-phospho-p65. Immunoreactivity is evident as a dark brown stain, whereas non-reactive areas display only the background color. Original magnification: ×400. ( C ) Percent staining was determined by measuring positive immunoreactivity per unit area. Arrows represent the area for positive staining for an antigen. The intensity of antigen staining was quantified by digital image analysis. Bars represent mean ± SEM ( n = 4); * P

Techniques Used: Inhibition, Expressing, Mouse Assay, Western Blot, Polymerase Chain Reaction, Staining

33) Product Images from "p62/SQSTM1 interacts with vimentin to enhance breast cancer metastasis"

Article Title: p62/SQSTM1 interacts with vimentin to enhance breast cancer metastasis

Journal: Carcinogenesis

doi: 10.1093/carcin/bgx099

p62 expression is positively correlated with vimentin level in breast cancer specimens. ( A ) Both the p62 and vimentin protein expression in breast cancer specimens ( n  = 10; T: tumour) were subjected to western blot analysis. ( B ) Both the p62 and vimentin expression levels were normalized to relative glyceraldehyde 3-phosphate dehydrogenase and linear regression analysis was shown.  R 2  = 0.7539,  P  = 0.0011.
Figure Legend Snippet: p62 expression is positively correlated with vimentin level in breast cancer specimens. ( A ) Both the p62 and vimentin protein expression in breast cancer specimens ( n = 10; T: tumour) were subjected to western blot analysis. ( B ) Both the p62 and vimentin expression levels were normalized to relative glyceraldehyde 3-phosphate dehydrogenase and linear regression analysis was shown. R 2 = 0.7539, P = 0.0011.

Techniques Used: Expressing, Western Blot

34) Product Images from "Long noncoding RNA SPRY4-IT1 promotes malignant development of colorectal cancer by targeting epithelial–mesenchymal transition"

Article Title: Long noncoding RNA SPRY4-IT1 promotes malignant development of colorectal cancer by targeting epithelial–mesenchymal transition

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S111794

Relative expression of  SPRY4-IT1  in CRC tissues and serum samples. Notes:  ( A ) Relative  SPRY4-IT1  expression in 84 paired CRC tissues and corresponding adjacent normal tissues. ( B ) Relative  SPRY4-IT1  expression in serum samples of 88 CRC and 98 healthy controls.  SPRY4-IT1  expression was measured by qRT-PCR and normalized to GAPDH expression. The results are expressed as the fold change. Abbreviations: SPRY4-IT1 , SPRY4 intronic transcript 1; CRC, colorectal cancer; qRT-PCR, quantitative real-time polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Relative expression of SPRY4-IT1 in CRC tissues and serum samples. Notes: ( A ) Relative SPRY4-IT1 expression in 84 paired CRC tissues and corresponding adjacent normal tissues. ( B ) Relative SPRY4-IT1 expression in serum samples of 88 CRC and 98 healthy controls. SPRY4-IT1 expression was measured by qRT-PCR and normalized to GAPDH expression. The results are expressed as the fold change. Abbreviations: SPRY4-IT1 , SPRY4 intronic transcript 1; CRC, colorectal cancer; qRT-PCR, quantitative real-time polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Expressing, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

35) Product Images from "Tetraspanin 8-Rictor-Integrin α3 Complex Is Required for Glioma Cell Migration"

Article Title: Tetraspanin 8-Rictor-Integrin α3 Complex Is Required for Glioma Cell Migration

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms16035363

Over-expression of tetraspanin 8 (Tspan8) in human malignant glioma tissues and cell lines. Expression of Tspan8 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (the loading control) in four different human malignant glioma tissues (“T”) or corresponding surrounded normal brain tissues (“N”) was tested by Western blots ( A ); relative Tspan8 expression ( vs. GAPDH) was quantified ( B ); Expression of Tspan8 and GAPDH in normal brain tissues (from stroke patient) or in different human glioma cell lines (CGH-5, TJ-899, SGH-44, TJ-905 and U251MG) was shown ( C ); relative Tspan8 expression ( vs. GAPDH) was quantified ( n = 3, D ). Data were presented as mean ± SD ( B ). * p
Figure Legend Snippet: Over-expression of tetraspanin 8 (Tspan8) in human malignant glioma tissues and cell lines. Expression of Tspan8 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (the loading control) in four different human malignant glioma tissues (“T”) or corresponding surrounded normal brain tissues (“N”) was tested by Western blots ( A ); relative Tspan8 expression ( vs. GAPDH) was quantified ( B ); Expression of Tspan8 and GAPDH in normal brain tissues (from stroke patient) or in different human glioma cell lines (CGH-5, TJ-899, SGH-44, TJ-905 and U251MG) was shown ( C ); relative Tspan8 expression ( vs. GAPDH) was quantified ( n = 3, D ). Data were presented as mean ± SD ( B ). * p

Techniques Used: Over Expression, Expressing, Western Blot

36) Product Images from "Novel Protective Role of Nicotinamide Phosphoribosyltransferase in Acetaminophen-Induced Acute Liver Injury in Mice"

Article Title: Novel Protective Role of Nicotinamide Phosphoribosyltransferase in Acetaminophen-Induced Acute Liver Injury in Mice

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2018.04.004

Nampt  expression levels correlate with NAD production and liver injury after acetaminophen (APAP) treatment.  A:  Real-time quantitative RT-PCR assays for liver  Nampt  mRNA after saline or APAP treatments. Fold changes are relative to the saline-treated  Nampt +/+  group, which was set to 1.0. Ct values were normalized to β-actin.  B:  Western blot image of NAMPT and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).  C:  Mouse liver NAD levels.  D:  Western blot image of serum NAMPT levels from  Nampt +/+ ,  Nampt OE , and  Nampt +/−  mice.  E:  Mouse serum NAMPT levels and their relationship with serum alanine aminotransferase (ALT) activities. A representative Western blot image of serum NAMPT levels from  Nampt +/+  mice with low (L), medium (M), and high (H) ALT level is displayed. Data are expressed as means ± SD ( A  and  C ).  n  ≥ 3 ( A );  n  = 4 ( C ).  ∗ P
Figure Legend Snippet: Nampt expression levels correlate with NAD production and liver injury after acetaminophen (APAP) treatment. A: Real-time quantitative RT-PCR assays for liver Nampt mRNA after saline or APAP treatments. Fold changes are relative to the saline-treated Nampt +/+ group, which was set to 1.0. Ct values were normalized to β-actin. B: Western blot image of NAMPT and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). C: Mouse liver NAD levels. D: Western blot image of serum NAMPT levels from Nampt +/+ , Nampt OE , and Nampt +/− mice. E: Mouse serum NAMPT levels and their relationship with serum alanine aminotransferase (ALT) activities. A representative Western blot image of serum NAMPT levels from Nampt +/+ mice with low (L), medium (M), and high (H) ALT level is displayed. Data are expressed as means ± SD ( A and C ). n  ≥ 3 ( A ); n  = 4 ( C ). ∗ P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Mouse Assay

37) Product Images from "Comparative Phytochemical Characterization, Genetic Profile, and Antiproliferative Activity of Polyphenol-Rich Extracts from Pigmented Tubers of Different Solanum tuberosum Varieties"

Article Title: Comparative Phytochemical Characterization, Genetic Profile, and Antiproliferative Activity of Polyphenol-Rich Extracts from Pigmented Tubers of Different Solanum tuberosum Varieties

Journal: Molecules

doi: 10.3390/molecules25010233

Polyphenol and anthocyanin-rich extracts (PAE) from  S. tuberosum  varieties restored the apoptotic program in U937 cancer cells, as compared to untreated U937 control cells (Ctr). ( A ) Western blot analysis of the indicated proteins in U937 cells after PAE treatment from “Magenta Love”, “Blue Star”, “Double Fun”, and “Vitelotte” varieties at 2.5 mg/mL for 24 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) detection was used as loading control. ( B ) Western blot analysis of the indicated protein in U937 cells after PAE treatment at 2.5 mg/mL for 24 h. Extracellular signal-regulated protein kinases 1 and 2 (ERKs 1/2) were used as loading control.
Figure Legend Snippet: Polyphenol and anthocyanin-rich extracts (PAE) from S. tuberosum varieties restored the apoptotic program in U937 cancer cells, as compared to untreated U937 control cells (Ctr). ( A ) Western blot analysis of the indicated proteins in U937 cells after PAE treatment from “Magenta Love”, “Blue Star”, “Double Fun”, and “Vitelotte” varieties at 2.5 mg/mL for 24 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) detection was used as loading control. ( B ) Western blot analysis of the indicated protein in U937 cells after PAE treatment at 2.5 mg/mL for 24 h. Extracellular signal-regulated protein kinases 1 and 2 (ERKs 1/2) were used as loading control.

Techniques Used: Western Blot

38) Product Images from "Expression of calcium-buffering proteins in rat intrinsic laryngeal muscles"

Article Title: Expression of calcium-buffering proteins in rat intrinsic laryngeal muscles

Journal: Physiological Reports

doi: 10.14814/phy2.12409

Protein levels of sarcoplasmic reticulum Ca 2+ -handling proteins in intrinsic laryngeal muscles (ILM), cricothyroid (CT) muscle, extraocular muscles (EOM), and tibialis anterior (TA) muscle. Western blot analysis showing relative abundance of indicated proteins: calsequestrins 1 and 2 (CASQ1 and CASQ2), Sercas 1 and 2 (SERCA1 and SERCA2), calmodulin (CaM), calmodulin kinase II (CaMKII), and Orai1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control for protein loading, Western blot transfer and nonspecific changes in protein levels. The molecular weight, expressed in kDa, for each protein is indicated. Quantifications from three independent muscle samples, each sample containing muscles pooled from three or four different rats. Asterisks and different letter combination indicate statistical significance (* P
Figure Legend Snippet: Protein levels of sarcoplasmic reticulum Ca 2+ -handling proteins in intrinsic laryngeal muscles (ILM), cricothyroid (CT) muscle, extraocular muscles (EOM), and tibialis anterior (TA) muscle. Western blot analysis showing relative abundance of indicated proteins: calsequestrins 1 and 2 (CASQ1 and CASQ2), Sercas 1 and 2 (SERCA1 and SERCA2), calmodulin (CaM), calmodulin kinase II (CaMKII), and Orai1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control for protein loading, Western blot transfer and nonspecific changes in protein levels. The molecular weight, expressed in kDa, for each protein is indicated. Quantifications from three independent muscle samples, each sample containing muscles pooled from three or four different rats. Asterisks and different letter combination indicate statistical significance (* P

Techniques Used: Western Blot, Chick Chorioallantoic Membrane Assay, Molecular Weight

39) Product Images from "Intratracheal transplantation of mesenchymal stem cells attenuates hyperoxia-induced lung injury by down-regulating, but not direct inhibiting formyl peptide receptor 1 in the newborn mice"

Article Title: Intratracheal transplantation of mesenchymal stem cells attenuates hyperoxia-induced lung injury by down-regulating, but not direct inhibiting formyl peptide receptor 1 in the newborn mice

Journal: PLoS ONE

doi: 10.1371/journal.pone.0206311

TUNEL-positive apoptotic cells in lung tissue. (A) Representative confocal images of lung tissues stained with TUNEL (green) with DAPI (blue) (left panel, original magnification; ×200, scale bar; 100μm). The number of TUNEL-positive cells per high power field of each group (right panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of caspase 9 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of caspase 9 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P
Figure Legend Snippet: TUNEL-positive apoptotic cells in lung tissue. (A) Representative confocal images of lung tissues stained with TUNEL (green) with DAPI (blue) (left panel, original magnification; ×200, scale bar; 100μm). The number of TUNEL-positive cells per high power field of each group (right panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of caspase 9 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of caspase 9 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P

Techniques Used: TUNEL Assay, Staining, Western Blot, Mouse Assay, Knock-Out

mRNA level of formyl peptide receptor (FPR) 1 in mouse lung tissue. Representative RT-PCR blot of FPR1 (upper panel) and its densitometric histogram, normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), of each group (lower panel). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) Data are given as mean ± SEM. * P
Figure Legend Snippet: mRNA level of formyl peptide receptor (FPR) 1 in mouse lung tissue. Representative RT-PCR blot of FPR1 (upper panel) and its densitometric histogram, normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), of each group (lower panel). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) Data are given as mean ± SEM. * P

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Knock-Out

Angiogenesis in lung tissues. (A) Representative confocal images of von willbrand factor (vWF; red) with DAPI (blue) (upper panel, original magnification; ×100, scale bar; 100μm) and the light intensity and the vessel number of vWF-positive cells per high power field of each group (lower panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of CD31 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of CD31 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (C) Level of vascular endothelial growth factor (VEGF) in lung tissue (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P
Figure Legend Snippet: Angiogenesis in lung tissues. (A) Representative confocal images of von willbrand factor (vWF; red) with DAPI (blue) (upper panel, original magnification; ×100, scale bar; 100μm) and the light intensity and the vessel number of vWF-positive cells per high power field of each group (lower panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of CD31 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of CD31 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (C) Level of vascular endothelial growth factor (VEGF) in lung tissue (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P

Techniques Used: Western Blot, Mouse Assay, Knock-Out

40) Product Images from "Sphingosine Kinase 1 Promotes Malignant Progression in Colon Cancer and Independently Predicts Survival of Patients With Colon Cancer by Competing Risk Approach in South Asian Population"

Article Title: Sphingosine Kinase 1 Promotes Malignant Progression in Colon Cancer and Independently Predicts Survival of Patients With Colon Cancer by Competing Risk Approach in South Asian Population

Journal: Clinical and Translational Gastroenterology

doi: 10.1038/ctg.2013.21

Sphingosine kinase 1 (SphK1) inhibition by compound 5c (5c) reduces the viability of colon cancer cells. ( a ) SphK1 protein levels in HCT116, RKO, SW480, and SW620 cells were measured by western blot with antibodies against SphK1. Glyceraldehyde 3-phosphate dehydrogenase was used as a loading control. ( b ) Whole-cell lysates were prepared respectively from HCT116, RKO, SW480, and SW620 cells pre-treated with or without 10 μ M  5c, and stimulated with 10% fetal bovine serum (FBS) for up to 30 min. Equal amounts of protein lysates were measured for SphK activity using the fluorometric SphK Assay. * P
Figure Legend Snippet: Sphingosine kinase 1 (SphK1) inhibition by compound 5c (5c) reduces the viability of colon cancer cells. ( a ) SphK1 protein levels in HCT116, RKO, SW480, and SW620 cells were measured by western blot with antibodies against SphK1. Glyceraldehyde 3-phosphate dehydrogenase was used as a loading control. ( b ) Whole-cell lysates were prepared respectively from HCT116, RKO, SW480, and SW620 cells pre-treated with or without 10 μ M 5c, and stimulated with 10% fetal bovine serum (FBS) for up to 30 min. Equal amounts of protein lysates were measured for SphK activity using the fluorometric SphK Assay. * P

Techniques Used: Inhibition, Western Blot, Activity Assay

41) Product Images from "Interaction between NO and COX pathways modulating hepatic endothelial cells from control and cirrhotic rats"

Article Title: Interaction between NO and COX pathways modulating hepatic endothelial cells from control and cirrhotic rats

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/j.1582-4934.2012.01563.x

Effects of NO inhibition on COX pathway in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of COX-1 from control HEC treated with vehicle (Veh) or with L-NAME. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n  = 7 per group). (B) Prostacyclin (PGI 2 ) and Thromboxane (TXA 2 ) production in control HEC treated with Veh or L-NAME in the presence of the calcium ionophore A23187 or its Veh ( n  = 6 per group). The mean prostanoid levels of HEC treated with Veh+Veh was considered one. NO inhibition did not modify either basal or A23187-induced prostanoid (PGI 2  and TXA 2 ) production. (C) Representative Western blot and analysis of COX-1 from cirrhotic HEC treated with vehicle (Veh) or with L-NAME. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n  = 9 per group). (D) Thromboxane (TXA 2 ) production by cirrhotic HEC treated with Veh or L-NAME in the presence of A23187 or its Veh ( n  = 9 per group). The mean prostanoid levels of HEC treated with Veh+Veh was considered one. NO inhibition did not modify either basal or A23187 induced TXA 2  production.
Figure Legend Snippet: Effects of NO inhibition on COX pathway in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of COX-1 from control HEC treated with vehicle (Veh) or with L-NAME. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n = 7 per group). (B) Prostacyclin (PGI 2 ) and Thromboxane (TXA 2 ) production in control HEC treated with Veh or L-NAME in the presence of the calcium ionophore A23187 or its Veh ( n = 6 per group). The mean prostanoid levels of HEC treated with Veh+Veh was considered one. NO inhibition did not modify either basal or A23187-induced prostanoid (PGI 2 and TXA 2 ) production. (C) Representative Western blot and analysis of COX-1 from cirrhotic HEC treated with vehicle (Veh) or with L-NAME. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n = 9 per group). (D) Thromboxane (TXA 2 ) production by cirrhotic HEC treated with Veh or L-NAME in the presence of A23187 or its Veh ( n = 9 per group). The mean prostanoid levels of HEC treated with Veh+Veh was considered one. NO inhibition did not modify either basal or A23187 induced TXA 2 production.

