Structured Review

Becton Dickinson glyceraldehyde 3 phosphate dehydrogenase
FAM98A increased cyclin D1 expression and enhanced proliferation via promoting P38-ATF2 phosphorylation. Notes: (A) The expression of p-P38, p-ATF2, and cyclin D1 were determined after FAM98A overexpression or knockdown in A549 and SPC cells. (B) The expressions of p-P38, p-ATF2, and cyclin D1 were measured after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. (C) The colony formation assay was performed after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. The assays were replicated 3 times. Abbreviations: DMSO, dimethyl sulfoxide; GAPDH, <t>glyceraldehyde-3-phosphate</t> dehydrogenase; p-ATF2, phosphorylated ATF2; p-P38, phosphorylated P38; NC, negative control.
Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase/product/Becton Dickinson
Average 94 stars, based on 2 article reviews
Price from $9.99 to $1999.99
glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-04
94/100 stars

Images

1) Product Images from "FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway"

Article Title: FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S163323

FAM98A increased cyclin D1 expression and enhanced proliferation via promoting P38-ATF2 phosphorylation. Notes: (A) The expression of p-P38, p-ATF2, and cyclin D1 were determined after FAM98A overexpression or knockdown in A549 and SPC cells. (B) The expressions of p-P38, p-ATF2, and cyclin D1 were measured after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. (C) The colony formation assay was performed after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. The assays were replicated 3 times. Abbreviations: DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; p-ATF2, phosphorylated ATF2; p-P38, phosphorylated P38; NC, negative control.
Figure Legend Snippet: FAM98A increased cyclin D1 expression and enhanced proliferation via promoting P38-ATF2 phosphorylation. Notes: (A) The expression of p-P38, p-ATF2, and cyclin D1 were determined after FAM98A overexpression or knockdown in A549 and SPC cells. (B) The expressions of p-P38, p-ATF2, and cyclin D1 were measured after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. (C) The colony formation assay was performed after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. The assays were replicated 3 times. Abbreviations: DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; p-ATF2, phosphorylated ATF2; p-P38, phosphorylated P38; NC, negative control.

Techniques Used: Expressing, Over Expression, Negative Control, Colony Assay

2) Product Images from "Placenta Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in Sickle Cell Disease (SCD) *"

Article Title: Placenta Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in Sickle Cell Disease (SCD) *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M110.101691

PAI-1 expression in mice and human subjects. A and B , plasma levels of PAI-1 in mice as measured by ELISA. Berk-hemi , hemizygous Berkeley mice; Berk-SS , Berkeley SS mice. C , plasma PlGF levels in mice by ELISA. The respective strain is indicated at the bottom of the figure. D , immunohistochemistry for PAI-1 expression in C57BL/6 (normal) and Berkeley SS mouse lungs (shown in brown ; nuclei are stained red ). The top panel shows: (i) antibody control and PAI-1 expression in bronchial epithelial cells of normal and (ii) Berkeley SS mice; the bottom panel shows corresponding staining for PAI-1 in their lung parenchyma. Arrows indicate alveolar macrophages, and arrowheads indicate bronchial epithelial layer. E , the levels of PAI-1 were quantified in BAL of indicated strains of mice by ELISA. F , qRT-PCR analysis of PAI-1 mRNA in MNC from SCD subjects ( n = 9) and normal controls ( n = 9). RQ , relative quantification. G and H , HPMVEC were treated with human recombinant PlGF (250 ng/ml) for the indicated time periods. G , total RNA was subjected to RPA for the expression of indicated genes. H , the culture supernatants were assayed for PAI-1 by ELISA. RPA data are representative of three independent experiments. GAPDH , glyceraldehyde-3-phosphate dehydrogenase. Where indicated, the vertical lines show repositioned gel lanes. *, p
Figure Legend Snippet: PAI-1 expression in mice and human subjects. A and B , plasma levels of PAI-1 in mice as measured by ELISA. Berk-hemi , hemizygous Berkeley mice; Berk-SS , Berkeley SS mice. C , plasma PlGF levels in mice by ELISA. The respective strain is indicated at the bottom of the figure. D , immunohistochemistry for PAI-1 expression in C57BL/6 (normal) and Berkeley SS mouse lungs (shown in brown ; nuclei are stained red ). The top panel shows: (i) antibody control and PAI-1 expression in bronchial epithelial cells of normal and (ii) Berkeley SS mice; the bottom panel shows corresponding staining for PAI-1 in their lung parenchyma. Arrows indicate alveolar macrophages, and arrowheads indicate bronchial epithelial layer. E , the levels of PAI-1 were quantified in BAL of indicated strains of mice by ELISA. F , qRT-PCR analysis of PAI-1 mRNA in MNC from SCD subjects ( n = 9) and normal controls ( n = 9). RQ , relative quantification. G and H , HPMVEC were treated with human recombinant PlGF (250 ng/ml) for the indicated time periods. G , total RNA was subjected to RPA for the expression of indicated genes. H , the culture supernatants were assayed for PAI-1 by ELISA. RPA data are representative of three independent experiments. GAPDH , glyceraldehyde-3-phosphate dehydrogenase. Where indicated, the vertical lines show repositioned gel lanes. *, p

Techniques Used: Expressing, Mouse Assay, Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Staining, Quantitative RT-PCR, Recombinant, Recombinase Polymerase Amplification

3) Product Images from "FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway"

Article Title: FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S163323

FAM98A increased cyclin D1 expression and enhanced proliferation via promoting P38-ATF2 phosphorylation. Notes: (A) The expression of p-P38, p-ATF2, and cyclin D1 were determined after FAM98A overexpression or knockdown in A549 and SPC cells. (B) The expressions of p-P38, p-ATF2, and cyclin D1 were measured after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. (C) The colony formation assay was performed after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. The assays were replicated 3 times. Abbreviations: DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; p-ATF2, phosphorylated ATF2; p-P38, phosphorylated P38; NC, negative control.
Figure Legend Snippet: FAM98A increased cyclin D1 expression and enhanced proliferation via promoting P38-ATF2 phosphorylation. Notes: (A) The expression of p-P38, p-ATF2, and cyclin D1 were determined after FAM98A overexpression or knockdown in A549 and SPC cells. (B) The expressions of p-P38, p-ATF2, and cyclin D1 were measured after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. (C) The colony formation assay was performed after SB203580, a P38 inhibitor, was added to the culture media of A549 and SPC cells with or without FAM98A overexpression. DMSO was used as negative control. The assays were replicated 3 times. Abbreviations: DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; p-ATF2, phosphorylated ATF2; p-P38, phosphorylated P38; NC, negative control.

