glyceraldehyde 3 phosphate dehydrogenase gapdh  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher glyceraldehyde 3 phosphate dehydrogenase gapdh
    Comparison of RNase expression and HIV inhibition in T h 17-polarized cells with those in T h 0-polarized cells. (A) Representative flow cytometry plots depicting IL-17 expression among T h 0-polarized, CCR6 − cells and T h 17-polarized, CCR6 + cells. SSC, side scatter. (B) Box plot showing differential gene expression between T h 0- and T h 17-polarized cells. Total RNA from T h 0- or T h 17-polarized cells was analyzed by using microarrays. Relative levels of gene expression in T h 17-polarized cells and T h 0-polarized cells are shown. (C) Thirty micrograms of total protein from cell lysates of CCR6 − , T h 0-polarized and CCR6 + , T h 17-polarized CD4 T cells from three donors was denatured and separated according to size by SDS-PAGE, transferred to a PVDF membrane, and then probed for the indicated RNase expression with anti-RNase antibodies. The loading control was glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH).</t> (D) T h 0- and T h 17-polarized CD4 T cells were infected with HIV IIIB , washed, and then resuspended in medium containing the indicated RNases. Percent inhibition was calculated from the percentage of p24 + cells, as measured by flow cytometry.
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 294 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Thermo Fisher
    Average 99 stars, based on 294 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Human Th17 Cells Lack HIV-Inhibitory RNases and Are Highly Permissive to Productive HIV Infection"

    Article Title: Human Th17 Cells Lack HIV-Inhibitory RNases and Are Highly Permissive to Productive HIV Infection

    Journal: Journal of Virology

    doi: 10.1128/JVI.02869-15

    Comparison of RNase expression and HIV inhibition in T h 17-polarized cells with those in T h 0-polarized cells. (A) Representative flow cytometry plots depicting IL-17 expression among T h 0-polarized, CCR6 − cells and T h 17-polarized, CCR6 + cells. SSC, side scatter. (B) Box plot showing differential gene expression between T h 0- and T h 17-polarized cells. Total RNA from T h 0- or T h 17-polarized cells was analyzed by using microarrays. Relative levels of gene expression in T h 17-polarized cells and T h 0-polarized cells are shown. (C) Thirty micrograms of total protein from cell lysates of CCR6 − , T h 0-polarized and CCR6 + , T h 17-polarized CD4 T cells from three donors was denatured and separated according to size by SDS-PAGE, transferred to a PVDF membrane, and then probed for the indicated RNase expression with anti-RNase antibodies. The loading control was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (D) T h 0- and T h 17-polarized CD4 T cells were infected with HIV IIIB , washed, and then resuspended in medium containing the indicated RNases. Percent inhibition was calculated from the percentage of p24 + cells, as measured by flow cytometry.
    Figure Legend Snippet: Comparison of RNase expression and HIV inhibition in T h 17-polarized cells with those in T h 0-polarized cells. (A) Representative flow cytometry plots depicting IL-17 expression among T h 0-polarized, CCR6 − cells and T h 17-polarized, CCR6 + cells. SSC, side scatter. (B) Box plot showing differential gene expression between T h 0- and T h 17-polarized cells. Total RNA from T h 0- or T h 17-polarized cells was analyzed by using microarrays. Relative levels of gene expression in T h 17-polarized cells and T h 0-polarized cells are shown. (C) Thirty micrograms of total protein from cell lysates of CCR6 − , T h 0-polarized and CCR6 + , T h 17-polarized CD4 T cells from three donors was denatured and separated according to size by SDS-PAGE, transferred to a PVDF membrane, and then probed for the indicated RNase expression with anti-RNase antibodies. The loading control was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (D) T h 0- and T h 17-polarized CD4 T cells were infected with HIV IIIB , washed, and then resuspended in medium containing the indicated RNases. Percent inhibition was calculated from the percentage of p24 + cells, as measured by flow cytometry.

    Techniques Used: Expressing, Inhibition, Flow Cytometry, Cytometry, SDS Page, Infection

    2) Product Images from "Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex"

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex

    Journal: Blood

    doi: 10.1182/blood-2012-12-471094

    Downregulation of nucleolin removes surface nucleolin and eradicates the nucleolin-Fas complex. A nucleolin-specific (906), nontargeting (nonsilencing [NS]) control, and a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) targeting short hairpin RNA miR30
    Figure Legend Snippet: Downregulation of nucleolin removes surface nucleolin and eradicates the nucleolin-Fas complex. A nucleolin-specific (906), nontargeting (nonsilencing [NS]) control, and a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) targeting short hairpin RNA miR30

    Techniques Used: shRNA

    3) Product Images from "Retinal pH and acid regulation during metabolic acidosis"