Techniques Used: Inhibition, Western Blot

Effects of NO supplementation on COX pathway in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of COX-1 from control HEC treated with sodium nitroprusside (SNP) or its vehicle in the presence of AA. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups. ( n  = 5 per group). (B) Prostacylin (PGI 2 ) and Thromboxane (TXA 2 ) production by HEC from control rats stimulated with AA in the presence or absence of the exogenous NO donor SNP ( n  = 6 per group). In control HEC, NO supplementation produced a significant and similar decrease in PGI 2  (−38%) and TXA 2  (−36%). (* P
Figure Legend Snippet: Effects of NO supplementation on COX pathway in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of COX-1 from control HEC treated with sodium nitroprusside (SNP) or its vehicle in the presence of AA. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups. ( n = 5 per group). (B) Prostacylin (PGI 2 ) and Thromboxane (TXA 2 ) production by HEC from control rats stimulated with AA in the presence or absence of the exogenous NO donor SNP ( n = 6 per group). In control HEC, NO supplementation produced a significant and similar decrease in PGI 2 (−38%) and TXA 2 (−36%). (* P

Techniques Used: Western Blot, Produced

Prostacyclin and Thromboxane synthase protein expression in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of prostacyclin synthase (PGIS) from control and cirrhotic HEC. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n  = 4 per group). (B) Representative Western blot and analysis of thromboxane synthase (TXAS) from control and cirrhotic HEC. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed a significant increase in TXAS in cirrhotic HEC ( n  = 4 per group) (* P
Figure Legend Snippet: Prostacyclin and Thromboxane synthase protein expression in control and cirrhotic hepatic endothelial cells (HEC). (A) Representative Western blot and analysis of prostacyclin synthase (PGIS) from control and cirrhotic HEC. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed no differences between both groups ( n = 4 per group). (B) Representative Western blot and analysis of thromboxane synthase (TXAS) from control and cirrhotic HEC. Densitometry quantification in arbitrary units, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), showed a significant increase in TXAS in cirrhotic HEC ( n = 4 per group) (* P

Techniques Used: Expressing, Western Blot

42) Product Images from "Functional microarray analysis of differentially expressed genes in granulosa cells from women with polycystic ovary syndrome related to MAPK/ERK signaling"

Article Title: Functional microarray analysis of differentially expressed genes in granulosa cells from women with polycystic ovary syndrome related to MAPK/ERK signaling

Journal: Scientific Reports

doi: 10.1038/srep14994

The activation of MAP3K4 and p-ERK1/2 was decreased in PCOS granulosa cells when compared with the non-PCOS granulosa cells. Western blot analysis of the MAP3K4 protein ( A ) and the p-ERK1/2 protein ( B ) in the non-PCOS granulosa cells and PCOS granulosa cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), internal control for quantitation. Bar chart represents the quantitation of protein levels. *P 
Figure Legend Snippet: The activation of MAP3K4 and p-ERK1/2 was decreased in PCOS granulosa cells when compared with the non-PCOS granulosa cells. Western blot analysis of the MAP3K4 protein ( A ) and the p-ERK1/2 protein ( B ) in the non-PCOS granulosa cells and PCOS granulosa cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), internal control for quantitation. Bar chart represents the quantitation of protein levels. *P 

Techniques Used: Activation Assay, Western Blot, Quantitation Assay

43) Product Images from "Effects of Aluminum on the Integrity of the Intestinal Epithelium: An in Vitro and in Vivo Study"

Article Title: Effects of Aluminum on the Integrity of the Intestinal Epithelium: An in Vitro and in Vivo Study

Journal: Environmental Health Perspectives

doi: 10.1289/EHP5701

Gene expression of  TNF- α ,  IL- 1 β , and IL-6 in  AlCl 3 -treated mouse colon tissue sample. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the  mean ± SEM  ( n = 6 – 8 ); * p
Figure Legend Snippet: Gene expression of TNF- α , IL- 1 β , and IL-6 in AlCl 3 -treated mouse colon tissue sample. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the mean ± SEM ( n = 6 – 8 ); * p

Techniques Used: Expressing

Markers of activation of the extracellular signal-regulated kinase 1/2 (ERK1/2) and nuclear factor-kappa B ( NF- κ B ) pathways by  AlCl 3  in HT-29 cells. (A) Phosphorylation of ERK in cells treated with  AlCl 3  ( 0 – 4   mM ,  1 h ) with or without pretreatment with  N -acetylcysteine (NAC;  5   mM ,  1 h ) ( n = 3   wells / group ). The level of p-ERK was compared with the level of total ERK by the stripping procedure. (B) Nuclear expression of  NF- κ B  p65 in cells treated with  AlCl 3  ( 0 – 4   mM ,  6 h ) ( n = 3   wells / group ). Lamin B was used as the nuclear housekeeping gene. (C and D) Cells were treated with  AlCl 3  ( 2   mM ,  24 h ) with or without pretreatment with PD98059 (PD) ( 20 μ M ,  1 h ) or Bay ( 15 μ M ,  1 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The Western blots shown are representative images of three independent experiments. The values represent the  mean ± SEM  ( n = 3 ). ** p
Figure Legend Snippet: Markers of activation of the extracellular signal-regulated kinase 1/2 (ERK1/2) and nuclear factor-kappa B ( NF- κ B ) pathways by AlCl 3 in HT-29 cells. (A) Phosphorylation of ERK in cells treated with AlCl 3 ( 0 – 4   mM , 1 h ) with or without pretreatment with N -acetylcysteine (NAC; 5   mM , 1 h ) ( n = 3   wells / group ). The level of p-ERK was compared with the level of total ERK by the stripping procedure. (B) Nuclear expression of NF- κ B p65 in cells treated with AlCl 3 ( 0 – 4   mM , 6 h ) ( n = 3   wells / group ). Lamin B was used as the nuclear housekeeping gene. (C and D) Cells were treated with AlCl 3 ( 2   mM , 24 h ) with or without pretreatment with PD98059 (PD) ( 20 μ M , 1 h ) or Bay ( 15 μ M , 1 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The Western blots shown are representative images of three independent experiments. The values represent the mean ± SEM ( n = 3 ). ** p

Techniques Used: Activation Assay, Stripping Membranes, Expressing, Western Blot

Activity of metalloproteinase-9 (MMP-9), and mRNA expression of MMP-9 and myosin light-chain kinase (MLCK) in  AlCl 3 -treated HT-29 cells. (A) The cells were treated with  AlCl 3  ( 0 – 4   mM ,  24 h ). The MMP-9 activity in cultured medium was measured by gelatin zymography. The image shown is representative of three independent experiments. (B) Gene expression of MMP-9 and MLCK in cells treated with  AlCl 3  ( 0 – 4   mM ,  12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. (C) Gene expression of MMP-9 in cells pretreated with Bay ( 15 μ M ,  1 h ), followed by  AlCl 3  treatment ( 2   mM ,  12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the  mean ± SEM  ( n = 3 ); * p
Figure Legend Snippet: Activity of metalloproteinase-9 (MMP-9), and mRNA expression of MMP-9 and myosin light-chain kinase (MLCK) in AlCl 3 -treated HT-29 cells. (A) The cells were treated with AlCl 3 ( 0 – 4   mM , 24 h ). The MMP-9 activity in cultured medium was measured by gelatin zymography. The image shown is representative of three independent experiments. (B) Gene expression of MMP-9 and MLCK in cells treated with AlCl 3 ( 0 – 4   mM , 12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. (C) Gene expression of MMP-9 in cells pretreated with Bay ( 15 μ M , 1 h ), followed by AlCl 3 treatment ( 2   mM , 12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the mean ± SEM ( n = 3 ); * p

Techniques Used: Activity Assay, Expressing, Cell Culture, Zymography

Measures informative of epithelial barrier function in HT-29 cells treated with  AlCl 3 . (A) Cell monolayers were treated with  AlCl 3  ( 2   mM , up to  24 h ) with or without pretreatment with  N -acetylcysteine (NAC) ( 5   mM ,  1 h ) or PD98059 (PD) ( 20 μ M ,  1 h ). Transepithelial electrical resistance (TEER) was measured in the cells ( n = 3   wells / group ). (B and C) Gene and protein expression of tight junction molecules. The cells were treated with  AlCl 3  ( 0 – 4   mM ,  12 – 24 h ). The mRNA level ( 12 h ) and protein expression ( 24 h ) of occludin and claudin-1 were measured ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. (D) Fluorescence microscopy of occludin and claudin-1. The cells were treated with  AlCl 3  ( 2   mM ,  24 h ). The images shown are representatives of three independent experiments. The values represent the  mean ± SEM  ( n = 3 ); * p
Figure Legend Snippet: Measures informative of epithelial barrier function in HT-29 cells treated with AlCl 3 . (A) Cell monolayers were treated with AlCl 3 ( 2   mM , up to 24 h ) with or without pretreatment with N -acetylcysteine (NAC) ( 5   mM , 1 h ) or PD98059 (PD) ( 20 μ M , 1 h ). Transepithelial electrical resistance (TEER) was measured in the cells ( n = 3   wells / group ). (B and C) Gene and protein expression of tight junction molecules. The cells were treated with AlCl 3 ( 0 – 4   mM , 12 – 24 h ). The mRNA level ( 12 h ) and protein expression ( 24 h ) of occludin and claudin-1 were measured ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. (D) Fluorescence microscopy of occludin and claudin-1. The cells were treated with AlCl 3 ( 2   mM , 24 h ). The images shown are representatives of three independent experiments. The values represent the mean ± SEM ( n = 3 ); * p

Techniques Used: Expressing, Fluorescence, Microscopy

Gene expression of  TNF- α ,  IL- 1 β , and IL-6 in  AlCl 3 -treated HT-29 cells. The cells were treated with  AlCl 3  ( 0 – 4   mM ,  12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the  mean ± SEM  ( n = 3 ); * p
Figure Legend Snippet: Gene expression of TNF- α , IL- 1 β , and IL-6 in AlCl 3 -treated HT-29 cells. The cells were treated with AlCl 3 ( 0 – 4   mM , 12 h ) ( n = 3   wells / group ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The values represent the mean ± SEM ( n = 3 ); * p

Techniques Used: Expressing

44) Product Images from "Elevated expression of podoplanin and its clinicopathological, prognostic, and therapeutic values in squamous non-small cell lung cancer"

Article Title: Elevated expression of podoplanin and its clinicopathological, prognostic, and therapeutic values in squamous non-small cell lung cancer

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S163510

PDPN expression in A549 and H226 human NSCLC cell lines:  (A) PDPN  mRNA expression in A549 and H226 cell lines from the NCI-60 cell lines study;  (B)  Western blot analyses of PDPN expression in A549 and H226 cell lines. GAPDH was used as an internal reference.  (C, D)  Flow cytometry analyses of A549 and H226 cells to determine PDPN expression on their surface. Cell lines were stained with anti-PDPN-AF488 antibody (open black peaks) or an isotype control antibody (filled gray peaks). Abbreviations:  PDPN, podoplanin; NSCLC, non-small cell lung cancer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: PDPN expression in A549 and H226 human NSCLC cell lines: (A) PDPN mRNA expression in A549 and H226 cell lines from the NCI-60 cell lines study; (B) Western blot analyses of PDPN expression in A549 and H226 cell lines. GAPDH was used as an internal reference. (C, D) Flow cytometry analyses of A549 and H226 cells to determine PDPN expression on their surface. Cell lines were stained with anti-PDPN-AF488 antibody (open black peaks) or an isotype control antibody (filled gray peaks). Abbreviations: PDPN, podoplanin; NSCLC, non-small cell lung cancer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Expressing, Western Blot, Flow Cytometry, Cytometry, Staining

45) Product Images from "Gelidium elegans Extract Ameliorates Type 2 Diabetes via Regulation of MAPK and PI3K/Akt Signaling"

Article Title: Gelidium elegans Extract Ameliorates Type 2 Diabetes via Regulation of MAPK and PI3K/Akt Signaling

Journal: Nutrients

doi: 10.3390/nu10010051

Effect of GEE on GLUT4 protein expression in the skeletal muscle and liver of db/db mice. Five-week-old mice were administered with or without GEE (50 and 200 mg/kg/day) for five weeks. GLUT4 was quantified by western blotting in the skeletal muscle ( A ) and liver ( B ). Protein expression was quantified after normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using Image J software. Data were analyzed by a one-way ANOVA followed by Duncan’s test. Data are mean ± SD ( n  = 8 per group,  a p
Figure Legend Snippet: Effect of GEE on GLUT4 protein expression in the skeletal muscle and liver of db/db mice. Five-week-old mice were administered with or without GEE (50 and 200 mg/kg/day) for five weeks. GLUT4 was quantified by western blotting in the skeletal muscle ( A ) and liver ( B ). Protein expression was quantified after normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using Image J software. Data were analyzed by a one-way ANOVA followed by Duncan’s test. Data are mean ± SD ( n = 8 per group, a p

Techniques Used: Expressing, Mouse Assay, Western Blot, Software

46) Product Images from "Dietary Linoleic Acid and Its Oxidized Metabolites Exacerbate Liver Injury Caused by Ethanol via Induction of Hepatic Proinflammatory Response in Mice"

Article Title: Dietary Linoleic Acid and Its Oxidized Metabolites Exacerbate Liver Injury Caused by Ethanol via Induction of Hepatic Proinflammatory Response in Mice

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2017.06.008

Effect of different types of dietary lipids and chronic ethanol (EtOH) administration on hepatic oxidative stress. A: Cytochrome p450 2E1 (CYP2E1) protein expression analyzed by Western blotting with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as loading control (Ctrl). B: The intensity of protein bands (from A ) was quantified by densitometry using the ImageJ software. C and D: Representative images and quantification of hepatic 4-hydroxy-2-nonenal staining (4-HNE). Quantification is presented as percentage of 4-HNE–positive area over the entire area of the image slide, and was performed using ImageJ by manually chosen identical thresholds applied to all images being analyzed. E: Hepatic thiobarbituric acid reactive substance (TBARS) levels. Data are expressed as means ± SEM . Each experiment is a representative of the average of 8–10 mice in each group. ∗ P
Figure Legend Snippet: Effect of different types of dietary lipids and chronic ethanol (EtOH) administration on hepatic oxidative stress. A: Cytochrome p450 2E1 (CYP2E1) protein expression analyzed by Western blotting with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as loading control (Ctrl). B: The intensity of protein bands (from A ) was quantified by densitometry using the ImageJ software. C and D: Representative images and quantification of hepatic 4-hydroxy-2-nonenal staining (4-HNE). Quantification is presented as percentage of 4-HNE–positive area over the entire area of the image slide, and was performed using ImageJ by manually chosen identical thresholds applied to all images being analyzed. E: Hepatic thiobarbituric acid reactive substance (TBARS) levels. Data are expressed as means ± SEM . Each experiment is a representative of the average of 8–10 mice in each group. ∗ P