Techniques Used: Expressing, Over Expression, Negative Control, Colony Assay

Related Articles

Centrifugation:

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. For ligand binding assay membranes were prepared by harvesting the cells in ice-cold PBS followed by differential centrifugation as detailed previously.

Amplification:

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: .. Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. The PCR for D1R and GAPDH was performed with commercially available taqman® primers (Life Technologies).

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume. .. The specificity of the amplification reactions was confirmed by melting curve analysis.

Synthesized:

Article Title:
Article Snippet: Total cellular RNA, which was prepared using RNeasy Mini kit (QIAGEN, Valencia, CA), was treated with RNase-free DNase (RQ1; Promega, Madison, WI) to eliminate contaminated DNA. cDNA was synthesized using a Superscript preamplification system (Invitrogen, Carlsbad, CA) from 3 μg of total RNA. .. A primer set for glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences.

Autoradiography:

Article Title: Polycystin-1 Protein Level Determines Activity of the G?12/JNK Apoptosis Pathway *
Article Snippet: Lysates were analyzed by SDS-PAGE and Western blotting with antibodies specific for Bcl-2 (1:1000 dilution) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000 dilution) (BD Transduction Laboratories); NF-κB (1:500 dilution; Santa Cruz Biotechnology); and Bcl-xL (1:500 dilution), Akt (1:1000 dilution), and phospho-Akt Ser473 (1:500 dilution) (Cell Signaling). .. After washing and incubating with the appropriate horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature, signal was detected with the SuperSignal West Pico horseradish peroxidase substrate system (Pierce) and by autoradiography (Biomax, Denville Scientific).

Pyrolysis Gas Chromatography:

Article Title: AMP-Activated Protein Kinase-Deficient Mice Are Resistant to the Metabolic Effects of Resveratrol
Article Snippet: The following antibodies were used: AMPKα (Cell Signaling Technology), p-AMPK (T172) (Cell Signaling Technology), phosphor–acetyl-CoA carboxylase (ACC), which recognizes phosphorylated Ser 79 in ACC1 or phosphorylated Ser 22 in ACC2 (Cell Signaling Technology), ACC (Cell Signaling Technology), Sirt1 (Upstate Biotechology), V5 (Invitrogen), cytochrome C (Cell Signaling Technology), actin (Santa Cruz), and glyceraldehyde 3-phosphate dehydrogenase (BD Bioscience). .. Peroxisome proliferator–activated receptor (PPAR)-γ coactivator (PGC)-1α acetylation was visualized by immunoprecipitating PGC-1α (antibody from Santa Cruz) from the nuclear extract (500 μg) of skeletal muscle and immunoblotting with antibody specific for acetylated lysine (Cell Signaling Technology) or PGC-1α.

Quantitative RT-PCR:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title: IL-6 induction in desiccated corneal epithelium in vitro and in vivo
Article Snippet: PCR of the cDNAs of cytokines and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) was performed using the Advantage 2 PCR kit (BD Bioscience). .. The primer sets for cytokines and GAPDH were purchased from TOYOBO CO., LTD. TaqMan real-time RT–PCR of IL-6 and IL-8 was performed using the ABI PRISM 7700 Sequence Detection Systems (Life Technologies Corporation, Carlsbad, CA) according to the manufacturer’s protocol.

SYBR Green Assay:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: .. The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume. .. The PCR cycling conditions were as follows: 5 min at 95 °C for 1 cycle, 30 s at 95 °C, and 1 min at 60 °C for 45 cycles.

Incubation:

Article Title: FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway
Article Snippet: .. Membranes were incubated with primary antibodies to FAM98A (1:500, Abcam), phosphorylated P38 (p-P38), P38, phosphorylated ATF2 (p-ATF2), ATF2, cyclin D1 (1:1000; Cell Signaling Technology, Danvers, MA, USA), glyceraldehyde-3-phosphate dehydrogenase (1:2000, BD Transduction Laboratories, Lexington, KY, USA), and β-actin (1:500; Santa Cruz Biotechnology) overnight at 4°C. .. The P38 inhibitor sb203580 was purchased from Cell Signaling Technology.

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: The PVDF membrane was incubated for 1 h at 37°C in a blocking solution containing 5% nonfat dry milk, 0.04 M Tris-HCl (pH 7.6), 0.8% NaCl, and 0.5% Tween 20, followed by an overnight incubation at 4°C with mouse monoclonal anti-CD16 (dilution, 1:1,000; BD), anti-CD32 (dilution, 1:1,000; BD), or anti-CD64 (dilution, 1:1,000; BD) antibody and with subsequent addition of peroxidase-linked anti-mouse secondary IgG antibody diluted (1:5,000; Southern Biotech) in the blocking solution. .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

Article Title: A novel orally active proteasome inhibitor ONX 0912 triggers in vitro and in vivo cytotoxicity in multiple myeloma
Article Snippet: .. Membranes were blocked by incubation in 5% nonfat dry milk in PBST (0.05% Tween-20 in phosphate-buffered saline [PBS]), and probed with specific antibodies against poly(ADP) ribose polymerase (PARP; BD Biosciences Pharmingen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; BD Biosciences Pharmingen), or caspase-8, caspase-9, or caspase-3 (Cell Signaling Technology). .. Blots were then developed by enhanced chemiluminescence (ECL; Amersham).

Activity Assay:

Article Title: A novel orally active proteasome inhibitor ONX 0912 triggers in vitro and in vivo cytotoxicity in multiple myeloma
Article Snippet: Paragraph title: Immunoblotting and in vitro proteasome activity assays ... Membranes were blocked by incubation in 5% nonfat dry milk in PBST (0.05% Tween-20 in phosphate-buffered saline [PBS]), and probed with specific antibodies against poly(ADP) ribose polymerase (PARP; BD Biosciences Pharmingen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; BD Biosciences Pharmingen), or caspase-8, caspase-9, or caspase-3 (Cell Signaling Technology).

Expressing:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Relative quantification (RQ) values of 5-LO and FLAP mRNA expression were calculated as 2−ΔΔCt by the comparative cycle threshold (Ct ) method.

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: To determine mRNA expression levels, cDNA converted from 1 μg of total RNA was diluted to various concentrations. .. The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume.

Article Title: IL-6 induction in desiccated corneal epithelium in vitro and in vivo
Article Snippet: Paragraph title: mRNA expression in CEPI cells upon long-term desiccation ... PCR of the cDNAs of cytokines and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) was performed using the Advantage 2 PCR kit (BD Bioscience).

BIA-KA:

Article Title: Phosphodiesterase Type 5 Inhibitors Increase Herceptin Transport and Treatment Efficacy in Mouse Metastatic Brain Tumor Models
Article Snippet: Total protein was extracted and concentrations were determined using a BCA assay kit (Bio-Rad Laboratories, Hercules, CA). .. For apoptosis detection, the membranes were probed with primary antibodies to cleaved Poly-ADP-Ribose-Polymerase (PARP), an 89-kDa PARP fragment that is considered as a marker of apoptosis, and to an internal control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Pharmingen, San Diego, CA), respectively.

Western Blot:

Article Title: FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway
Article Snippet: Paragraph title: Western blotting ... Membranes were incubated with primary antibodies to FAM98A (1:500, Abcam), phosphorylated P38 (p-P38), P38, phosphorylated ATF2 (p-ATF2), ATF2, cyclin D1 (1:1000; Cell Signaling Technology, Danvers, MA, USA), glyceraldehyde-3-phosphate dehydrogenase (1:2000, BD Transduction Laboratories, Lexington, KY, USA), and β-actin (1:500; Santa Cruz Biotechnology) overnight at 4°C.

Article Title: Polycystin-1 Protein Level Determines Activity of the G?12/JNK Apoptosis Pathway *
Article Snippet: .. Lysates were analyzed by SDS-PAGE and Western blotting with antibodies specific for Bcl-2 (1:1000 dilution) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000 dilution) (BD Transduction Laboratories); NF-κB (1:500 dilution; Santa Cruz Biotechnology); and Bcl-xL (1:500 dilution), Akt (1:1000 dilution), and phospho-Akt Ser473 (1:500 dilution) (Cell Signaling). .. After washing and incubating with the appropriate horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature, signal was detected with the SuperSignal West Pico horseradish peroxidase substrate system (Pierce) and by autoradiography (Biomax, Denville Scientific).

Article Title: Phosphodiesterase Type 5 Inhibitors Increase Herceptin Transport and Treatment Efficacy in Mouse Metastatic Brain Tumor Models
Article Snippet: Paragraph title: Western Blot Analysis of Apoptotic Effect on Brain Tissues of Treated Mice ... For apoptosis detection, the membranes were probed with primary antibodies to cleaved Poly-ADP-Ribose-Polymerase (PARP), an 89-kDa PARP fragment that is considered as a marker of apoptosis, and to an internal control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Pharmingen, San Diego, CA), respectively.

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: Paragraph title: Western blot analysis. ... Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

Article Title: Nitric oxide-regulated proteolysis of human CYP2B6 via the ubiquitin-proteasome system
Article Snippet: .. CYP2B6 (WB-2B6-Pep, Cat# 458226), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Cat# MAB374) and V5-tag antibodies (Cat# V8012) were from BD Biosciences (San Jose, CA), Millipore (Billerica, MA), and Sigma-Aldrich (St. Louis, MO), respectively. .. The monoclonal anti-hemagglutinin (HA) antibody was from Santa Cruz Biotechnology, Dallas, TX (Ca# sc-7392).

Real-time Polymerase Chain Reaction:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: Paragraph title: RNA isolation and real-time PCR ... The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume.

Article Title: IL-6 induction in desiccated corneal epithelium in vitro and in vivo
Article Snippet: PCR of the cDNAs of cytokines and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) was performed using the Advantage 2 PCR kit (BD Bioscience). .. Primer sets and TaqMan probes, and other reagents for TaqMan real-time PCR were purchased from Life Technologies Corporation.

Recombinase Polymerase Amplification:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: .. Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title: Placenta Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in Sickle Cell Disease (SCD) *
Article Snippet: .. RPA was performed using custom-made RiboQuant multi-probe templates comprised of PAI-1, TGF-β, HIF-1α, and glyceraldehyde-3-phosphate dehydrogenase (BD Biosciences), as described previously ( ). .. Band intensity was analyzed using Spot-Denso software on an AlphaImager 2000 gel documentation system (Alpha Innotech Corp., San Leandro, CA).

Electrophoresis:

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: After electrophoresis at a constant 130 V/gel, the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad; 0.2 mm) and briefly stained with Ponceau S (Sigma) to verify efficient transfer of the protein. .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

Protease Inhibitor:

Article Title: Polycystin-1 Protein Level Determines Activity of the G?12/JNK Apoptosis Pathway *
Article Snippet: Cells were lysed with ice-cold lysis buffer (50 m m HEPES (pH 7.5), 1 m m EDTA, 3 m m dithiothreitol, 2 m m MgSO4 , 1% C12 E10 , and protease inhibitor mixture (Roche Diagnostics)). .. Lysates were analyzed by SDS-PAGE and Western blotting with antibodies specific for Bcl-2 (1:1000 dilution) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000 dilution) (BD Transduction Laboratories); NF-κB (1:500 dilution; Santa Cruz Biotechnology); and Bcl-xL (1:500 dilution), Akt (1:1000 dilution), and phospho-Akt Ser473 (1:500 dilution) (Cell Signaling).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title:
Article Snippet: Paragraph title: RNA Isolation and Reverse Transcription (RT)-PCR ... A primer set for glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences.