Techniques Used: Expressing, Western Blot, Software, Staining, Mouse Assay

47) Product Images from "WNT5A Inhibits Hepatocyte Proliferation and Concludes β-Catenin Signaling in Liver Regeneration"

Article Title: WNT5A Inhibits Hepatocyte Proliferation and Concludes β-Catenin Signaling in Liver Regeneration

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2015.04.021

Baseline characterization of Wnt5a –liver-specific knockout (LKO) mice. A: Representative PCR for genotyping mice to identify Wnt5a flox/flox ; Albumin -Cre +/− or Wnt5a -LKO (lane 1). Mice with genotype Wnt5a flox/flox ; Albumin -Cre −/− or Wnt5a flox/wt ; Albumin -Cre −/− (lanes 3 and 4) were used as controls (Con). B: A Western blot (WB) analysis shows a decrease in Wnt5a expression in livers of Wnt5a -LKO compared with Con. Correct band for Wnt5a protein is shown ( arrow ). C: Liver weight/body weight (LW/BW) ratio remains unchanged in 8-month-old Wnt5a -LKO compared with Con. D: Immunohistochemistry (IHC) shows only occasional proliferating cell nuclear antigen (PCNA)–positive hepatocytes in both Con and Wnt5a -LKO livers. E: Quantification of PCNA staining shows no difference in the number of positive hepatocytes between Con and Wnt5a -LKO. F: Representative WB shows comparable expression of β-catenin and cyclin-D1 in the Wnt5a -LKO and Con livers at baseline. G: IHC for glutamine synthetase (GS), Cyp1a2, and Cyp2e1 shows normal pericentral expression in both Con and Wnt5a -LKO livers. Original magnification: ×200 ( D ); ×100 ( G ). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WT, wild type.
Figure Legend Snippet: Baseline characterization of Wnt5a –liver-specific knockout (LKO) mice. A: Representative PCR for genotyping mice to identify Wnt5a flox/flox ; Albumin -Cre +/− or Wnt5a -LKO (lane 1). Mice with genotype Wnt5a flox/flox ; Albumin -Cre −/− or Wnt5a flox/wt ; Albumin -Cre −/− (lanes 3 and 4) were used as controls (Con). B: A Western blot (WB) analysis shows a decrease in Wnt5a expression in livers of Wnt5a -LKO compared with Con. Correct band for Wnt5a protein is shown ( arrow ). C: Liver weight/body weight (LW/BW) ratio remains unchanged in 8-month-old Wnt5a -LKO compared with Con. D: Immunohistochemistry (IHC) shows only occasional proliferating cell nuclear antigen (PCNA)–positive hepatocytes in both Con and Wnt5a -LKO livers. E: Quantification of PCNA staining shows no difference in the number of positive hepatocytes between Con and Wnt5a -LKO. F: Representative WB shows comparable expression of β-catenin and cyclin-D1 in the Wnt5a -LKO and Con livers at baseline. G: IHC for glutamine synthetase (GS), Cyp1a2, and Cyp2e1 shows normal pericentral expression in both Con and Wnt5a -LKO livers. Original magnification: ×200 ( D ); ×100 ( G ). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WT, wild type.

Techniques Used: Knock-Out, Mouse Assay, Polymerase Chain Reaction, Western Blot, Expressing, Immunohistochemistry, Staining

Ablation of Wnt5a in liver epithelial cells has no effect on liver regeneration. A: Immunohistochemistry (IHC) for proliferating cell nuclear antigen (PCNA) shows comparable numbers of positive hepatocytes in the liver-specific knockouts of Wntless ( Wls -LKO) and control (Con) at various time points after partial hepatectomy (PH). B: Quantification of PCNA staining shows insignificant differences in the number of positive hepatocytes in Con and Wls -LKO at various time points after PH. C: A Western blot analysis shows comparable levels of expression of cyclin-D1 at 40, 72, and 96 hours after PH in both Con and Wls- LKO. Original magnification, ×200 ( A ). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure Legend Snippet: Ablation of Wnt5a in liver epithelial cells has no effect on liver regeneration. A: Immunohistochemistry (IHC) for proliferating cell nuclear antigen (PCNA) shows comparable numbers of positive hepatocytes in the liver-specific knockouts of Wntless ( Wls -LKO) and control (Con) at various time points after partial hepatectomy (PH). B: Quantification of PCNA staining shows insignificant differences in the number of positive hepatocytes in Con and Wls -LKO at various time points after PH. C: A Western blot analysis shows comparable levels of expression of cyclin-D1 at 40, 72, and 96 hours after PH in both Con and Wls- LKO. Original magnification, ×200 ( A ). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Techniques Used: Immunohistochemistry, Staining, Western Blot, Expressing

Real-time quantitative PCR (qPCR) analysis shows a significant increase in Wnt5a expression at 24 and 48 hours ( A ) and Frizzled-2 expression at 24, 48, and 72 hours ( B ) after partial hepatectomy (PH) compared with shams. C: A representative Western blot analysis shows increased expression of Wnt5a and Frizzled-2 at 24 to 72 hours after PH compared with shams. Comparable protein loading was verified by glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The exposure times for the representative blots were normalized on the basis of a common protein on both gels to ensure comparison. D: qPCR analysis shows changes in Wnt5a, Frizzled-2, and Frizzled-4 mRNA expression at early time points after PH (1, 3, 6, 12, and 24 hours). A significant increase in Wnt5a is observed at 1 and 12 hours; Frizzled-2 expression does not increase at these time points. At 24 hours, a significant concomitant increase in Wnt5a and Frizzled-2 is observed. Frizzled-4 levels do not show an increase. E: Western blot from two representative control (Con) and liver-specific knockouts of Wntless ( Wls -LKO) livers show a notable decrease in Wnt5a in the Wls -LKO at 2 and 3 days after PH compared with controls. Equal loading was verified by β-actin. F: An enzyme-linked immunosorbent assay (ELISA) was performed on conditioned media collected after 24 hours' culture of hepatocytes isolated from regenerating Con and Wls -LKO livers at 48 hours after PH. A representative ELISA shows approximately 60% decrease in the Wnt5a concentration in the conditioned medium collected from Wls- LKO hepatocytes compared with Con. ∗ P
Figure Legend Snippet: Real-time quantitative PCR (qPCR) analysis shows a significant increase in Wnt5a expression at 24 and 48 hours ( A ) and Frizzled-2 expression at 24, 48, and 72 hours ( B ) after partial hepatectomy (PH) compared with shams. C: A representative Western blot analysis shows increased expression of Wnt5a and Frizzled-2 at 24 to 72 hours after PH compared with shams. Comparable protein loading was verified by glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The exposure times for the representative blots were normalized on the basis of a common protein on both gels to ensure comparison. D: qPCR analysis shows changes in Wnt5a, Frizzled-2, and Frizzled-4 mRNA expression at early time points after PH (1, 3, 6, 12, and 24 hours). A significant increase in Wnt5a is observed at 1 and 12 hours; Frizzled-2 expression does not increase at these time points. At 24 hours, a significant concomitant increase in Wnt5a and Frizzled-2 is observed. Frizzled-4 levels do not show an increase. E: Western blot from two representative control (Con) and liver-specific knockouts of Wntless ( Wls -LKO) livers show a notable decrease in Wnt5a in the Wls -LKO at 2 and 3 days after PH compared with controls. Equal loading was verified by β-actin. F: An enzyme-linked immunosorbent assay (ELISA) was performed on conditioned media collected after 24 hours' culture of hepatocytes isolated from regenerating Con and Wls -LKO livers at 48 hours after PH. A representative ELISA shows approximately 60% decrease in the Wnt5a concentration in the conditioned medium collected from Wls- LKO hepatocytes compared with Con. ∗ P

Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Isolation, Concentration Assay

Wnt5a decreases β-catenin expression and activity and cell proliferation in liver cells. A: Treatment (48 hours) with 3 μg/mL human recombinant Wnt5a significantly decreases the TopFlash activity in human hepatoblastoma cell line (HepG2)–treated cells compared with phosphate-buffered saline (PBS). Wnt5a has no effect. B: Wnt5a-conditioned media (CM) derived from L cells show a dose-dependent decrease in HepG2 cell thymidine incorporation compared with treatment with media collected from control L cells. C: Treatment of transiently transfected HepG2 cells with 3 μg/mL recombinant human Wnt5a or HepG2 cells, transiently transfected with Frizzled-2–green fluorescent protein (GFP) expression plasmid, shows significantly lower TopFlash activity than HepG2 cells transiently transfected with pcDNA plasmid and treated with PBS. A more pronounced and synergistic decrease in TopFlash activity is seen with the treatment of Wnt5a on HepG2 cells transiently transfected with Frizzled-2–GFP. The transient transfection of Frizzled-2–GFP expression plasmid was measured by immunofluorescence (IF) for GFP that shows approximately 30% of cells to be transfected at 24 hours after transfection. D: Treatment of pcDNA-transfected HepG2 cells with 3 μg/mL recombinant human Wnt5a or transient expression of Frizzled-2–GFP in HepG2 cells leads to a significant decrease in thymidine incorporation at 48 hours when compared with pcDNA-transfected HepG2 cells treated with PBS. Combining the treatments elicits a more pronounced and synergistic effect. E: Addition of growth factors (GFs; epidermal growth factor and hepatocyte growth factor) to mouse growth medium (MGM) increases thymidine incorporation in primary mouse hepatocytes after 48 hours in culture. The addition of Wnt5a to MGM or growth factor media significantly decreases cell proliferation after 48 hours. F: Representative WB using whole cell lysates from hepatocytes cultured in MGM with Wnt5a for 48 hours shows a notable decrease in levels of β-catenin, cyclin-D1, and Frizzled-4 expression, and notable increases in Frizzled-2 and Ror2 when compared with media alone. No changes were observed in total glycogen synthetase kinase (GSK)-3β protein. Equal protein loading was verified by glyceraldehyde-3-phosphate dehydrogenase (GAPDH). ∗ P
Figure Legend Snippet: Wnt5a decreases β-catenin expression and activity and cell proliferation in liver cells. A: Treatment (48 hours) with 3 μg/mL human recombinant Wnt5a significantly decreases the TopFlash activity in human hepatoblastoma cell line (HepG2)–treated cells compared with phosphate-buffered saline (PBS). Wnt5a has no effect. B: Wnt5a-conditioned media (CM) derived from L cells show a dose-dependent decrease in HepG2 cell thymidine incorporation compared with treatment with media collected from control L cells. C: Treatment of transiently transfected HepG2 cells with 3 μg/mL recombinant human Wnt5a or HepG2 cells, transiently transfected with Frizzled-2–green fluorescent protein (GFP) expression plasmid, shows significantly lower TopFlash activity than HepG2 cells transiently transfected with pcDNA plasmid and treated with PBS. A more pronounced and synergistic decrease in TopFlash activity is seen with the treatment of Wnt5a on HepG2 cells transiently transfected with Frizzled-2–GFP. The transient transfection of Frizzled-2–GFP expression plasmid was measured by immunofluorescence (IF) for GFP that shows approximately 30% of cells to be transfected at 24 hours after transfection. D: Treatment of pcDNA-transfected HepG2 cells with 3 μg/mL recombinant human Wnt5a or transient expression of Frizzled-2–GFP in HepG2 cells leads to a significant decrease in thymidine incorporation at 48 hours when compared with pcDNA-transfected HepG2 cells treated with PBS. Combining the treatments elicits a more pronounced and synergistic effect. E: Addition of growth factors (GFs; epidermal growth factor and hepatocyte growth factor) to mouse growth medium (MGM) increases thymidine incorporation in primary mouse hepatocytes after 48 hours in culture. The addition of Wnt5a to MGM or growth factor media significantly decreases cell proliferation after 48 hours. F: Representative WB using whole cell lysates from hepatocytes cultured in MGM with Wnt5a for 48 hours shows a notable decrease in levels of β-catenin, cyclin-D1, and Frizzled-4 expression, and notable increases in Frizzled-2 and Ror2 when compared with media alone. No changes were observed in total glycogen synthetase kinase (GSK)-3β protein. Equal protein loading was verified by glyceraldehyde-3-phosphate dehydrogenase (GAPDH). ∗ P

Techniques Used: Expressing, Activity Assay, Recombinant, Derivative Assay, Transfection, Plasmid Preparation, Immunofluorescence, Western Blot, Cell Culture

48) Product Images from "Intratracheal transplantation of mesenchymal stem cells attenuates hyperoxia-induced lung injury by down-regulating, but not direct inhibiting formyl peptide receptor 1 in the newborn mice"

Article Title: Intratracheal transplantation of mesenchymal stem cells attenuates hyperoxia-induced lung injury by down-regulating, but not direct inhibiting formyl peptide receptor 1 in the newborn mice

Journal: PLoS ONE

doi: 10.1371/journal.pone.0206311

TUNEL-positive apoptotic cells in lung tissue. (A) Representative confocal images of lung tissues stained with TUNEL (green) with DAPI (blue) (left panel, original magnification; ×200, scale bar; 100μm). The number of TUNEL-positive cells per high power field of each group (right panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of caspase 9 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of caspase 9 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P
Figure Legend Snippet: TUNEL-positive apoptotic cells in lung tissue. (A) Representative confocal images of lung tissues stained with TUNEL (green) with DAPI (blue) (left panel, original magnification; ×200, scale bar; 100μm). The number of TUNEL-positive cells per high power field of each group (right panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of caspase 9 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of caspase 9 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P

Techniques Used: TUNEL Assay, Staining, Western Blot, Mouse Assay, Knock-Out

mRNA level of formyl peptide receptor (FPR) 1 in mouse lung tissue. Representative RT-PCR blot of FPR1 (upper panel) and its densitometric histogram, normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), of each group (lower panel). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) Data are given as mean ± SEM. * P
Figure Legend Snippet: mRNA level of formyl peptide receptor (FPR) 1 in mouse lung tissue. Representative RT-PCR blot of FPR1 (upper panel) and its densitometric histogram, normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), of each group (lower panel). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) Data are given as mean ± SEM. * P

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Knock-Out

Angiogenesis in lung tissues. (A) Representative confocal images of von willbrand factor (vWF; red) with DAPI (blue) (upper panel, original magnification; ×100, scale bar; 100μm) and the light intensity and the vessel number of vWF-positive cells per high power field of each group (lower panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of CD31 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of CD31 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (C) Level of vascular endothelial growth factor (VEGF) in lung tissue (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P
Figure Legend Snippet: Angiogenesis in lung tissues. (A) Representative confocal images of von willbrand factor (vWF; red) with DAPI (blue) (upper panel, original magnification; ×100, scale bar; 100μm) and the light intensity and the vessel number of vWF-positive cells per high power field of each group (lower panel). (n = 8, 8, 6, 8, 6 and 8 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (B) Representative western blots of CD31 and glyceraldehyde-3-phos phosphatedehydrogenase (GAPDH; loading control) and densitometric analysis of CD31 levels normalized to GAPDH (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively) (C) Level of vascular endothelial growth factor (VEGF) in lung tissue (n = 6, 8, 7, 6, 7 and 6 in WT-NC, WT-HC, WT-HM, FPR1 -/- -NC, FPR1 -/- -HC and FPR1 -/- -HM, respectively). WT-NC, wild type mice of normoxia control; WT-HC, wild type mice of hyperoxia control; WT-HM, wild type mice of hyperoxia with MSCs; FPR1 -/- -NC, FPR1 knockout mice of normoxia control; FPR1 -/- -HC, FPR1 knockout mice of hyperoxia control; FPR1 -/- -HM, FPR1 knockout mice of hyperoxia with MSCs. Data are given as mean ± SEM. * P