Polymerase Chain Reaction:

Article Title:
Article Snippet: Semiquantitative PCR for WNT10B was performed using 2 μl of cDNA, 2 μM of each primer (TGGAAGAATGCGGCTCTGA and CTCTCCAAAGTCCATGTCATGG), 1.5 mM MgCl2 , 800 μM dNTP mix, and 2.5 U of AmpliTaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ) in a buffer supplied by the company. .. A primer set for glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences.

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: .. Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. The PCR for D1R and GAPDH was performed with commercially available taqman® primers (Life Technologies).

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: .. The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume. .. The PCR cycling conditions were as follows: 5 min at 95 °C for 1 cycle, 30 s at 95 °C, and 1 min at 60 °C for 45 cycles.

Article Title: IL-6 induction in desiccated corneal epithelium in vitro and in vivo
Article Snippet: .. PCR of the cDNAs of cytokines and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) was performed using the Advantage 2 PCR kit (BD Bioscience). .. The primer sets for cytokines and GAPDH were purchased from TOYOBO CO., LTD. TaqMan real-time RT–PCR of IL-6 and IL-8 was performed using the ABI PRISM 7700 Sequence Detection Systems (Life Technologies Corporation, Carlsbad, CA) according to the manufacturer’s protocol.

Affinity Purification:

Article Title: Characterization of a novel microRNA, miR-188, elevated in serum of muscular dystrophy dog model
Article Snippet: Mouse monoclonal antibodies against ubiquitin-conjugating enzyme E2I, UBE2I (610748), Glyceraldehyde-3-phosphate dehydrogenase, GAPDH (sc-32233), and developmental myosin heavy chain, dMyHC (NCL-MHCd), were purchased from BD Bioscience (San Jose, CA), Santa Cruz Biotechnology (Santa Cruz, CA), and Leica Biosystems (Newcastle, UK), respectively. .. Affinity purified peroxidase-conjugated anti-mouse IgG goat antibody (PNIM0817) and peroxidase-conjugated anti-rabbit IgG goat antibody (A0545) were purchased from Merck (Darmstadt, Germany) and Beckman Coulter Diagnostics (Fullerton, CA), respectively.

Binding Assay:

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. Membranes (50 µg protein) were suspended in 50 mmol/L TrisHCl (pH 7.4, 120 mmol/L MgCl2 ) and saturation assay was performed at different concentrations of [3 H] using unlabeled (10 µmol/L) to obtain specific binding.

Nucleic Acid Electrophoresis:

Article Title: FAM98A promotes proliferation of non-small cell lung cancer cells via the P38-ATF2 signaling pathway
Article Snippet: Protein samples (80 μg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then transferred onto poly-vinylidene fluoride membranes (Millipore, Billerica, MA, USA), then blocked with 5% non-fat milk in tris-buffered saline with Tween 20. .. Membranes were incubated with primary antibodies to FAM98A (1:500, Abcam), phosphorylated P38 (p-P38), P38, phosphorylated ATF2 (p-ATF2), ATF2, cyclin D1 (1:1000; Cell Signaling Technology, Danvers, MA, USA), glyceraldehyde-3-phosphate dehydrogenase (1:2000, BD Transduction Laboratories, Lexington, KY, USA), and β-actin (1:500; Santa Cruz Biotechnology) overnight at 4°C.

Article Title: A novel orally active proteasome inhibitor ONX 0912 triggers in vitro and in vivo cytotoxicity in multiple myeloma
Article Snippet: Briefly, equal amounts of proteins were resolved by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes. .. Membranes were blocked by incubation in 5% nonfat dry milk in PBST (0.05% Tween-20 in phosphate-buffered saline [PBS]), and probed with specific antibodies against poly(ADP) ribose polymerase (PARP; BD Biosciences Pharmingen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; BD Biosciences Pharmingen), or caspase-8, caspase-9, or caspase-3 (Cell Signaling Technology).

Isolation:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA). .. Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA).

Article Title:
Article Snippet: Paragraph title: RNA Isolation and Reverse Transcription (RT)-PCR ... A primer set for glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences.

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: .. Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. The PCR for D1R and GAPDH was performed with commercially available taqman® primers (Life Technologies).

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: Paragraph title: RNA isolation and real-time PCR ... The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume.

Article Title: Nitric oxide-regulated proteolysis of human CYP2B6 via the ubiquitin-proteasome system
Article Snippet: RNA-Bee isolation reagent was from Tel-Test, Friendswood, TX. .. CYP2B6 (WB-2B6-Pep, Cat# 458226), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Cat# MAB374) and V5-tag antibodies (Cat# V8012) were from BD Biosciences (San Jose, CA), Millipore (Billerica, MA), and Sigma-Aldrich (St. Louis, MO), respectively.

Mouse Assay:

Article Title: Phosphodiesterase Type 5 Inhibitors Increase Herceptin Transport and Treatment Efficacy in Mouse Metastatic Brain Tumor Models
Article Snippet: Paragraph title: Western Blot Analysis of Apoptotic Effect on Brain Tissues of Treated Mice ... For apoptosis detection, the membranes were probed with primary antibodies to cleaved Poly-ADP-Ribose-Polymerase (PARP), an 89-kDa PARP fragment that is considered as a marker of apoptosis, and to an internal control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Pharmingen, San Diego, CA), respectively.

Sequencing:

Article Title: IL-6 induction in desiccated corneal epithelium in vitro and in vivo
Article Snippet: PCR of the cDNAs of cytokines and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) was performed using the Advantage 2 PCR kit (BD Bioscience). .. The primer sets for cytokines and GAPDH were purchased from TOYOBO CO., LTD. TaqMan real-time RT–PCR of IL-6 and IL-8 was performed using the ABI PRISM 7700 Sequence Detection Systems (Life Technologies Corporation, Carlsbad, CA) according to the manufacturer’s protocol.