Techniques Used: Western Blot, Mouse Assay, Knock-Out

49) Product Images from "Effect of daphnoretin on the proliferation and apoptosis of A549 lung cancer cells in vitro"

Article Title: Effect of daphnoretin on the proliferation and apoptosis of A549 lung cancer cells in vitro

Journal: Oncology Letters

doi: 10.3892/ol.2014.2296

Effect of daphnoretin on Bcl-2 family protein expression detected using western blot analysis. A549 cells were treated with daphnoretin (0, 5, 10 and 15 μmol/l) for 24 h. Proteins were then extracted and Bax, Bcl-2 and GAPDH expression were analyzed using western blot analysis. Bcl, B-cell lymphoma; Bax, Bcl-2-associated X protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure Legend Snippet: Effect of daphnoretin on Bcl-2 family protein expression detected using western blot analysis. A549 cells were treated with daphnoretin (0, 5, 10 and 15 μmol/l) for 24 h. Proteins were then extracted and Bax, Bcl-2 and GAPDH expression were analyzed using western blot analysis. Bcl, B-cell lymphoma; Bax, Bcl-2-associated X protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Techniques Used: Expressing, Western Blot

50) Product Images from "Brown Seaweed Fucoidan Inhibits Cancer Progression by Dual Regulation of mir-29c/ADAM12 and miR-17-5p/PTEN Axes in Human Breast Cancer Cells"

Article Title: Brown Seaweed Fucoidan Inhibits Cancer Progression by Dual Regulation of mir-29c/ADAM12 and miR-17-5p/PTEN Axes in Human Breast Cancer Cells

Journal: Journal of Cancer

doi: 10.7150/jca.15703

Fucoidan regulates the miR-29c/ADAM12 and miR-17-5p/PTEN axes to inhibit the epithelial-mesenchymal transition (EMT) and cancer cell survival in MCF-7 and MDA-MB-231 cells. (A) After treatment with fucoidan (0, 50, 100, 200 μg/mL) for 48 h, protein levels of E-cadherin, occludin, N-cadherin, vimentin, ADAM12, TGF-βRII, and were analyzed by Western blotting. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B) Protein levels of PTEN, phosphor- and total-PI3K, and phosphor- and total-AKT were analyzed by Western blotting. GAPDH was used as a loading control.
Figure Legend Snippet: Fucoidan regulates the miR-29c/ADAM12 and miR-17-5p/PTEN axes to inhibit the epithelial-mesenchymal transition (EMT) and cancer cell survival in MCF-7 and MDA-MB-231 cells. (A) After treatment with fucoidan (0, 50, 100, 200 μg/mL) for 48 h, protein levels of E-cadherin, occludin, N-cadherin, vimentin, ADAM12, TGF-βRII, and were analyzed by Western blotting. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B) Protein levels of PTEN, phosphor- and total-PI3K, and phosphor- and total-AKT were analyzed by Western blotting. GAPDH was used as a loading control.

Techniques Used: Multiple Displacement Amplification, Western Blot

51) Product Images from "Effect of inhibition proliferation in human lung adenocarcinoma A549 cells by cytokine-induced killer cells"

Article Title: Effect of inhibition proliferation in human lung adenocarcinoma A549 cells by cytokine-induced killer cells

Journal: Thoracic Cancer

doi: 10.1111/1759-7714.12205

The expression of P27 was upregulated in response to cytokine-induced killer cells by Western blot analysis of A549 cells. Analysis of variance with subsequent multiple comparisons test. Control group: lane 1: treated group; lane 2: 10:1 effector-to-target cell (E/T) ratio; lane 3: 20:1 E/T ratio; lane 4: 30:1 E/T ratio. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: The expression of P27 was upregulated in response to cytokine-induced killer cells by Western blot analysis of A549 cells. Analysis of variance with subsequent multiple comparisons test. Control group: lane 1: treated group; lane 2: 10:1 effector-to-target cell (E/T) ratio; lane 3: 20:1 E/T ratio; lane 4: 30:1 E/T ratio. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Expressing, Western Blot

52) Product Images from "Protein phosphatase 2A inhibition enhances radiation sensitivity and reduces tumor growth in chordoma"

Article Title: Protein phosphatase 2A inhibition enhances radiation sensitivity and reduces tumor growth in chordoma

Journal: Neuro-Oncology

doi: 10.1093/neuonc/nox241

LB100 enhances radiation-induced DNA damage. (A) U-CH1 and UM-Chor1 cells were treated with 4 μM LB100 for 3 hours pre- and 24 hours post-radiation (2 Gy). At the end of drug exposure, cells were fixed and then subjected to immunofluorescence staining with 4′,6′-diamidino-2-phenylindole‒blue and fluorescein isothiocyanate‒green foci for γ-H2AX, a marker of DNA double-strand breaks. Representative images show increased γ-H2AX expression in the cells exposed to the combination of LB100 and irradiation. (B) Western blot analysis reveals increased protein level of γ-H2AX with LB100 treatment and combination treatment with LB100 and radiation in U-CH1 and UM-Chor1 cells. (C) Quantification of γ-H2AX volume intensity relative to glyceraldehyde 3-phosphate dehydrogenase volume intensity. (D) DNA backbone intensity and location in live chordoma cells as a function of different treatments. Optical image (top panel). Chemical image (lower panel). Image 1: untreated; image 2: treated with LB100; image 3: irradiated; image 4: irradiated and treated with LB100; image 5: overlay of Raman spectra indicating the peak at 1095 cm −1  corresponding to the DNA backbone. Scale bar = 10 μm. (E) Images obtained by transmission electron microscopy show nuclear fragmentation in cells treated with the combination of LB100 and irradiation.
Figure Legend Snippet: LB100 enhances radiation-induced DNA damage. (A) U-CH1 and UM-Chor1 cells were treated with 4 μM LB100 for 3 hours pre- and 24 hours post-radiation (2 Gy). At the end of drug exposure, cells were fixed and then subjected to immunofluorescence staining with 4′,6′-diamidino-2-phenylindole‒blue and fluorescein isothiocyanate‒green foci for γ-H2AX, a marker of DNA double-strand breaks. Representative images show increased γ-H2AX expression in the cells exposed to the combination of LB100 and irradiation. (B) Western blot analysis reveals increased protein level of γ-H2AX with LB100 treatment and combination treatment with LB100 and radiation in U-CH1 and UM-Chor1 cells. (C) Quantification of γ-H2AX volume intensity relative to glyceraldehyde 3-phosphate dehydrogenase volume intensity. (D) DNA backbone intensity and location in live chordoma cells as a function of different treatments. Optical image (top panel). Chemical image (lower panel). Image 1: untreated; image 2: treated with LB100; image 3: irradiated; image 4: irradiated and treated with LB100; image 5: overlay of Raman spectra indicating the peak at 1095 cm −1 corresponding to the DNA backbone. Scale bar = 10 μm. (E) Images obtained by transmission electron microscopy show nuclear fragmentation in cells treated with the combination of LB100 and irradiation.

Techniques Used: Immunofluorescence, Staining, Marker, Expressing, Irradiation, Western Blot, Transmission Assay, Electron Microscopy

53) Product Images from "Optimization of the method for the culture of melanocyte precursors from hair follicles and their activation by 1,25-dihydroxyvitamin D3"

Article Title: Optimization of the method for the culture of melanocyte precursors from hair follicles and their activation by 1,25-dihydroxyvitamin D3

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2013.1252

Expression levels of microphthalmia-associated transcription factor (MITF), tyrosinase (TYR) and TYR-related protein-1 (TRP-1) in melanocytes (MCs) are significantly higher than those in melanocyte precursors (MPs), while the level of TRP-2 is similar in these two cell types. Following treatment with 1,25-dihydroxyvitamin D3 (VID), the expression levels of MITF, TYR and TRP-1 are significantly increased in the MPs; however, they remain lower than those in the MCs. The expression of TRP-2 is not changed significantly with VID treatment. GADPH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Expression levels of microphthalmia-associated transcription factor (MITF), tyrosinase (TYR) and TYR-related protein-1 (TRP-1) in melanocytes (MCs) are significantly higher than those in melanocyte precursors (MPs), while the level of TRP-2 is similar in these two cell types. Following treatment with 1,25-dihydroxyvitamin D3 (VID), the expression levels of MITF, TYR and TRP-1 are significantly increased in the MPs; however, they remain lower than those in the MCs. The expression of TRP-2 is not changed significantly with VID treatment. GADPH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Expressing

54) Product Images from "Centrality of bone marrow in the severity of gadolinium-based contrast-induced systemic fibrosis"

Article Title: Centrality of bone marrow in the severity of gadolinium-based contrast-induced systemic fibrosis

Journal: The FASEB Journal

doi: 10.1096/fj.201500188R

Augmentation of dermal CCRs by contrast-exposed bone marrow.  A ) CCR2 and CCR7 were assessed by immunoblot. Accompanying bar plots show the pixel densities of protein expressions (normalized to glyceraldehyde 3-phosphate dehydrogenase [GAPDH]) relative
Figure Legend Snippet: Augmentation of dermal CCRs by contrast-exposed bone marrow. A ) CCR2 and CCR7 were assessed by immunoblot. Accompanying bar plots show the pixel densities of protein expressions (normalized to glyceraldehyde 3-phosphate dehydrogenase [GAPDH]) relative

Techniques Used:

MRI contrast had no effect on liver.  A ) Liver histology.  B ) Liver fibronectin, CCR2, and CCR7. Immunoblot.  C ) Bone marrow–derived cellularity, CCR2, and CCR7 in the liver. Immunofluoresence. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H  E,
Figure Legend Snippet: MRI contrast had no effect on liver. A ) Liver histology. B ) Liver fibronectin, CCR2, and CCR7. Immunoblot. C ) Bone marrow–derived cellularity, CCR2, and CCR7 in the liver. Immunofluoresence. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H E,

Techniques Used: Magnetic Resonance Imaging, Derivative Assay

55) Product Images from "Recombinant adenovirus containing hyper-interleukin-6 and hepatocyte growth factor ameliorates acute-on-chronic liver failure in rats"

Article Title: Recombinant adenovirus containing hyper-interleukin-6 and hepatocyte growth factor ameliorates acute-on-chronic liver failure in rats

Journal: World Journal of Gastroenterology

doi: 10.3748/wjg.v22.i16.4136

Protein levels of Bcl-2, Bax, Caspase-3 and HMGB1 detected by Western blot, revealing the relative protein expression of Bcl-2, Bax, Caspase-3 and HMGB1, and the ratio of Bcl-2/Bax of all treated livers. A: Bcl-2 protein; B: Bax protein; C: the ratio of Bcl-2/Bax; D: Caspase-3 protein; E: HMGB1 protein. A, B, D, E: The Y axis represents the relative protein expression of Bcl-2, Bax Caspase-3 and HMGB1 compared to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for all types of treated liver; C: The Y axis represents the ratio of the relative protein expression of Bcl-2/Bax for all types of treated liver. a P
Figure Legend Snippet: Protein levels of Bcl-2, Bax, Caspase-3 and HMGB1 detected by Western blot, revealing the relative protein expression of Bcl-2, Bax, Caspase-3 and HMGB1, and the ratio of Bcl-2/Bax of all treated livers. A: Bcl-2 protein; B: Bax protein; C: the ratio of Bcl-2/Bax; D: Caspase-3 protein; E: HMGB1 protein. A, B, D, E: The Y axis represents the relative protein expression of Bcl-2, Bax Caspase-3 and HMGB1 compared to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for all types of treated liver; C: The Y axis represents the ratio of the relative protein expression of Bcl-2/Bax for all types of treated liver. a P

Techniques Used: Western Blot, Expressing

56) Product Images from "EGF Receptor Inhibition Alleviates Hyperuricemic Nephropathy"

Article Title: EGF Receptor Inhibition Alleviates Hyperuricemic Nephropathy

Journal: Journal of the American Society of Nephrology : JASN

doi: 10.1681/ASN.2014080793

Pharmacologic blockade of EGFR activity suppresses TGF- β  signaling in the kidney of hyperuricemic rats. (A) Protein was extracted from the kidneys of rats after feeding of the mixture of adenine and potassium oxonate with or without gefitinib treatment and subjected to ELISA as described in the Concise Methods section. Protein expression level of TGF -β 1 was indicated. (B) The kidneys were taken for immunoblot analysis of p-Smad3, Smad3, or glyceraldehyde 3-phosphate dehydrogenase. (C) Expression levels of p-Smad3 and Smad3 were calculated by densitometry and the ratio between p-Smad3 and Smad3 was determined. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Pharmacologic blockade of EGFR activity suppresses TGF- β signaling in the kidney of hyperuricemic rats. (A) Protein was extracted from the kidneys of rats after feeding of the mixture of adenine and potassium oxonate with or without gefitinib treatment and subjected to ELISA as described in the Concise Methods section. Protein expression level of TGF -β 1 was indicated. (B) The kidneys were taken for immunoblot analysis of p-Smad3, Smad3, or glyceraldehyde 3-phosphate dehydrogenase. (C) Expression levels of p-Smad3 and Smad3 were calculated by densitometry and the ratio between p-Smad3 and Smad3 was determined. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P

Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Expressing

Gefitinib inhibits renal expression level of fibronectin and collagen 1 in hyperuricemic rats. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against fibronectin, collagen 1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of fibronectin was quantified by densitometry and normalized with GAPDH. (C) Expression level of collagen 1 was quantified by densitometry and normalized with GAPDH. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Gefitinib inhibits renal expression level of fibronectin and collagen 1 in hyperuricemic rats. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against fibronectin, collagen 1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of fibronectin was quantified by densitometry and normalized with GAPDH. (C) Expression level of collagen 1 was quantified by densitometry and normalized with GAPDH. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P

Techniques Used: Expressing

Gefitinib treatment inhibits uric acid–induced activation of cultured renal interstitial fibroblasts. Cultured NRK-49F cells were starved for 24 hours and then exposed to 800  μ M uric acid for 36 hours in the absence or presence of gefitinib (0–10 nM). Cell lysates were subjected to immunoblot analysis using antibodies to  α- SMA, collagen 1, p-EGFR, EGFR, p-Smad3, Smad3, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (A) Representative immunoblots from three experiments. Expression levels of all these proteins were quantified by densitometry and expressed as means±SEM.  α- SMA (B) and collagen 1 (C) were normalized with GADPH. The ratios of p-EGFR/EGFR (D) and p-Smad3/Smad3 (E) are shown. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Gefitinib treatment inhibits uric acid–induced activation of cultured renal interstitial fibroblasts. Cultured NRK-49F cells were starved for 24 hours and then exposed to 800 μ M uric acid for 36 hours in the absence or presence of gefitinib (0–10 nM). Cell lysates were subjected to immunoblot analysis using antibodies to α- SMA, collagen 1, p-EGFR, EGFR, p-Smad3, Smad3, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (A) Representative immunoblots from three experiments. Expression levels of all these proteins were quantified by densitometry and expressed as means±SEM. α- SMA (B) and collagen 1 (C) were normalized with GADPH. The ratios of p-EGFR/EGFR (D) and p-Smad3/Smad3 (E) are shown. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P

Techniques Used: Activation Assay, Cell Culture, Western Blot, Expressing

Inhibition of EGFR decreases expression of Lcn2 in the kidney of hyperuricemic rats. (A) Photomicrographs illustrating Lcn2 immunochemistry staining of kidney tissue collected at day 21 after feeding of the mixture of adenine and potassium oxonate with or without gefitinib. (B) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against Lcn2 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (C) Expression level of Lcn2 was quantified by densitometry and normalized with GAPDH. Data are represented as the mean±SEM ( n =6). Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Inhibition of EGFR decreases expression of Lcn2 in the kidney of hyperuricemic rats. (A) Photomicrographs illustrating Lcn2 immunochemistry staining of kidney tissue collected at day 21 after feeding of the mixture of adenine and potassium oxonate with or without gefitinib. (B) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against Lcn2 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (C) Expression level of Lcn2 was quantified by densitometry and normalized with GAPDH. Data are represented as the mean±SEM ( n =6). Means with different superscript letters are significantly different from one another ( P