Blocking Assay:

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: The PVDF membrane was incubated for 1 h at 37°C in a blocking solution containing 5% nonfat dry milk, 0.04 M Tris-HCl (pH 7.6), 0.8% NaCl, and 0.5% Tween 20, followed by an overnight incubation at 4°C with mouse monoclonal anti-CD16 (dilution, 1:1,000; BD), anti-CD32 (dilution, 1:1,000; BD), or anti-CD64 (dilution, 1:1,000; BD) antibody and with subsequent addition of peroxidase-linked anti-mouse secondary IgG antibody diluted (1:5,000; Southern Biotech) in the blocking solution. .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

Staining:

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: Protein bands were detected and quantified with a lumino image analyzer (GE Typhoon 8600) after staining with chemiluminescence detection reagents (Thermo Fisher). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

SDS Page:

Article Title: Polycystin-1 Protein Level Determines Activity of the G?12/JNK Apoptosis Pathway *
Article Snippet: .. Lysates were analyzed by SDS-PAGE and Western blotting with antibodies specific for Bcl-2 (1:1000 dilution) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000 dilution) (BD Transduction Laboratories); NF-κB (1:500 dilution; Santa Cruz Biotechnology); and Bcl-xL (1:500 dilution), Akt (1:1000 dilution), and phospho-Akt Ser473 (1:500 dilution) (Cell Signaling). .. After washing and incubating with the appropriate horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature, signal was detected with the SuperSignal West Pico horseradish peroxidase substrate system (Pierce) and by autoradiography (Biomax, Denville Scientific).

Article Title: A novel orally active proteasome inhibitor ONX 0912 triggers in vitro and in vivo cytotoxicity in multiple myeloma
Article Snippet: Briefly, equal amounts of proteins were resolved by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes. .. Membranes were blocked by incubation in 5% nonfat dry milk in PBST (0.05% Tween-20 in phosphate-buffered saline [PBS]), and probed with specific antibodies against poly(ADP) ribose polymerase (PARP; BD Biosciences Pharmingen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; BD Biosciences Pharmingen), or caspase-8, caspase-9, or caspase-3 (Cell Signaling Technology).

Software:

Article Title: Placenta growth factor induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell disease
Article Snippet: .. Ribonuclease protection assay (RPA) was performed using a custom RiboQuant Multi-Probe template comprising 5-LO, FLAP, HIF-1α, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Biosciences, San Diego, CA) as described., The intensity of the bands was analyzed using the Spot-Denso software on the Alpha Imager 2000 gel documentation system (Alpha Innotech, San Leandro, CA). .. Real-time polymerase chain reaction (qRT-PCR) was carried out using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad Laboratories, Hercules, CA) as per the manufacturer's instructions on an ABI P rism 7900 (Applied Biosystems, Foster City, CA).

Article Title: Methamphetamine Impairs IgG1-Mediated Phagocytosis and Killing of Cryptococcus neoformans by J774.16 Macrophage- and NR-9640 Microglia-Like Cells
Article Snippet: Quantitative measurements of individual band intensities in Western blot analyses for CD16, CD32, and CD64 were performed using ImageJ software (National Institutes of Health). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; dilution, 1:1,000; BD), a cytoplasmic housekeeping protein, was used as a loading control to determine the relative intensity ratio.

Article Title: Placenta Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in Sickle Cell Disease (SCD) *
Article Snippet: RPA was performed using custom-made RiboQuant multi-probe templates comprised of PAI-1, TGF-β, HIF-1α, and glyceraldehyde-3-phosphate dehydrogenase (BD Biosciences), as described previously ( ). .. Band intensity was analyzed using Spot-Denso software on an AlphaImager 2000 gel documentation system (Alpha Innotech Corp., San Leandro, CA).

Rnase Protection Assay:

Article Title: Placenta Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in Sickle Cell Disease (SCD) *
Article Snippet: Paragraph title: RNase Protection Assay (RPA) ... RPA was performed using custom-made RiboQuant multi-probe templates comprised of PAI-1, TGF-β, HIF-1α, and glyceraldehyde-3-phosphate dehydrogenase (BD Biosciences), as described previously ( ).

In Vitro:

Article Title: A novel orally active proteasome inhibitor ONX 0912 triggers in vitro and in vivo cytotoxicity in multiple myeloma
Article Snippet: Paragraph title: Immunoblotting and in vitro proteasome activity assays ... Membranes were blocked by incubation in 5% nonfat dry milk in PBST (0.05% Tween-20 in phosphate-buffered saline [PBS]), and probed with specific antibodies against poly(ADP) ribose polymerase (PARP; BD Biosciences Pharmingen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; BD Biosciences Pharmingen), or caspase-8, caspase-9, or caspase-3 (Cell Signaling Technology).

Radio Immunoprecipitation:

Article Title: AMP-Activated Protein Kinase-Deficient Mice Are Resistant to the Metabolic Effects of Resveratrol
Article Snippet: Cells were lysed in radioimmunoprecipitation assay buffer and subjected to immunoblotting. .. The following antibodies were used: AMPKα (Cell Signaling Technology), p-AMPK (T172) (Cell Signaling Technology), phosphor–acetyl-CoA carboxylase (ACC), which recognizes phosphorylated Ser 79 in ACC1 or phosphorylated Ser 22 in ACC2 (Cell Signaling Technology), ACC (Cell Signaling Technology), Sirt1 (Upstate Biotechology), V5 (Invitrogen), cytochrome C (Cell Signaling Technology), actin (Santa Cruz), and glyceraldehyde 3-phosphate dehydrogenase (BD Bioscience).

Homogenization:

Article Title: Reactive oxygen species regulate context-dependent inhibition of NFAT5 target genes
Article Snippet: RNA samples from kidney tissues were prepared by homogenization using TRIzol reagent (Invitrogen), phenol–chloroform extraction and isopropanol precipitation. .. The diluted cDNA was mixed with pairs of primers, including those primers for mouse aldose reductase (AR; 5′-agtgcgcattgctgagaactt-3′ and 5′-gtagctgagtagagtggccatgtc-3′), the betaine-γ-amino-butyric acid transporter (BGT-1; 5′-ctgggagagacgggttttgggtattacatc-3′ and 5′-ggaccccaggtcgtggat-3′), the sodium-dependent myo-inositol cotransporter (SMIT; 5′-ccgggcgctctatgacctggg-3′ and 5′-caaacagagaggcaccaatcg-3′), IL-6 (5′-ttccatccagttgccttcttg-3′ and 5′-aggtctgttgggagtggtatc-3′), and glyceraldehyde 3-phosphate dehydrogenase (5′-tgatgacatcaagaaggtggtgaa-3′ and 5′-tccttggaggccatgtaggccat-3′), along with cDNA sequences and SYBR Green PCR Master Mix (BD Biosciences), in a 20-μl total volume.