Techniques Used: Inhibition, Expressing, Staining

Gefitinib inhibits EGFR activation in the kidney of HN rats. (A) Rat model of HN was established by oral administration of a mixture of adenine and potassium oxonate daily. In some rats, gefitinib were simultaneously administrated intraperitoneally. After 3 weeks, the kidneys were taken for immunoblot analysis of p-EGFR, EGFR, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression levels of p-EGFR and EGFR were calculated by densitometry, and the ratio between p-EGFR and total EGFR was determined. (C) Total EGFR levels were normalized with GAPDH. Data are represented as the mean±SEM ( n =6). Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Gefitinib inhibits EGFR activation in the kidney of HN rats. (A) Rat model of HN was established by oral administration of a mixture of adenine and potassium oxonate daily. In some rats, gefitinib were simultaneously administrated intraperitoneally. After 3 weeks, the kidneys were taken for immunoblot analysis of p-EGFR, EGFR, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression levels of p-EGFR and EGFR were calculated by densitometry, and the ratio between p-EGFR and total EGFR was determined. (C) Total EGFR levels were normalized with GAPDH. Data are represented as the mean±SEM ( n =6). Means with different superscript letters are significantly different from one another ( P

Techniques Used: Activation Assay, Expressing

Gefitinib administration preserves the expression of two key urate transporters. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against OAT1, OAT3, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of OAT1was quantified by densitometry and normalized with GAPDH. (C) Expression level of OAT3 was quantified by densitometry and normalized with GAPDH. (D) Excretion level of urine uric acid was examined by using automatic biochemistry assay. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Gefitinib administration preserves the expression of two key urate transporters. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against OAT1, OAT3, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of OAT1was quantified by densitometry and normalized with GAPDH. (C) Expression level of OAT3 was quantified by densitometry and normalized with GAPDH. (D) Excretion level of urine uric acid was examined by using automatic biochemistry assay. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P

Techniques Used: Expressing

Inhibition of EGFR blocks expression of  α -SMA in the kidney of hyperuricemic rats. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against  α -SMA and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of  α- SMA was quantified by densitometry and normalized with GAPDH. (C) Photomicrographs (original magnification, ×200) illustrate immunochemistry  α- SMA staining of the kidney tissues. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P
Figure Legend Snippet: Inhibition of EGFR blocks expression of α -SMA in the kidney of hyperuricemic rats. (A) The kidney tissue lysates were subjected to immunoblot analysis with specific antibodies against α -SMA and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B) Expression level of α- SMA was quantified by densitometry and normalized with GAPDH. (C) Photomicrographs (original magnification, ×200) illustrate immunochemistry α- SMA staining of the kidney tissues. Data are represented as the mean±SEM. Means with different superscript letters are significantly different from one another ( P

Techniques Used: Inhibition, Expressing, Staining

57) Product Images from "A Novel Type 2 Diabetes Mouse Model of Combined Diabetic Kidney Disease and Atherosclerosis"

Article Title: A Novel Type 2 Diabetes Mouse Model of Combined Diabetic Kidney Disease and Atherosclerosis

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2017.10.012

Inducible degrader of the low-density lipoprotein (LDL) receptor (IDOL) overexpression results in elevated cholesterol levels. Human degradation–resistant IDOL was expressed using a liver-specific adenoassociated virus (AAV) serotype DJ/8 [or enhanced green fluorescent protein (eGFP)-AAV-DJ/8 as a control) in 5-week–old male black and tan, brachyury (BTBR) wild-type (WT) and BTBR leptin-deficient (OB) mice. The mice were then fed a high-fat diet for 18 weeks. A: Body weight throughout the study. B: Blood glucose. C: Blood cholesterol. D: Plasma triglycerides (TG). E: Liver MYLIP mRNA using primers that detect both mouse and human MYLIP (gene encoding IDOL). F: Liver LDL receptor levels determined by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase. G: Cholesterol lipoprotein profiles. H: Quantification of cholesterol in each lipoprotein based on G . Data are expressed as means ± SEM. n = 9 to 15 ( A–D , H ); n = 5 to 9 ( E ); n = 4 to 7 ( F ); n = 3 to 4 ( G ). ∗ P
Figure Legend Snippet: Inducible degrader of the low-density lipoprotein (LDL) receptor (IDOL) overexpression results in elevated cholesterol levels. Human degradation–resistant IDOL was expressed using a liver-specific adenoassociated virus (AAV) serotype DJ/8 [or enhanced green fluorescent protein (eGFP)-AAV-DJ/8 as a control) in 5-week–old male black and tan, brachyury (BTBR) wild-type (WT) and BTBR leptin-deficient (OB) mice. The mice were then fed a high-fat diet for 18 weeks. A: Body weight throughout the study. B: Blood glucose. C: Blood cholesterol. D: Plasma triglycerides (TG). E: Liver MYLIP mRNA using primers that detect both mouse and human MYLIP (gene encoding IDOL). F: Liver LDL receptor levels determined by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase. G: Cholesterol lipoprotein profiles. H: Quantification of cholesterol in each lipoprotein based on G . Data are expressed as means ± SEM. n = 9 to 15 ( A–D , H ); n = 5 to 9 ( E ); n = 4 to 7 ( F ); n = 3 to 4 ( G ). ∗ P

Techniques Used: Over Expression, Mouse Assay, Western Blot

58) Product Images from "Host Enzymes Heparanase and Cathepsin L Promote Herpes Simplex Virus 2 Release from Cells"

Article Title: Host Enzymes Heparanase and Cathepsin L Promote Herpes Simplex Virus 2 Release from Cells

Journal: Journal of Virology

doi: 10.1128/JVI.01179-18

HPSE is upregulated after HSV-2 infection. (A) Increase in promoter activity of HPSE gene upon infection in HCE cells. HSV-2 333 was used to infect cells at an MOI of 1 for 12, 24, 36, and 48 h. Shown is the average fold increase over the uninfected control. Experimental values are normalized to those obtained with pGL3 as a control for transfection efficiency. (B) Increase in HPSE mRNA levels. Shown is the average fold increase over that at 0 h postinfection. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (C) Representative immunofluorescence microscopy images of cell surface HPSE stain. HSV-2 333 was used to infect cells at an MOI of 1 for 24 h. The upper left shows HPSE stain only in an uninfected sample, the upper right shows Hoechst and HPSE stains merged for an uninfected sample, the lower left shows HPSE stain only for an infected sample at 24 hpi, and the lower right shows Hoechst and HPSE stains merged for an infected sample at 24 hpi. (D) Quantification of HPSE cell surface expression from multiple immunofluorescent images. (E) Representative flow cytometry histogram showing change in cell surface HPSE expression, with red representing infected samples and black representing the uninfected control. (F) Quantification of cell surface HPSE flow cytometry experiments compared to that at 0 h postinfection.
Figure Legend Snippet: HPSE is upregulated after HSV-2 infection. (A) Increase in promoter activity of HPSE gene upon infection in HCE cells. HSV-2 333 was used to infect cells at an MOI of 1 for 12, 24, 36, and 48 h. Shown is the average fold increase over the uninfected control. Experimental values are normalized to those obtained with pGL3 as a control for transfection efficiency. (B) Increase in HPSE mRNA levels. Shown is the average fold increase over that at 0 h postinfection. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (C) Representative immunofluorescence microscopy images of cell surface HPSE stain. HSV-2 333 was used to infect cells at an MOI of 1 for 24 h. The upper left shows HPSE stain only in an uninfected sample, the upper right shows Hoechst and HPSE stains merged for an uninfected sample, the lower left shows HPSE stain only for an infected sample at 24 hpi, and the lower right shows Hoechst and HPSE stains merged for an infected sample at 24 hpi. (D) Quantification of HPSE cell surface expression from multiple immunofluorescent images. (E) Representative flow cytometry histogram showing change in cell surface HPSE expression, with red representing infected samples and black representing the uninfected control. (F) Quantification of cell surface HPSE flow cytometry experiments compared to that at 0 h postinfection.

Techniques Used: Infection, Activity Assay, Transfection, Immunofluorescence, Microscopy, Staining, Expressing, Flow Cytometry, Cytometry

59) Product Images from "Neuronal-Specific Overexpression of a Mutant Valosin-Containing Protein Associated with IBMPFD Promotes Aberrant Ubiquitin and TDP-43 Accumulation and Cognitive Dysfunction in Transgenic Mice"

Article Title: Neuronal-Specific Overexpression of a Mutant Valosin-Containing Protein Associated with IBMPFD Promotes Aberrant Ubiquitin and TDP-43 Accumulation and Cognitive Dysfunction in Transgenic Mice

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2013.04.014

A high-molecular-weight TDP-43 isoform accumulates in the cytoplasm of Thy-VCP A232E mice. A : Immunoblot analysis revealed a TDP-43 band of approximately 90 kDa only on mutant VCP mice at 6 and 12 months of age. Glyceraldehyde-3-phosphate dehydrogenase
Figure Legend Snippet: A high-molecular-weight TDP-43 isoform accumulates in the cytoplasm of Thy-VCP A232E mice. A : Immunoblot analysis revealed a TDP-43 band of approximately 90 kDa only on mutant VCP mice at 6 and 12 months of age. Glyceraldehyde-3-phosphate dehydrogenase

Techniques Used: Molecular Weight, Mouse Assay, Mutagenesis

60) Product Images from "Nicotinamide Phosphoribosyltransferase Deficiency Potentiates the Antiproliferative Activity of Methotrexate through Enhanced Depletion of Intracellular ATP"

Article Title: Nicotinamide Phosphoribosyltransferase Deficiency Potentiates the Antiproliferative Activity of Methotrexate through Enhanced Depletion of Intracellular ATP

Journal: The Journal of Pharmacology and Experimental Therapeutics

doi: 10.1124/jpet.117.246199

MTX does not cause synergistic depletion of cellular NAD in NAMPT-deficient cells. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT; 24 hours after transfection, cells were treated with 1000 nM MTX for 96 hours or 50 mM etoposide for 24 hours to determine activation of PARP by measuring PAR formation by Western blot analysis. (B) Control and NAMPT-deficient cells were treated with different concentrations of MTX for 96 hours and total DNA was separated on 1% agarose gel to evaluate DNA damage. (C) Total NAD levels were monitored in control and NAMPT-deficient cells treated with different concentrations of MTX for 96 hours. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; NS, not significant; PAR, poly(ADP-ribose); Scr, scrambled.
Figure Legend Snippet: MTX does not cause synergistic depletion of cellular NAD in NAMPT-deficient cells. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT; 24 hours after transfection, cells were treated with 1000 nM MTX for 96 hours or 50 mM etoposide for 24 hours to determine activation of PARP by measuring PAR formation by Western blot analysis. (B) Control and NAMPT-deficient cells were treated with different concentrations of MTX for 96 hours and total DNA was separated on 1% agarose gel to evaluate DNA damage. (C) Total NAD levels were monitored in control and NAMPT-deficient cells treated with different concentrations of MTX for 96 hours. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; NS, not significant; PAR, poly(ADP-ribose); Scr, scrambled.

Techniques Used: Transfection, Activation Assay, Western Blot, Agarose Gel Electrophoresis, Molecular Weight

MTX activity in NAMPT-deficient cells is folate dependent. A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT. Twenty-four hours after transfection, cells were treated with different concentrations of MTX alone or in combination with 10 μ M folinic acid for 96 hours. (A–C) Knockdown of NAMPT by siRNA was confirmed by Western blot analysis (A), quantified by densitometry analysis (B), and verified by real-time-PCR (C). Cell viability was measured by fluorescence spectroscopy using the resazurin reduction assay. (D) The effect of MTX toxicity alone or in combination with 10 μ M folinic acid was determined as percent viability based on untreated control cells. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented. Concentrations of MTX required for half-maximal inhibition of 50% inhibition of cell viability were determined and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; Scr, scrambled.
Figure Legend Snippet: MTX activity in NAMPT-deficient cells is folate dependent. A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT. Twenty-four hours after transfection, cells were treated with different concentrations of MTX alone or in combination with 10 μ M folinic acid for 96 hours. (A–C) Knockdown of NAMPT by siRNA was confirmed by Western blot analysis (A), quantified by densitometry analysis (B), and verified by real-time-PCR (C). Cell viability was measured by fluorescence spectroscopy using the resazurin reduction assay. (D) The effect of MTX toxicity alone or in combination with 10 μ M folinic acid was determined as percent viability based on untreated control cells. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented. Concentrations of MTX required for half-maximal inhibition of 50% inhibition of cell viability were determined and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; Scr, scrambled.

Techniques Used: Activity Assay, Transfection, Western Blot, Real-time Polymerase Chain Reaction, Fluorescence, Spectroscopy, Inhibition, Molecular Weight

Inhibition of NAMPT does not affect DHFR expression or intracellular levels of folate or MTX. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT and protein levels of DHFR were monitored 96 hours after transfection. (B) For densitometry analysis, DHFR protein levels were normalized to GAPDH. (C and D) Cellular concentrations of folate (C) and MTX levels (D) were analyzed in control and NAMPT-deficient cells treated for 24 hours with 1000 nM MTX. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant; Scr, scrambled.
Figure Legend Snippet: Inhibition of NAMPT does not affect DHFR expression or intracellular levels of folate or MTX. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT and protein levels of DHFR were monitored 96 hours after transfection. (B) For densitometry analysis, DHFR protein levels were normalized to GAPDH. (C and D) Cellular concentrations of folate (C) and MTX levels (D) were analyzed in control and NAMPT-deficient cells treated for 24 hours with 1000 nM MTX. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant; Scr, scrambled.

Techniques Used: Inhibition, Expressing, Transfection

61) Product Images from "Interleukin-2 is upregulated in patients with a prolapsed lumbar intervertebral disc and modulates cell proliferation, apoptosis and extracellular matrix metabolism of human nucleus pulposus cells"

Article Title: Interleukin-2 is upregulated in patients with a prolapsed lumbar intervertebral disc and modulates cell proliferation, apoptosis and extracellular matrix metabolism of human nucleus pulposus cells

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2015.2809

Protein expression levels of Fas cell surface death receptor (Fas) in human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P
Figure Legend Snippet: Protein expression levels of Fas cell surface death receptor (Fas) in human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P

Techniques Used: Expressing, Standard Deviation

Protein expression levels of p38 and phophorylated (pho)-p38 in human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P
Figure Legend Snippet: Protein expression levels of p38 and phophorylated (pho)-p38 in human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P

Techniques Used: Expressing, Standard Deviation

Protein expression levels of aggrecan, and type I and II collagen in the human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P
Figure Legend Snippet: Protein expression levels of aggrecan, and type I and II collagen in the human nucleus pulposus cells following treatment with interleukin (IL)-2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Data are presented as the mean ± standard deviation. *P

Techniques Used: Expressing, Standard Deviation

62) Product Images from "Programmed Death 1 and Cytokine Inducible SH2-Containing Protein Dependent Expansion of Regulatory T Cells Upon Stimulation With Mycobacterium tuberculosis"

Article Title: Programmed Death 1 and Cytokine Inducible SH2-Containing Protein Dependent Expansion of Regulatory T Cells Upon Stimulation With Mycobacterium tuberculosis

Journal: The Journal of Infectious Diseases

doi: 10.1093/infdis/jir011

Up-regulation of cytokine inducible SH2-containing protein (CISH) expression on  Mycobacterium tuberculosis  (M. tb) – expanded regulatory T cells (Tregs).  A,  CD4 + CD25 −  cells from peripheral blood mononuclear cells of healthy tuberculin reactors were cultured with autologous monocytes in medium alone or with γ-irradiated  M. tuberculosis  (10 μg/mL). After 4 d, CD4 + CD25 +  (Tregs) and CD4 + CD25 −  (Treg-depleted) cells were isolated and whole-cell lysates were prepared. Lysates were subjected to Western blot analysis with an antibody to CISH ( upper panel ). The blot was stripped and reprobed with an antibody to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ( lower panel ). The result is representative of experiments performed on samples from 3 donors.  Lane 1,  Unstimulated cells;  lane 2, M. tuberculosis– expanded Tregs;  lane 3, M. tuberculosis– expanded Treg-depleted cells.  B,  CISH expression quantified by densitometry. Cells from 3 donors were prepared, and Western blot analysis was performed as detailed for panel  A . Mean values and SEs are shown.
Figure Legend Snippet: Up-regulation of cytokine inducible SH2-containing protein (CISH) expression on Mycobacterium tuberculosis (M. tb) – expanded regulatory T cells (Tregs). A, CD4 + CD25 − cells from peripheral blood mononuclear cells of healthy tuberculin reactors were cultured with autologous monocytes in medium alone or with γ-irradiated M. tuberculosis (10 μg/mL). After 4 d, CD4 + CD25 + (Tregs) and CD4 + CD25 − (Treg-depleted) cells were isolated and whole-cell lysates were prepared. Lysates were subjected to Western blot analysis with an antibody to CISH ( upper panel ). The blot was stripped and reprobed with an antibody to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ( lower panel ). The result is representative of experiments performed on samples from 3 donors. Lane 1, Unstimulated cells; lane 2, M. tuberculosis– expanded Tregs; lane 3, M. tuberculosis– expanded Treg-depleted cells. B, CISH expression quantified by densitometry. Cells from 3 donors were prepared, and Western blot analysis was performed as detailed for panel A . Mean values and SEs are shown.

Techniques Used: Chromogenic In Situ Hybridization, Expressing, Cell Culture, Irradiation, Isolation, Western Blot

63) Product Images from "Nicotinamide Phosphoribosyltransferase Deficiency Potentiates the Antiproliferative Activity of Methotrexate through Enhanced Depletion of Intracellular ATP"

Article Title: Nicotinamide Phosphoribosyltransferase Deficiency Potentiates the Antiproliferative Activity of Methotrexate through Enhanced Depletion of Intracellular ATP

Journal: The Journal of Pharmacology and Experimental Therapeutics

doi: 10.1124/jpet.117.246199

MTX does not cause synergistic depletion of cellular NAD in NAMPT-deficient cells. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT; 24 hours after transfection, cells were treated with 1000 nM MTX for 96 hours or 50 mM etoposide for 24 hours to determine activation of PARP by measuring PAR formation by Western blot analysis. (B) Control and NAMPT-deficient cells were treated with different concentrations of MTX for 96 hours and total DNA was separated on 1% agarose gel to evaluate DNA damage. (C) Total NAD levels were monitored in control and NAMPT-deficient cells treated with different concentrations of MTX for 96 hours. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; NS, not significant; PAR, poly(ADP-ribose); Scr, scrambled.
Figure Legend Snippet: MTX does not cause synergistic depletion of cellular NAD in NAMPT-deficient cells. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT; 24 hours after transfection, cells were treated with 1000 nM MTX for 96 hours or 50 mM etoposide for 24 hours to determine activation of PARP by measuring PAR formation by Western blot analysis. (B) Control and NAMPT-deficient cells were treated with different concentrations of MTX for 96 hours and total DNA was separated on 1% agarose gel to evaluate DNA damage. (C) Total NAD levels were monitored in control and NAMPT-deficient cells treated with different concentrations of MTX for 96 hours. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; NS, not significant; PAR, poly(ADP-ribose); Scr, scrambled.

Techniques Used: Transfection, Activation Assay, Western Blot, Agarose Gel Electrophoresis, Molecular Weight

MTX activity in NAMPT-deficient cells is folate dependent. A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT. Twenty-four hours after transfection, cells were treated with different concentrations of MTX alone or in combination with 10 μ M folinic acid for 96 hours. (A–C) Knockdown of NAMPT by siRNA was confirmed by Western blot analysis (A), quantified by densitometry analysis (B), and verified by real-time-PCR (C). Cell viability was measured by fluorescence spectroscopy using the resazurin reduction assay. (D) The effect of MTX toxicity alone or in combination with 10 μ M folinic acid was determined as percent viability based on untreated control cells. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented. Concentrations of MTX required for half-maximal inhibition of 50% inhibition of cell viability were determined and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; Scr, scrambled.
Figure Legend Snippet: MTX activity in NAMPT-deficient cells is folate dependent. A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT. Twenty-four hours after transfection, cells were treated with different concentrations of MTX alone or in combination with 10 μ M folinic acid for 96 hours. (A–C) Knockdown of NAMPT by siRNA was confirmed by Western blot analysis (A), quantified by densitometry analysis (B), and verified by real-time-PCR (C). Cell viability was measured by fluorescence spectroscopy using the resazurin reduction assay. (D) The effect of MTX toxicity alone or in combination with 10 μ M folinic acid was determined as percent viability based on untreated control cells. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented. Concentrations of MTX required for half-maximal inhibition of 50% inhibition of cell viability were determined and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MW, molecular weight; Scr, scrambled.

Techniques Used: Activity Assay, Transfection, Western Blot, Real-time Polymerase Chain Reaction, Fluorescence, Spectroscopy, Inhibition, Molecular Weight

Inhibition of NAMPT does not affect DHFR expression or intracellular levels of folate or MTX. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT and protein levels of DHFR were monitored 96 hours after transfection. (B) For densitometry analysis, DHFR protein levels were normalized to GAPDH. (C and D) Cellular concentrations of folate (C) and MTX levels (D) were analyzed in control and NAMPT-deficient cells treated for 24 hours with 1000 nM MTX. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant; Scr, scrambled.
Figure Legend Snippet: Inhibition of NAMPT does not affect DHFR expression or intracellular levels of folate or MTX. (A) A549 cells were transfected with either control scrambled siRNA or with siRNA directed toward NAMPT and protein levels of DHFR were monitored 96 hours after transfection. (B) For densitometry analysis, DHFR protein levels were normalized to GAPDH. (C and D) Cellular concentrations of folate (C) and MTX levels (D) were analyzed in control and NAMPT-deficient cells treated for 24 hours with 1000 nM MTX. Experiments were conducted in triplicate and the resulting mean ± S.D. for each experiment is presented and compared by t test analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant; Scr, scrambled.

Techniques Used: Inhibition, Expressing, Transfection

64) Product Images from ""

Article Title:

Journal: The Journal of Pharmacology and Experimental Therapeutics

doi: 10.1124/jpet.115.224386

SRT1720 enhances phosphorylation of EGFR and PDGFR β in cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and then incubated with different concentrations of SRT1720 (0–2 μ M) for 36 hours (A–C). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-EGFR (Tyr1068), EGFR, phospho-PDGFR β (Tyr751), PDGFR β , or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A). Representative immunoblots from three experiments are shown. The phospho-EGFR, phospho-PDGFR β , EGFR, PDGFR β , and GAPDH were quantified by densitometry. (B) The phosphorylated EGFR and PDGFR β were normalized to total protein levels. (C) The levels of EGFR and PDGFR β were normalized with GAPDH. Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a and b) are significantly different from one another ( P
Figure Legend Snippet: SRT1720 enhances phosphorylation of EGFR and PDGFR β in cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and then incubated with different concentrations of SRT1720 (0–2 μ M) for 36 hours (A–C). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-EGFR (Tyr1068), EGFR, phospho-PDGFR β (Tyr751), PDGFR β , or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A). Representative immunoblots from three experiments are shown. The phospho-EGFR, phospho-PDGFR β , EGFR, PDGFR β , and GAPDH were quantified by densitometry. (B) The phosphorylated EGFR and PDGFR β were normalized to total protein levels. (C) The levels of EGFR and PDGFR β were normalized with GAPDH. Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a and b) are significantly different from one another ( P

Techniques Used: Cell Culture, Incubation, Western Blot

SRT1720 treatment enhances activation of cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and incubated with different concentrations of SRT1720 (0–2 μ M) for 36 hours. Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies against α -SMA, fibronectin, Ac-H3K9, PCNA, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A and E). Representative immunoblots from three independent experiments are shown. The levels of Ac-H3K9, α -SMA, fibronectin, and PCNA were quantified by densitometry and normalized with GAPDH (B–D and F). NRK-49F cells were treated with the indicated concentration of SRT1720 for 36 hours and cells were randomly photographed in bright field (200×). Cell proliferation was measured by cell counting (G), or the MTT assay (H). Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a–d) are significantly different from one another ( P
Figure Legend Snippet: SRT1720 treatment enhances activation of cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and incubated with different concentrations of SRT1720 (0–2 μ M) for 36 hours. Then, cell lysates were prepared and subjected to immunoblot analysis with antibodies against α -SMA, fibronectin, Ac-H3K9, PCNA, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A and E). Representative immunoblots from three independent experiments are shown. The levels of Ac-H3K9, α -SMA, fibronectin, and PCNA were quantified by densitometry and normalized with GAPDH (B–D and F). NRK-49F cells were treated with the indicated concentration of SRT1720 for 36 hours and cells were randomly photographed in bright field (200×). Cell proliferation was measured by cell counting (G), or the MTT assay (H). Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a–d) are significantly different from one another ( P

Techniques Used: Activation Assay, Cell Culture, Incubation, Western Blot, Concentration Assay, Cell Counting, MTT Assay

SRT1720 enhances STAT3 phosphorylation in cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and then with different concentrations of SRT1720 (0–2 μ M) for 36 hours (A–D). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-STAT3 (Tyr705), STAT3, phospho-AKT (Ser473), AKT, phospho-ERK1/2, ERK1/2, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A). Representative immunoblots from three experiments are shown. The phosphorylated and total proteins were quantified by densitometry and phosphorylated protein levels were normalized to their corresponding total protein level. The levels of total STAT3, AKT, and ERK1/2 were normalized with GAPDH (B–D). Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a and b) are significantly different from one another ( P
Figure Legend Snippet: SRT1720 enhances STAT3 phosphorylation in cultured renal interstitial fibroblasts. NRK-49F cells were cultured in 2.5% fetal bovine serum containing medium and then with different concentrations of SRT1720 (0–2 μ M) for 36 hours (A–D). Cell lysates were prepared and subjected to immunoblot analysis with antibodies for phospho-STAT3 (Tyr705), STAT3, phospho-AKT (Ser473), AKT, phospho-ERK1/2, ERK1/2, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A). Representative immunoblots from three experiments are shown. The phosphorylated and total proteins were quantified by densitometry and phosphorylated protein levels were normalized to their corresponding total protein level. The levels of total STAT3, AKT, and ERK1/2 were normalized with GAPDH (B–D). Values are mean ± S.D. of three independent experiments. Bars with different lowercase letters (a and b) are significantly different from one another ( P

Techniques Used: Cell Culture, Western Blot

65) Product Images from "A novel mouse model carrying a human cytoplasmic dynein mutation shows motor behavior deficits consistent with Charcot-Marie-Tooth type 2O disease"

Article Title: A novel mouse model carrying a human cytoplasmic dynein mutation shows motor behavior deficits consistent with Charcot-Marie-Tooth type 2O disease

Journal: Scientific Reports

doi: 10.1038/s41598-018-20081-1

Dynein complex protein levels in wild type and H304R/+ brain tissue. Western blots of brain tissue high speed supernatant from wild-type (lanes 1 and 3) and H304R/+ (lanes 2 and 4) mice were probed for the dynein intermediate chain (lanes 1 and 2) or glyceraldehyde-3-phosphate dehydrogenase (lanes 3 and 4, loading control). The data were statistically compared between wild-type and H304R/+ using the Students t- test (two-tailed distribution, p = 0.23).
Figure Legend Snippet: Dynein complex protein levels in wild type and H304R/+ brain tissue. Western blots of brain tissue high speed supernatant from wild-type (lanes 1 and 3) and H304R/+ (lanes 2 and 4) mice were probed for the dynein intermediate chain (lanes 1 and 2) or glyceraldehyde-3-phosphate dehydrogenase (lanes 3 and 4, loading control). The data were statistically compared between wild-type and H304R/+ using the Students t- test (two-tailed distribution, p = 0.23).

Techniques Used: Western Blot, Mouse Assay, Two Tailed Test

66) Product Images from "Elevated expression of podoplanin and its clinicopathological, prognostic, and therapeutic values in squamous non-small cell lung cancer"

Article Title: Elevated expression of podoplanin and its clinicopathological, prognostic, and therapeutic values in squamous non-small cell lung cancer

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S163510

PDPN expression in A549 and H226 human NSCLC cell lines:  (A) PDPN  mRNA expression in A549 and H226 cell lines from the NCI-60 cell lines study;  (B)  Western blot analyses of PDPN expression in A549 and H226 cell lines. GAPDH was used as an internal reference.  (C, D)  Flow cytometry analyses of A549 and H226 cells to determine PDPN expression on their surface. Cell lines were stained with anti-PDPN-AF488 antibody (open black peaks) or an isotype control antibody (filled gray peaks). Abbreviations:  PDPN, podoplanin; NSCLC, non-small cell lung cancer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: PDPN expression in A549 and H226 human NSCLC cell lines: (A) PDPN mRNA expression in A549 and H226 cell lines from the NCI-60 cell lines study; (B) Western blot analyses of PDPN expression in A549 and H226 cell lines. GAPDH was used as an internal reference. (C, D) Flow cytometry analyses of A549 and H226 cells to determine PDPN expression on their surface. Cell lines were stained with anti-PDPN-AF488 antibody (open black peaks) or an isotype control antibody (filled gray peaks). Abbreviations: PDPN, podoplanin; NSCLC, non-small cell lung cancer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Expressing, Western Blot, Flow Cytometry, Cytometry, Staining

67) Product Images from "Downregulation of α-Melanocyte-Stimulating Hormone-Induced Activation of the Pax3-MITF-Tyrosinase Axis by Sorghum Ethanolic Extract in B16F10 Melanoma Cells"

Article Title: Downregulation of α-Melanocyte-Stimulating Hormone-Induced Activation of the Pax3-MITF-Tyrosinase Axis by Sorghum Ethanolic Extract in B16F10 Melanoma Cells

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19061640

Effect of sorghum ethanolic extract (SEE) on the suppression of alpha-melanocyte-stimulating hormone (α-MSH)-induced tyrosinase (TYR) expression. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–24 h) and cell lysates were subjected to immunoblotting using antibodies against TYR. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. T/G, tyrosinase/GAPDH ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 12 h, cell lysates were prepared, and immunoblotting was performed using antibodies against TYR. The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative TYR intensity was normalized to that of GAPDH and visualized in the blot. T/G, TYR/GAPDH. ( C , D ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 6 h, total RNA was isolated and TYR mRNA was measured by RT-PCR ( C ) and quantitative real-time PCR ( D ). The GAPDH mRNA level was examined as an internal control. ( E ) B16F10 cells were treated with vehicle (DMSO) or SEE (50 μg/mL) in the absence or presence of 100 nM α-MSH. After 12 h, the cells were fixed and incubated with antibodies against TYR for 2 h, followed by incubation with Alexa Fluor 555-conjugated (red signal) secondary antibodies for 30 min. Nuclear DNA was stained with 1 μg/mL Hoechst 33258 for 10 min (blue signal). The dotted box indicates the region of higher magnification in images.
Figure Legend Snippet: Effect of sorghum ethanolic extract (SEE) on the suppression of alpha-melanocyte-stimulating hormone (α-MSH)-induced tyrosinase (TYR) expression. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–24 h) and cell lysates were subjected to immunoblotting using antibodies against TYR. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. T/G, tyrosinase/GAPDH ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 12 h, cell lysates were prepared, and immunoblotting was performed using antibodies against TYR. The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative TYR intensity was normalized to that of GAPDH and visualized in the blot. T/G, TYR/GAPDH. ( C , D ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 and 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 6 h, total RNA was isolated and TYR mRNA was measured by RT-PCR ( C ) and quantitative real-time PCR ( D ). The GAPDH mRNA level was examined as an internal control. ( E ) B16F10 cells were treated with vehicle (DMSO) or SEE (50 μg/mL) in the absence or presence of 100 nM α-MSH. After 12 h, the cells were fixed and incubated with antibodies against TYR for 2 h, followed by incubation with Alexa Fluor 555-conjugated (red signal) secondary antibodies for 30 min. Nuclear DNA was stained with 1 μg/mL Hoechst 33258 for 10 min (blue signal). The dotted box indicates the region of higher magnification in images.

Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Incubation, Staining

Effect of SEE on the inhibition of α-MSH-induced  MITF  promoter activity. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–120 min), and cell lysates were subjected to immunoblotting using an antibody against phospho-cAMP response element-binding protein (CREB) (Ser133). The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 or 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 30 min, cell lysates were subjected to immunoblotting using an antibody against phospho-CREB (Ser133). The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative p-CREB intensity was normalized to that of GAPDH and visualized in the blot. pC/G, p-CREB/GAPDH. ( C ) B16F10 cells were transfected with 0.2 µg of a series of 5′-deletion constructs of the  MITF  gene promoter reporter plasmids. Forty-eight hours later, the cells were treated with either vehicle (DMSO), 100 nM α-MSH, or α-MSH plus 50 μg/mL SEE for 8 h, and the luciferase activities were measured. The data shown represent the mean ± SD ( n  = 3). ****  p
Figure Legend Snippet: Effect of SEE on the inhibition of α-MSH-induced MITF promoter activity. ( A ) B16F10 cells were treated with 100 nM α-MSH for various times (0–120 min), and cell lysates were subjected to immunoblotting using an antibody against phospho-cAMP response element-binding protein (CREB) (Ser133). The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level was examined as an internal control. ( B ) B16F10 cells were treated with either vehicle (DMSO) or SEE (50 or 100 μg/mL) for 30 min, followed by stimulation with 100 nM α-MSH. After 30 min, cell lysates were subjected to immunoblotting using an antibody against phospho-CREB (Ser133). The GAPDH level was examined as an internal control. The intensity of the bands was quantified using ImageJ and the relative p-CREB intensity was normalized to that of GAPDH and visualized in the blot. pC/G, p-CREB/GAPDH. ( C ) B16F10 cells were transfected with 0.2 µg of a series of 5′-deletion constructs of the MITF gene promoter reporter plasmids. Forty-eight hours later, the cells were treated with either vehicle (DMSO), 100 nM α-MSH, or α-MSH plus 50 μg/mL SEE for 8 h, and the luciferase activities were measured. The data shown represent the mean ± SD ( n = 3). **** p

Techniques Used: Inhibition, Activity Assay, Binding Assay, Transfection, Construct, Luciferase

Related Articles

Clone Assay:

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: The p3XFLAG-E6 expression vector was generated by PCR cloning of the HPV16 PCDNA3-E6 cDNAs, followed by HindIII and XbaI double digestion and insertion into the HindIII and XbaI sites of the pA3F vector (Sigma-Aldrich, St. Louis, MO, USA). .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting).

Autoradiography:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Membranes were incubated with horseradish peroxidase–conjugated Donkey anti-goat secondary antibody (1:10,000; Santa Cruz), and bands were visualized using SuperSignal West Pico chemiluminescent detection reagents (Thermo Scientific) and Hyblot-CL Autoradiography Film (Denville, Metuchen, NJ). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Electrophoresis:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: After electrophoresis, protein samples were electroblotted onto nitrocellulose membrane (Amersham, Pittsburgh, PA), washed in Tris-buffered saline, and incubated overnight at 4 °C with goat anti-CTGF antibody (1:1,000; Santa Cruz, Santa Cruz, CA). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Incubation:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. GAPDH was chosen because changes in protein levels have been reported in vivo only after 12 months of hyperglycemia [ ].

Article Title: Human Papillomavirus Types 16 and 18 Early-expressed Proteins Differentially Modulate the Cellular Redox State and DNA Damage
Article Snippet: Equal amounts of protein were loaded and separated in a SDS-PAGE; then, proteins were transferred onto a nitrocellulose membrane and incubated with the proper primary antibody. .. Primary antibodies were prepared in TBS/T buffer as follows: anti-glyceraldehyde 3 phosphate dehydrogenase (GAPDH, 1:1000) (Santa Cruz Biotechnologies), anti-SOD2 (1:1000) (Cell Signalling, Danvers, MA, USA), anti-SOD1 (1:1000) (Cell Signalling), anti-catalase (1:500) (Cell Signalling), anti-γH2AX (1:1000) (Abcam, Cambridge, UK), anti-H2AX (1:1000) (Upstate, Darmstadt, Germany), anti-His (1:1000) (Cell Signalling), anti-HA (1:1000) (Roche), anti-FLAG M2 (1:2000) (Sigma-Aldrich), and anti-HPV18 E2 (1:1000) (Abcam).

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: .. The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control. .. The levels of proteins and phosphoproteins were detected with horseradish peroxidase-linked secondary antibodies and the enhanced chemiluminescence system (GE Healthcare, Milan, Italy).

Expressing:

Article Title: miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *
Article Snippet: .. Antibodies against p65 (Santa Cruz Biotechnology, 1:1000), SMA (Millipore, 1:3000), SM-myosin heavy chain (SMMHC, BTI, 1:2000), glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology, 1:1000), lamin A/C (Santa Cruz Biotechnology, 1:1000), and HDAC4 (Abcam, 1:500) were used for testing individual protein expression. .. Immuno-activity and band density was visualized by the enhanced chemiluminescence detection system (Amersham Biosciences) or Odyssey system (LI-COR Biosciences, Lincoln, NE) according to the manufacturer's instructions.

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: The p3XFLAG-E6 expression vector was generated by PCR cloning of the HPV16 PCDNA3-E6 cDNAs, followed by HindIII and XbaI double digestion and insertion into the HindIII and XbaI sites of the pA3F vector (Sigma-Aldrich, St. Louis, MO, USA). .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting).

Article Title: Genes Proximal and Distal to MYCN Are Highly Expressed in Human Neuroblastoma as Visualized by Comparative Expressed Sequence Hybridization
Article Snippet: MYCN protein expression from whole-cell extracts was assessed by Western blot analysis according to the manufacture’s instructions (LI-COR, Biosciences). .. The primary antibodies used were mouse monoclonal anti-N-MYC (NCM II 100, ab16898, Abcam) and anti-glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz).

Article Title: Stress-induced changes in gene interactions in human cells
Article Snippet: Expression of NDUFA4 was used as a control for normalization, and expression levels were calculated relative to NDUFA4 . .. Protein levels of THAP1 were assessed using rabbit antibody directed against Thap1 (ProteinTech, IL, USA) and normalized to glyceraldehyde 3-phosphate dehydrogenase (sc-137179, Santa Cruz Biotechnology, CA, USA).

BIA-KA:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Protein concentration in cleared lysates was measured using bicinchoninic acid colorimetric assay (BCA kit; Pierce, Rockford, IL). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Modification:

Article Title: A Resveratrol Analogue Promotes ERKMAPK
Article Snippet: These cells were grown in Dulbecco’s modified Eagle’s medium containing 10% heat-inactivated FBS. .. Except for anti– β -actin, glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnology, Inc., Dallas, TX), and cyclin D1 (SPM587) (Novus Biologicals, Littleton, CO), antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA).

Western Blot:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. GAPDH was chosen because changes in protein levels have been reported in vivo only after 12 months of hyperglycemia [ ].

Article Title: Enhanced NF-?B Activity Impairs Vascular Function Through PARP-1-, SP-1-, and COX-2-Dependent Mechanisms in Type 2 Diabetes
Article Snippet: Paragraph title: Western blot analysis. ... Blots were stripped and then reprobed with either β-actin (1:2,000 dilution, Santa Cruz Biotechnology) or glyceraldehyde-3-phosphate dehydrogenase (1:2,000 dilution, Santa Cruz Biotechnology) antibodies to verify the equal loading among the samples.

Article Title: miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *
Article Snippet: Paragraph title: Western Blot Analysis ... Antibodies against p65 (Santa Cruz Biotechnology, 1:1000), SMA (Millipore, 1:3000), SM-myosin heavy chain (SMMHC, BTI, 1:2000), glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology, 1:1000), lamin A/C (Santa Cruz Biotechnology, 1:1000), and HDAC4 (Abcam, 1:500) were used for testing individual protein expression.

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: Paragraph title: SDS-PAGE and Western blot analysis ... The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting). .. Cell culture and transfection The SiHa, CaSki, C33A and HEK293 cell lines, purchased from teh American Type Culture Collection (Manassas, VA, USA) were grown in HyClone Dulbecco's modified Eagle's medium (DMEM; GE Healthcare Life Sciences) supplemented with 10% fetal bovine serum (FBS), 50 U/ml penicillin, 50 µg/ml streptomycin and 2 mM L-glutamine.

Article Title: Genes Proximal and Distal to MYCN Are Highly Expressed in Human Neuroblastoma as Visualized by Comparative Expressed Sequence Hybridization
Article Snippet: Paragraph title: Western Blot Analyses ... The primary antibodies used were mouse monoclonal anti-N-MYC (NCM II 100, ab16898, Abcam) and anti-glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz).

Article Title: Human Papillomavirus Types 16 and 18 Early-expressed Proteins Differentially Modulate the Cellular Redox State and DNA Damage
Article Snippet: Paragraph title: Western blot analysis ... Primary antibodies were prepared in TBS/T buffer as follows: anti-glyceraldehyde 3 phosphate dehydrogenase (GAPDH, 1:1000) (Santa Cruz Biotechnologies), anti-SOD2 (1:1000) (Cell Signalling, Danvers, MA, USA), anti-SOD1 (1:1000) (Cell Signalling), anti-catalase (1:500) (Cell Signalling), anti-γH2AX (1:1000) (Abcam, Cambridge, UK), anti-H2AX (1:1000) (Upstate, Darmstadt, Germany), anti-His (1:1000) (Cell Signalling), anti-HA (1:1000) (Roche), anti-FLAG M2 (1:2000) (Sigma-Aldrich), and anti-HPV18 E2 (1:1000) (Abcam).

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: Paragraph title: Western Blotting Analysis ... The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control.

Article Title: Effect of bone marrow mesenchymal stem cell transplantation on acute hepatic failure in rats
Article Snippet: Paragraph title: Western blot analysis ... The primary antibodies were mouse anti-CD163 (1:200; sc-58965; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), mouse anti-IL-10 (1:250; ab25073; Abcam, Cambridge, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; sc-25778; Santa Cruz Biotechnology).

Real-time Polymerase Chain Reaction:

Article Title: Stress-induced changes in gene interactions in human cells
Article Snippet: Effect of small interfering RNA (siRNA) on gene expression was analyzed by quantitative polymerase chain reaction (PCR; 7900HT Analyzer, Applied Biosystems). .. Protein levels of THAP1 were assessed using rabbit antibody directed against Thap1 (ProteinTech, IL, USA) and normalized to glyceraldehyde 3-phosphate dehydrogenase (sc-137179, Santa Cruz Biotechnology, CA, USA).

Colorimetric Assay:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Protein concentration in cleared lysates was measured using bicinchoninic acid colorimetric assay (BCA kit; Pierce, Rockford, IL). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Protease Inhibitor:

Article Title: miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *
Article Snippet: Whole cell lysate samples were extracted from cells using the mammalian protein extraction reagent M-Per (Promega) supplemented with a protease inhibitor mixture (Roche Applied Science). .. Antibodies against p65 (Santa Cruz Biotechnology, 1:1000), SMA (Millipore, 1:3000), SM-myosin heavy chain (SMMHC, BTI, 1:2000), glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology, 1:1000), lamin A/C (Santa Cruz Biotechnology, 1:1000), and HDAC4 (Abcam, 1:500) were used for testing individual protein expression.

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: Whole-cell lysates were prepared with radioimmunoprecipitation assay buffer (50 mmol/L Tris, 1% NP-40, 0.25% sodium deoxycholate, 150 mmol/L NaCl, 1 mmol/L EDTA) supplemented with 1 mmol/L NaVO4 and 1% protease inhibitor cocktail (Roche) as described previously ( , ). .. The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Generated:

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: The p3XFLAG-E6 expression vector was generated by PCR cloning of the HPV16 PCDNA3-E6 cDNAs, followed by HindIII and XbaI double digestion and insertion into the HindIII and XbaI sites of the pA3F vector (Sigma-Aldrich, St. Louis, MO, USA). .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting).

other:

Article Title: Gelidium elegans Extract Ameliorates Type 2 Diabetes via Regulation of MAPK and PI3K/Akt Signaling
Article Snippet: Antibodies targeting GLUT4 (sc-7938), phospho-IRS-1 (sc-17196), IRS-1 (sc-559), phospho-PI3K p85α (sc-12929), phospho-c-Jun N-terminal kinases (p-JNK, sc-6254), JNK (sc-571), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, sc-25778) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Article Title: VEGF (Vascular Endothelial Growth Factor) Induces NRP1 (Neuropilin-1) Cleavage via ADAMs (a Disintegrin and Metalloproteinase) 9 and 10 to Generate Novel Carboxy-Terminal NRP1 Fragments That Regulate Angiogenic Signaling
Article Snippet: Antibodies, Drugs, and Small Interfering RNAs Antibodies to the NRP1 carboxy terminus (C-19; sc-7239), glyceraldehyde 3-phosphate dehydrogenase (GAPDH; V-18, sc-20357), ADAM9 (sc-23290), ADAM17 (TACE; C15, sc-6416), and VEGFR2/KDR (kinase domain insert receptor; A-3, sc-6251) were from Santa Cruz Inc (Santa Cruz, CA).

Imaging:

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight. .. Using infrared dye-labeled secondary antibodies (LI-COR Biosciences), the membranes were directly scanned with Odyssey Infrared Imaging System (LI-COR Biosciences).

Article Title: Genes Proximal and Distal to MYCN Are Highly Expressed in Human Neuroblastoma as Visualized by Comparative Expressed Sequence Hybridization
Article Snippet: Visualization and quantification of the protein extracts were done using the Odyssey infrared imaging system. .. The primary antibodies used were mouse monoclonal anti-N-MYC (NCM II 100, ab16898, Abcam) and anti-glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz).

Protein Concentration:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Protein concentration in cleared lysates was measured using bicinchoninic acid colorimetric assay (BCA kit; Pierce, Rockford, IL). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: For equal loading, the protein concentration of each sample was determined by Bio-Rad protein assay kit. .. The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Polymerase Chain Reaction:

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: The p3XFLAG-E6 expression vector was generated by PCR cloning of the HPV16 PCDNA3-E6 cDNAs, followed by HindIII and XbaI double digestion and insertion into the HindIII and XbaI sites of the pA3F vector (Sigma-Aldrich, St. Louis, MO, USA). .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting).

Article Title: Stress-induced changes in gene interactions in human cells
Article Snippet: Sequences of PCR primers were as follows: ATF4 (forward–CCAACAACAGCAAGGAGGAT, reverse–GTGTCATCCAACGTGGTCAG), DDIT3 (forward–TCACCTCCTGGAAATGAAGA, reverse–CTCCTCCTCAGTCAGCCAAG), HSPA5 (forward–GGAAAGAAGGTTACCCATGC, reverse–CCGTAGGCTCGTTGATGAT), THAP1 (forward–TGCTGTGCCCACAATATTTC, reverse–AGGAGGCGGTAAAGGAGGT) and NDUFA4 (forward–GTCAGGCCAAGAAGCATCC, reverse–GCTCCAGTAGCTCCAGTTCC). .. Protein levels of THAP1 were assessed using rabbit antibody directed against Thap1 (ProteinTech, IL, USA) and normalized to glyceraldehyde 3-phosphate dehydrogenase (sc-137179, Santa Cruz Biotechnology, CA, USA).