Saturation Assay:

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously. .. Membranes (50 µg protein) were suspended in 50 mmol/L TrisHCl (pH 7.4, 120 mmol/L MgCl2 ) and saturation assay was performed at different concentrations of [3 H] using unlabeled (10 µmol/L) to obtain specific binding.

Marker:

Article Title: Phosphodiesterase Type 5 Inhibitors Increase Herceptin Transport and Treatment Efficacy in Mouse Metastatic Brain Tumor Models
Article Snippet: .. For apoptosis detection, the membranes were probed with primary antibodies to cleaved Poly-ADP-Ribose-Polymerase (PARP), an 89-kDa PARP fragment that is considered as a marker of apoptosis, and to an internal control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; BD Pharmingen, San Diego, CA), respectively. .. Horseradish peroxidase-conjugated secondary antibodies were used for detection followed by enhanced chemiluminescence development (Bio-Rad Laboratories, Hercules, CA).

Lysis:

Article Title: Polycystin-1 Protein Level Determines Activity of the G?12/JNK Apoptosis Pathway *
Article Snippet: Cells were lysed with ice-cold lysis buffer (50 m m HEPES (pH 7.5), 1 m m EDTA, 3 m m dithiothreitol, 2 m m MgSO4 , 1% C12 E10 , and protease inhibitor mixture (Roche Diagnostics)). .. Lysates were analyzed by SDS-PAGE and Western blotting with antibodies specific for Bcl-2 (1:1000 dilution) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000 dilution) (BD Transduction Laboratories); NF-κB (1:500 dilution; Santa Cruz Biotechnology); and Bcl-xL (1:500 dilution), Akt (1:1000 dilution), and phospho-Akt Ser473 (1:500 dilution) (Cell Signaling).

Article Title: AMP-Activated Protein Kinase-Deficient Mice Are Resistant to the Metabolic Effects of Resveratrol
Article Snippet: For tissue extraction, samples were pulverized in liquid nitrogen and homogenized in a lysis buffer. .. The following antibodies were used: AMPKα (Cell Signaling Technology), p-AMPK (T172) (Cell Signaling Technology), phosphor–acetyl-CoA carboxylase (ACC), which recognizes phosphorylated Ser 79 in ACC1 or phosphorylated Ser 22 in ACC2 (Cell Signaling Technology), ACC (Cell Signaling Technology), Sirt1 (Upstate Biotechology), V5 (Invitrogen), cytochrome C (Cell Signaling Technology), actin (Santa Cruz), and glyceraldehyde 3-phosphate dehydrogenase (BD Bioscience).

Ligand Binding Assay:

Article Title: Transcriptional Regulation of Renal Dopamine D1 Receptor Function during oxidative stress
Article Snippet: Paragraph title: D1R mRNA and ligand binding ... Total RNA was isolated from HK2 cells by a RNeasy mini kit (QIAGEN) and used for cDNA synthesis and amplification of D1R and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, used as an internal control) using Advantage cDNA PCR Kit (BD Biosciences, Clonetech) as described previously.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Becton Dickinson anti bax
    Reduced CPEs in influenza virus-infected SPL cells. (A) HEK cells or SPL cells were either left uninfected (CTR) or infected with WSN virus at an MOI of 1. At 2, 3, or 4 <t>dpi,</t> cellular viability was monitored by using a trypan blue exclusion assay. The number of uninfected cells was set at 1.0, and the relative numbers of virus-infected groups were compared. Three separate wells per group were used. Values are means ± SEM. P values are included to show statistical significance. NS, no significant difference. (B) HEK cells or SPL cells were either left uninfected or infected with WSN virus at an MOI of 5. Cells were stained with annexin V at 1 dpi and were then analyzed by flow cytometry. Percentages of annexin V + cells are shown. (C and D) HEK cells or SPL cells were infected with WSN virus at an MOI of 1. Cell lysates were used for Western blot analysis to detect <t>Bax,</t> Bcl-2, and actin (C) or uncleaved PARP, cleaved PARP, and actin (D) at 1 or 2 dpi.
    Anti Bax, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti bax/product/Becton Dickinson
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti bax - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    Becton Dickinson mouse anti bax
    hBM-MSCs reduced apoptosis in QA-lesioned mice. (A–D) Confocal laser microscopic observation of immunofluorescence labeled striatal sections 8 weeks after hBM-MSC transplantation in QA-lesioned mice. Brain slides from the group with transplanted hBM-MSCs pre-labeled with bisbenzimide (B-b C-c; blue) or co-labeled with TOTO3 (A-b C-d; white) and from the QA−lesioned group (A-d, B-d D) were immunostained for the cell markers <t>caspase-3</t> (A-a; green), TUNEL (B-a; green), p-Erk1/2 (C-a D-a; green), and <t>Bax</t> (C-b D-b; red). Corresponding merged images are shown accordingly (A-c, B-c C-e). Images A-d, B-d, and D are from the QA−lesioned group, stained with the same cell markers as A-c, B-c, and C, respectively, except that the bisbenzimide labeling was substituted with DAPI staining in B-d. Scale bar = 10 µm. (E) Quantitation of caspase-3, TUNEL, p-Erk1/2, and Bax-positive cells in the hemispheres of striata from QA+transplant or QA−lesioned groups. Error bars represent SD, and * P
    Mouse Anti Bax, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti bax/product/Becton Dickinson
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    mouse anti bax - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    Image Search Results


    Reduced CPEs in influenza virus-infected SPL cells. (A) HEK cells or SPL cells were either left uninfected (CTR) or infected with WSN virus at an MOI of 1. At 2, 3, or 4 dpi, cellular viability was monitored by using a trypan blue exclusion assay. The number of uninfected cells was set at 1.0, and the relative numbers of virus-infected groups were compared. Three separate wells per group were used. Values are means ± SEM. P values are included to show statistical significance. NS, no significant difference. (B) HEK cells or SPL cells were either left uninfected or infected with WSN virus at an MOI of 5. Cells were stained with annexin V at 1 dpi and were then analyzed by flow cytometry. Percentages of annexin V + cells are shown. (C and D) HEK cells or SPL cells were infected with WSN virus at an MOI of 1. Cell lysates were used for Western blot analysis to detect Bax, Bcl-2, and actin (C) or uncleaved PARP, cleaved PARP, and actin (D) at 1 or 2 dpi.

    Journal: Journal of Virology

    Article Title: Sphingosine 1-Phosphate-Metabolizing Enzymes Control Influenza Virus Propagation and Viral Cytopathogenicity ▿

    doi: 10.1128/JVI.00510-10

    Figure Lengend Snippet: Reduced CPEs in influenza virus-infected SPL cells. (A) HEK cells or SPL cells were either left uninfected (CTR) or infected with WSN virus at an MOI of 1. At 2, 3, or 4 dpi, cellular viability was monitored by using a trypan blue exclusion assay. The number of uninfected cells was set at 1.0, and the relative numbers of virus-infected groups were compared. Three separate wells per group were used. Values are means ± SEM. P values are included to show statistical significance. NS, no significant difference. (B) HEK cells or SPL cells were either left uninfected or infected with WSN virus at an MOI of 5. Cells were stained with annexin V at 1 dpi and were then analyzed by flow cytometry. Percentages of annexin V + cells are shown. (C and D) HEK cells or SPL cells were infected with WSN virus at an MOI of 1. Cell lysates were used for Western blot analysis to detect Bax, Bcl-2, and actin (C) or uncleaved PARP, cleaved PARP, and actin (D) at 1 or 2 dpi.

    Article Snippet: At 2 or 3 days postinfection (dpi), cells were incubated with anti-Bax and anti-viral NP antibodies for 1 h and were then stained with phycoerythrin (PE)- and allophycocyanin (APC)-conjugated secondary antibodies (BD) for 1 h as described previously ( ).

    Techniques: Infection, Trypan Blue Exclusion Assay, Staining, Flow Cytometry, Cytometry, Western Blot

    Coexpression of Bax and viral NP in influenza virus-infected HEK or SPL cells. (A) HEK cells or SPL cells were either left uninfected (dotted lines) or infected (solid lines) with WSN virus at an MOI of 1. (Left) At 2 dpi, the expression of viral NP was assessed by flow cytometry. Virus-treated cells (solid lines) were separated into NP-expressing (NP + ) and nonexpressing (NP − ) cells. (Right) The Bax expression of the NP + cells (solid lines) and the NP − cells (shaded areas) was compared with that of uninfected cells (dotted lines). (B) Cells were either left uninfected (CTR) or infected with WSN at an MOI of 1. They were fixed, permeabilized, and stained with DAPI, to detect nuclei, and with antibodies against viral NP and Bax at 2 dpi. Representative confocal images are shown (original magnification, ×200). Bar, 20 μm.

    Journal: Journal of Virology

    Article Title: Sphingosine 1-Phosphate-Metabolizing Enzymes Control Influenza Virus Propagation and Viral Cytopathogenicity ▿

    doi: 10.1128/JVI.00510-10

    Figure Lengend Snippet: Coexpression of Bax and viral NP in influenza virus-infected HEK or SPL cells. (A) HEK cells or SPL cells were either left uninfected (dotted lines) or infected (solid lines) with WSN virus at an MOI of 1. (Left) At 2 dpi, the expression of viral NP was assessed by flow cytometry. Virus-treated cells (solid lines) were separated into NP-expressing (NP + ) and nonexpressing (NP − ) cells. (Right) The Bax expression of the NP + cells (solid lines) and the NP − cells (shaded areas) was compared with that of uninfected cells (dotted lines). (B) Cells were either left uninfected (CTR) or infected with WSN at an MOI of 1. They were fixed, permeabilized, and stained with DAPI, to detect nuclei, and with antibodies against viral NP and Bax at 2 dpi. Representative confocal images are shown (original magnification, ×200). Bar, 20 μm.

    Article Snippet: At 2 or 3 days postinfection (dpi), cells were incubated with anti-Bax and anti-viral NP antibodies for 1 h and were then stained with phycoerythrin (PE)- and allophycocyanin (APC)-conjugated secondary antibodies (BD) for 1 h as described previously ( ).

    Techniques: Infection, Expressing, Flow Cytometry, Cytometry, Staining

    Silencing of Nox-4 expression prevents the UPR induced by 7-Kchol. (A) Lysates of SMCs transfected with scrambled or Nox-4 siRNAs incubated with or without 40 μg of 7-Kchol/ml for 24 h were immunoblotted for CHOP/GADD 153, GRP78/Bip, and proapoptotic Bax and for antiapoptotic Bcl-2 and α-actin. (B) The relative protein content of samples was determined with an anti-α-actin antibody. The bars represent the densitometric value for each experimental condition and are representative of three separate experiments.

    Journal: Molecular and Cellular Biology

    Article Title: NAD(P)H Oxidase Nox-4 Mediates 7-Ketocholesterol-Induced Endoplasmic Reticulum Stress and Apoptosis in Human Aortic Smooth Muscle Cells

    doi: 10.1128/MCB.24.24.10703-10717.2004

    Figure Lengend Snippet: Silencing of Nox-4 expression prevents the UPR induced by 7-Kchol. (A) Lysates of SMCs transfected with scrambled or Nox-4 siRNAs incubated with or without 40 μg of 7-Kchol/ml for 24 h were immunoblotted for CHOP/GADD 153, GRP78/Bip, and proapoptotic Bax and for antiapoptotic Bcl-2 and α-actin. (B) The relative protein content of samples was determined with an anti-α-actin antibody. The bars represent the densitometric value for each experimental condition and are representative of three separate experiments.

    Article Snippet: Annexin V-fluorescein isothiocyanate (FITC), propidium iodide (PI), Z-VAD-fmk, mouse anti-GRP-78/Bip, anti-Bcl-2, anti-Bax, anti-calnexin, and anti-actin monoclonal antibodies (MAbs) were from Becton Dickinson (Le Pont de Claix, France), and mouse anti-CHOP/GADD153 MAb was from Tebu-Bio (Le Perray en Yvelines, France).