Binding Assay:

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: Nonspecific binding on the membranes was blocked with PBS containing 5% dry milk. .. The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Magnetic Cell Separation:

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: The cortex was homogenized using the Gentle MACS dissociator (Miltenyi Biotech, Bergisch Gladbach, Germany) in ice-cold NP40 lysis buffer (Life Technologies) containing a cocktail of protease and phosphatase inhibitors (Life Technologies, Monza, Italy), and then centrifuged at 16099 g for 30 min at 4 °C to remove tissue debris. .. The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control.

In Vivo:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. GAPDH was chosen because changes in protein levels have been reported in vivo only after 12 months of hyperglycemia [ ].

Multiple Displacement Amplification:

Article Title: A Resveratrol Analogue Promotes ERKMAPK
Article Snippet: The human breast (MDA-MB-231 and MCF-7) and pancreatic (Panc-1) cancer cells and the normal mouse fibroblasts (NIH3T3) and their v-Src–transformed (NIH3T3/v-Src) or v-Ras–transformed (NIH3T3/v-Ras) counterparts have all been previously reported ( ; ; ). .. Except for anti– β -actin, glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnology, Inc., Dallas, TX), and cyclin D1 (SPM587) (Novus Biologicals, Littleton, CO), antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA).

Isolation:

Article Title: Enhanced NF-?B Activity Impairs Vascular Function Through PARP-1-, SP-1-, and COX-2-Dependent Mechanisms in Type 2 Diabetes
Article Snippet: Freshly isolated hearts MRAs from all groups were immediately frozen in liquid nitrogen and then homogenized in ice-cold lysis buffer as previously described ( – ). .. Blots were stripped and then reprobed with either β-actin (1:2,000 dilution, Santa Cruz Biotechnology) or glyceraldehyde-3-phosphate dehydrogenase (1:2,000 dilution, Santa Cruz Biotechnology) antibodies to verify the equal loading among the samples.

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: Subsequently, the cortex was isolated and dissected by an optical microscope as previously described by Russo et al. [ ]. .. The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control.

Immunodetection:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. GAPDH was chosen because changes in protein levels have been reported in vivo only after 12 months of hyperglycemia [ ].

Microscopy:

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: Subsequently, the cortex was isolated and dissected by an optical microscope as previously described by Russo et al. [ ]. .. The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control.

Protein Extraction:

Article Title: miR-10a Contributes to Retinoid Acid-induced Smooth Muscle Cell Differentiation *
Article Snippet: Whole cell lysate samples were extracted from cells using the mammalian protein extraction reagent M-Per (Promega) supplemented with a protease inhibitor mixture (Roche Applied Science). .. Antibodies against p65 (Santa Cruz Biotechnology, 1:1000), SMA (Millipore, 1:3000), SM-myosin heavy chain (SMMHC, BTI, 1:2000), glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology, 1:1000), lamin A/C (Santa Cruz Biotechnology, 1:1000), and HDAC4 (Abcam, 1:500) were used for testing individual protein expression.

Stripping:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. GAPDH was chosen because changes in protein levels have been reported in vivo only after 12 months of hyperglycemia [ ].

Lysis:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Western blot analysis Retinas were homogenized for 5 min in ice-cold lysis buffer (50 mM Tris HCl, pH 7.4, 5 mM EDTA, and 0.02% sodium azide) containing a cocktail of protease inhibitors (Sigma). .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Article Title: Enhanced NF-?B Activity Impairs Vascular Function Through PARP-1-, SP-1-, and COX-2-Dependent Mechanisms in Type 2 Diabetes
Article Snippet: Freshly isolated hearts MRAs from all groups were immediately frozen in liquid nitrogen and then homogenized in ice-cold lysis buffer as previously described ( – ). .. Blots were stripped and then reprobed with either β-actin (1:2,000 dilution, Santa Cruz Biotechnology) or glyceraldehyde-3-phosphate dehydrogenase (1:2,000 dilution, Santa Cruz Biotechnology) antibodies to verify the equal loading among the samples.

Article Title: Fingolimod Exerts only Temporary Antiepileptogenic Effects but Longer-Lasting Positive Effects on Behavior in the WAG/Rij Rat Absence Epilepsy Model
Article Snippet: The cortex was homogenized using the Gentle MACS dissociator (Miltenyi Biotech, Bergisch Gladbach, Germany) in ice-cold NP40 lysis buffer (Life Technologies) containing a cocktail of protease and phosphatase inhibitors (Life Technologies, Monza, Italy), and then centrifuged at 16099 g for 30 min at 4 °C to remove tissue debris. .. The membrane was blocked for 1 h with 5% nonfat dry milk/phosphate-buffered saline–Tween 0.05% (Biorad, Hercules, CA, USA), and then incubated over night with the antibodies for phosphorylated (p) Akt (p-Akt; S473), AKT, p-mTOR (S2448), mTOR, p-p70S6 kinase (T389), p70S6 kinase, HDAC1, histone H4, and acetylated-histone H4 (K8) (all from Cell Signaling, Danvers, MA, USA); glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnologies, Santa Cruz, CA, USA) was used as loading control.

SDS Page:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Samples were fractionated on a 15% Tris-HCl sodium dodecyl sulfate–PAGE (SDS–PAGE) Ready Gel (Bio-Rad) for CTGF and VEGF and a 5% Tris-HCl SDS–PAGE Ready Gel (Bio-Rad) for laminin; 30 µg of total protein was loaded into each lane. .. Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above.

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: Paragraph title: SDS-PAGE and Western blot analysis ... The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Article Title: Human Papillomavirus Types 16 and 18 Early-expressed Proteins Differentially Modulate the Cellular Redox State and DNA Damage
Article Snippet: Equal amounts of protein were loaded and separated in a SDS-PAGE; then, proteins were transferred onto a nitrocellulose membrane and incubated with the proper primary antibody. .. Primary antibodies were prepared in TBS/T buffer as follows: anti-glyceraldehyde 3 phosphate dehydrogenase (GAPDH, 1:1000) (Santa Cruz Biotechnologies), anti-SOD2 (1:1000) (Cell Signalling, Danvers, MA, USA), anti-SOD1 (1:1000) (Cell Signalling), anti-catalase (1:500) (Cell Signalling), anti-γH2AX (1:1000) (Abcam, Cambridge, UK), anti-H2AX (1:1000) (Upstate, Darmstadt, Germany), anti-His (1:1000) (Cell Signalling), anti-HA (1:1000) (Roche), anti-FLAG M2 (1:2000) (Sigma-Aldrich), and anti-HPV18 E2 (1:1000) (Abcam).

Plasmid Preparation:

Article Title: HPV16 E6 upregulates Aurora A expression
Article Snippet: The p3XFLAG-E6 expression vector was generated by PCR cloning of the HPV16 PCDNA3-E6 cDNAs, followed by HindIII and XbaI double digestion and insertion into the HindIII and XbaI sites of the pA3F vector (Sigma-Aldrich, St. Louis, MO, USA). .. The antibodies used in the present study were the mouse monoclonal anti-FLAG M2 (catalog no. F1804; Sigma-Aldrich), anti-HA (catalog no. H3663; Sigma-Aldrich), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-Aurora A (catalog no. 610939; BD Biosciences, San Jose, CA, USA) and anti-HPV16 E6 C1P5 (catalog no. sc460; BD Biosciences) antibodies (at 1:1,000 dilution for western blotting).

Software:

Article Title: Effect of bone marrow mesenchymal stem cell transplantation on acute hepatic failure in rats
Article Snippet: The primary antibodies were mouse anti-CD163 (1:200; sc-58965; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), mouse anti-IL-10 (1:250; ab25073; Abcam, Cambridge, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; sc-25778; Santa Cruz Biotechnology). .. The gray value was measured using Quantity One software (Bio-Rad, Hercules, CA, USA).

Enzyme-linked Immunosorbent Assay:

Article Title: Synthesis and biological evaluation of a novel class of curcumin analogs as anti-inflammatory agents for prevention and treatment of sepsis in mouse model
Article Snippet: In addition, eBioscience (San Diego, CA, USA) was the source of the mouse IL-6 enzyme-linked immunosorbent assay (ELISA) kit and mouse TNF-α ELISA kit. .. Anti-glyceraldehyde 3-phosphate dehydrogenase, anti-IκBα (nuclear factor of kappa light-polypeptide gene enhancer in B-cells inhibitor alpha), and anti-extracellular signal-regulated kinase (ERK) antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

Recombinant:

Article Title: A Resveratrol Analogue Promotes ERKMAPK
Article Snippet: Except for anti– β -actin, glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnology, Inc., Dallas, TX), and cyclin D1 (SPM587) (Novus Biologicals, Littleton, CO), antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA). .. Recombinant human epidermal growth factor (EGF) was purchased from Invitrogen/Life Technologies (Carlsbad, CA).

In Situ:

Article Title: Notch signaling in the collecting duct regulates renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction in mice
Article Snippet: Antibodies The antibodies used in this study were as follows: AQP2 (Millipore, Billerica, MA, USA), Notch1 (Abcam, Cambridge, UK), fibronectin (DAKO, Glostrupp, Denmark), collagen IV (SouthernBiotech, Birmingham, AL, USA), fibroblast-specific protein 1 (FSP1, Thermo Scientific, Cheshire, UK), transforming growth factor β (TGF-β, R & D systems, Minneapolis, MN, USA), Smad4 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), c-Myc (Santa Cruz Biotechnology), and glyceraldehyde 3-phosphate dehydrogenase (Santa Cruz Biotechnology) were used. .. Apoptosis was detected using an ApopTag Peroxidase in situ Apoptosis Detection Kit (Millipore).

Radio Immunoprecipitation:

Article Title: Role of the Erythropoietin Receptor in ETV6/RUNX1-Positive Acute Lymphoblastic Leukemia
Article Snippet: Whole-cell lysates were prepared with radioimmunoprecipitation assay buffer (50 mmol/L Tris, 1% NP-40, 0.25% sodium deoxycholate, 150 mmol/L NaCl, 1 mmol/L EDTA) supplemented with 1 mmol/L NaVO4 and 1% protease inhibitor cocktail (Roche) as described previously ( , ). .. The membranes were probed with antibodies specific for phospho-AKT, AKT (Cell Signaling Technology), poly(ADP-ribose) polymerase (PARP; C210; Becton Dickinson), and glyceraldehyde 3-phosphate dehydrogenase (6C5; Santa Cruz Biotechnology) or tubulin (DM1A; Calbiochem) in 1% dry milk in PBS at 4 °C overnight.

Small Interfering RNA:

Article Title: Stress-induced changes in gene interactions in human cells
Article Snippet: Paragraph title: THAP1 small interfering RNA knockdown ... Protein levels of THAP1 were assessed using rabbit antibody directed against Thap1 (ProteinTech, IL, USA) and normalized to glyceraldehyde 3-phosphate dehydrogenase (sc-137179, Santa Cruz Biotechnology, CA, USA).

Staining:

Article Title: Inhibition of connective tissue growth factor by small interfering ribonucleic acid prevents increase in extracellular matrix molecules in a rodent model of diabetic retinopathy
Article Snippet: Membranes were subsequently stripped with Restore Western Blot Stripping (Thermo Scientific), incubated with antibodies to VEGF (1:1,000; Santa Cruz) and to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000; Santa Cruz) for loading control, and processed for immunodetection as described as above. .. For loading controls, membranes were stained with Ponceau S. Densitometric analysis of the luminescent signal was performed at non-saturating exposures.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Santa Cruz Biotechnology gapdh
    <t>RanGAP1</t> RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with <t>GAPDH</t> normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.
    Gapdh, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gapdh/product/Santa Cruz Biotechnology
    Average 99 stars, based on 129 article reviews
    Price from $9.99 to $1999.99
    gapdh - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Santa Cruz Biotechnology antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh
    Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH).</t>
    Antibodies Against Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Santa Cruz Biotechnology
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Santa Cruz Biotechnology anti bax antibody
    Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and <t>p53.</t> MPTQ treatment also upregulates <t>Bax</t> protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.
    Anti Bax Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti bax antibody/product/Santa Cruz Biotechnology
    Average 99 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    anti bax antibody - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    RanGAP1 RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with GAPDH normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.

    Journal: PLoS ONE

    Article Title: Ran GTPase-Activating Protein 1 Is a Therapeutic Target in Diffuse Large B-Cell Lymphoma

    doi: 10.1371/journal.pone.0079863

    Figure Lengend Snippet: RanGAP1 RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with GAPDH normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.

    Article Snippet: The ratio was expressed as the amount of RanGAP1 divided by the corresponding amount of GAPDH (glyceraldehyde 3-phosphate dehydrogenase, 1:5000, 6C5, sc-32233; Santa Cruz) using an imaging analyzer (White Light Transilluminator; Bio-Rad Laboratories, Hercules, CA, USA).

    Techniques: Transfection, Plasmid Preparation, shRNA, Cell Cycle Assay, Western Blot, Expressing

    Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

    Journal: International Journal of Molecular Sciences

    Article Title: Low Amount of Salinomycin Greatly Increases Akt Activation, but Reduces Activated p70S6K Levels

    doi: 10.3390/ijms140917304

    Figure Lengend Snippet: Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

    Article Snippet: Antibodies against glyceraldehyde 3-phosphate dehydrogenase (GAPDH), phosphorylated p38, p38, Erk1/2, Jak1, Jak2, survivin, and pRb were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Techniques: Concentration Assay, Western Blot

    Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and p53. MPTQ treatment also upregulates Bax protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.

    Journal: PLoS ONE

    Article Title: A Novel Anticancer Agent, 8-Methoxypyrimido[4?,5?:4,5]thieno(2,3-b) Quinoline-4(3H)-One Induces Neuro 2a Neuroblastoma Cell Death through p53-Dependent, Caspase-Dependent and -Independent Apoptotic Pathways

    doi: 10.1371/journal.pone.0066430

    Figure Lengend Snippet: Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and p53. MPTQ treatment also upregulates Bax protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.

    Article Snippet: Mouse anti-GAPDH antibody (6C5, monoclonal; SC32233), mouse anti-PARP-1 antibody (C2-10, monoclonal; S53643), rabbit anti-phopho-p53 (Ser20) antibody (SC-21872-R), Goat anti-AIF antibody (SC-9416) and anti-Bax antibody (SC-526) were purchased from Santa Cruz Biotechnology (Santa Cruz, USA).

    Techniques: Translocation Assay

    Effect of si-EpCAM and/or 5-FU treatment on apoptosis-related factors in MCF-7 cells. (A) MCF-7 cells were treated with 7.5 µg/ml and 20 µg/ml 5-FU for 48 h. Cells were harvested and analyzed by western blotting with antibodies against Bcl-2, Bax and caspase3. (B) MCF-7 cells were treated with si-EpCAM and/or 5-FU (7.5 µg/ml) for 48 h, and the expression of Bcl-2, Bax and caspase 3 was determined by immunoblotting.

    Journal: PLoS ONE

    Article Title: Knockdown of EpCAM Enhances the Chemosensitivity of Breast Cancer Cells to 5-fluorouracil by Downregulating the Antiapoptotic Factor Bcl-2

    doi: 10.1371/journal.pone.0102590

    Figure Lengend Snippet: Effect of si-EpCAM and/or 5-FU treatment on apoptosis-related factors in MCF-7 cells. (A) MCF-7 cells were treated with 7.5 µg/ml and 20 µg/ml 5-FU for 48 h. Cells were harvested and analyzed by western blotting with antibodies against Bcl-2, Bax and caspase3. (B) MCF-7 cells were treated with si-EpCAM and/or 5-FU (7.5 µg/ml) for 48 h, and the expression of Bcl-2, Bax and caspase 3 was determined by immunoblotting.

    Article Snippet: Anti-Bcl-2, anti-Bax, anti-Caspase 3, anti-GAPDH were obtained from Santa Cruz.

    Techniques: Western Blot, Expressing