    Techniques: Expressing, Transfection, Incubation

    Pharmacological inhibition of HDAC6 restores abnormal accumulation of BAX in the mitochondria in ALS patient-derived fibroblasts. (A) Confocal images of control and patient (E1357K) fibroblasts expressing GFP-BAX stained with anti-mitochondria antibody and DAPI. Cells were treated with DMSO or 1 µM tubastatin A (Tub A) prior to immunostaining. Scale bar, 5 µm. (B) Western blot analysis of mitochondrial and cytosolic fractions from DMSO- or Tub A-treated control and patient fibroblasts using anti-BAX and anti-α-tubulin antibodies. (C) Quantitative analysis of densitometric measurements (n=3). The band intensities of BAX in each fraction were normalized to the sum of mitochondrial and cytosolic BAX intensities. Data are presented as mean±SEM. Comparisons are made with the DMSO-treated control ( * p

    Journal: Experimental Neurobiology

    Article Title: A De NovoRAPGEF2 Variant Identified in a Sporadic Amyotrophic Lateral Sclerosis Patient Impairs Microtubule Stability and Axonal Mitochondria Distribution

    doi: 10.5607/en.2018.27.6.550

    Figure Lengend Snippet: Pharmacological inhibition of HDAC6 restores abnormal accumulation of BAX in the mitochondria in ALS patient-derived fibroblasts. (A) Confocal images of control and patient (E1357K) fibroblasts expressing GFP-BAX stained with anti-mitochondria antibody and DAPI. Cells were treated with DMSO or 1 µM tubastatin A (Tub A) prior to immunostaining. Scale bar, 5 µm. (B) Western blot analysis of mitochondrial and cytosolic fractions from DMSO- or Tub A-treated control and patient fibroblasts using anti-BAX and anti-α-tubulin antibodies. (C) Quantitative analysis of densitometric measurements (n=3). The band intensities of BAX in each fraction were normalized to the sum of mitochondrial and cytosolic BAX intensities. Data are presented as mean±SEM. Comparisons are made with the DMSO-treated control ( * p

    Article Snippet: The following primary antibodies were used: anti-acetylated α-tubulin (1:1000; Sigma-Aldrich), anti-tyrosinated α-tubulin (1:1000; Millipore), anti-α-tubulin (1:1000; Sigma-Aldrich), anti-BAX (1:1000; BD, Franklin Lakes, NJ, USA), and anti-GAPDH (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA).

    Techniques: Inhibition, Derivative Assay, Expressing, Staining, Immunostaining, Western Blot

    hBM-MSCs reduced apoptosis in QA-lesioned mice. (A–D) Confocal laser microscopic observation of immunofluorescence labeled striatal sections 8 weeks after hBM-MSC transplantation in QA-lesioned mice. Brain slides from the group with transplanted hBM-MSCs pre-labeled with bisbenzimide (B-b C-c; blue) or co-labeled with TOTO3 (A-b C-d; white) and from the QA−lesioned group (A-d, B-d D) were immunostained for the cell markers caspase-3 (A-a; green), TUNEL (B-a; green), p-Erk1/2 (C-a D-a; green), and Bax (C-b D-b; red). Corresponding merged images are shown accordingly (A-c, B-c C-e). Images A-d, B-d, and D are from the QA−lesioned group, stained with the same cell markers as A-c, B-c, and C, respectively, except that the bisbenzimide labeling was substituted with DAPI staining in B-d. Scale bar = 10 µm. (E) Quantitation of caspase-3, TUNEL, p-Erk1/2, and Bax-positive cells in the hemispheres of striata from QA+transplant or QA−lesioned groups. Error bars represent SD, and * P

    Journal: PLoS ONE

    Article Title: Human Mesenchymal Stem Cells Prolong Survival and Ameliorate Motor Deficit through Trophic Support in Huntington's Disease Mouse Models

    doi: 10.1371/journal.pone.0022924

    Figure Lengend Snippet: hBM-MSCs reduced apoptosis in QA-lesioned mice. (A–D) Confocal laser microscopic observation of immunofluorescence labeled striatal sections 8 weeks after hBM-MSC transplantation in QA-lesioned mice. Brain slides from the group with transplanted hBM-MSCs pre-labeled with bisbenzimide (B-b C-c; blue) or co-labeled with TOTO3 (A-b C-d; white) and from the QA−lesioned group (A-d, B-d D) were immunostained for the cell markers caspase-3 (A-a; green), TUNEL (B-a; green), p-Erk1/2 (C-a D-a; green), and Bax (C-b D-b; red). Corresponding merged images are shown accordingly (A-c, B-c C-e). Images A-d, B-d, and D are from the QA−lesioned group, stained with the same cell markers as A-c, B-c, and C, respectively, except that the bisbenzimide labeling was substituted with DAPI staining in B-d. Scale bar = 10 µm. (E) Quantitation of caspase-3, TUNEL, p-Erk1/2, and Bax-positive cells in the hemispheres of striata from QA+transplant or QA−lesioned groups. Error bars represent SD, and * P

    Article Snippet: The antibodies used in this study include rabbit anti-DARPP-32 (D32; 1∶200; Chemicon), mouse anti-NeuN (1∶50; Chemicon), rabbit anti-GFAP (1∶300; Chemicon), rat anti-F4/80 (1∶50; Serotec), mouse anti-mitochondria (1∶200; Millipore), goat anti-doublecortin (Dcx; 1∶50; Santa Cruz), mouse anti-synaptophysin (1∶200; Chemicon), rabbit anti-laminin (1∶100; Sigma), goat anti-SDF-1 (1∶100; Santa Cruz), rabbit anti-VWF (1∶100; DAKO), rabbit anti-Cxcr4 (1∶50; Torrey Pines Biolabs), rabbit anti-caspase-3 (1∶100; Cell Signaling), rabbit anti-p-Erk1/2 (1∶100; Chemicon), and mouse anti-Bax (1∶100; BD).

    Techniques: Mouse Assay, Immunofluorescence, Labeling, Transplantation Assay, TUNEL Assay, Staining, Quantitation Assay