    Article Title: Retinal pH and acid regulation during metabolic acidosis

    Journal: Current eye research

    doi: 10.1080/02713683.2018.1458882

    Retinal mRNA (mean ± SEM) expression after 3, 7 and 14 days of metabolic acidosis normalized to control expression for each gene. The genes were carbonic anhydrase II and XIV (CA-II and CA-XIV), acid-sensing ion channels 1 and 4 (ASIC-1 and ASIC-IV), anion exchange protein 3 (AEP-3) and Na + /H + exchanger 1 (NHE-1). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was a control gene that was not expected to change. One asterisk: significantly different at p
    Figure Legend Snippet: Retinal mRNA (mean ± SEM) expression after 3, 7 and 14 days of metabolic acidosis normalized to control expression for each gene. The genes were carbonic anhydrase II and XIV (CA-II and CA-XIV), acid-sensing ion channels 1 and 4 (ASIC-1 and ASIC-IV), anion exchange protein 3 (AEP-3) and Na + /H + exchanger 1 (NHE-1). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was a control gene that was not expected to change. One asterisk: significantly different at p

    Techniques Used: Expressing

    4) Product Images from "The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease"

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease

    Journal: Jacc. Basic to Translational Science

    doi: 10.1016/j.jacbts.2017.03.014

    TILRR Controls IL-1RI Levels, Signal Amplification, and Gene Activity (A) Quantitative polymerase chain reaction (qPCR) of TILRR expression in raw cells, stimulated with lipopolysaccharide (LPS) (6 h) over a range of concentrations, as indicated. Data are expressed relative to levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and show mean ± SEM. n = 3.0 μg/ml LPS versus 0.1μg/ml LPS; 0 μg/ml LPS versus 1 μg/ml LPS, **p
    Figure Legend Snippet: TILRR Controls IL-1RI Levels, Signal Amplification, and Gene Activity (A) Quantitative polymerase chain reaction (qPCR) of TILRR expression in raw cells, stimulated with lipopolysaccharide (LPS) (6 h) over a range of concentrations, as indicated. Data are expressed relative to levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and show mean ± SEM. n = 3.0 μg/ml LPS versus 0.1μg/ml LPS; 0 μg/ml LPS versus 1 μg/ml LPS, **p

    Techniques Used: Amplification, Activity Assay, Real-time Polymerase Chain Reaction, Expressing

    5) Product Images from "Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer"

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer

    Journal: Molecular and Clinical Oncology

    doi: 10.3892/mco.2015.681

    The expression of the DLC-1 protein in lung tissue was evaluated by western blotting. T, cancer tissue in NSCLC; N, corresponding adjacent normal lung tissue in NSCLC. DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
    Figure Legend Snippet: The expression of the DLC-1 protein in lung tissue was evaluated by western blotting. T, cancer tissue in NSCLC; N, corresponding adjacent normal lung tissue in NSCLC. DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    Techniques Used: Expressing, Western Blot

    6) Product Images from "High expression of HEF1 is associated with poor prognosis in urinary bladder carcinoma"

    Article Title: High expression of HEF1 is associated with poor prognosis in urinary bladder carcinoma

    Journal: OncoTargets and therapy

    doi: 10.2147/OTT.S64418

    Reverse transcription-polymerase chain reaction for HEF1 expression by using HEF1-specific primers with GAPDH as an internal control. Note: Black area represents median value, the upper and lower edge represent the upper and lower quartile of the box. Abbreviations: mRNA, messenger RNA; HEF1, Human enhancer of filamentation 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
    Figure Legend Snippet: Reverse transcription-polymerase chain reaction for HEF1 expression by using HEF1-specific primers with GAPDH as an internal control. Note: Black area represents median value, the upper and lower edge represent the upper and lower quartile of the box. Abbreviations: mRNA, messenger RNA; HEF1, Human enhancer of filamentation 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    7) Product Images from "The identification of hematopoietic-specific regulatory elements for WASp gene expression"

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1038/mtm.2016.77

    The evaluation of enhancer activity in stable expression system by using lenti vectors. ( a ) Lenti-vector constructions with insertion of potential enhancers. pCL20cw650 p500hWAS/GFP vectors were used as control vectors on top panel. Middle and bottom panels are vectors with 900 bp or 1.3 kb enhancer insertion upstream of p500 WAS promoter. ( b ) Relative GFP and WAS expression in K562 cells. K562 cells were infected by various lentivirus expressing either GFP or WAS at MOI 5. On day 6 cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. The q-RT-PCR was run with triplicated samples . The error bars represent the mean ± SE (standard error). ( c ) Relative GFP or WAS expression in hCD34 cells. Human CD34 cells were transduced by various vectors at MOI 20. On day 6, cells were harvested for gDNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. ( d ) Relative WAS/GFP mRNA expression ratio from transduced control lenti-vectors. Cells with different level of endogenous WAS expression, Jurkat-T, K562, EBV WAS-, were transduced with pCL20cw650 p500hWAS and pCL20cw650 p500hGFP, On day 6, cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. The western blot of WAS protein was shown on the bottom. ( e ) Relative GFP or WAS expression in murine WAS deficient BM cells. Both Lin− and Lin+ murine BM cells were isolated and transduced by various vectors at MOI 5. On day 6, cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. BM, bone marrow; GFP, green fluorescence protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MOI, multiplicity of infection; qRT-PCR, quantitative real-time polymerase chain reaction; VCN, vector copy number; WAS, Wiskott-Aldrich Syndrome; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element.
    Figure Legend Snippet: The evaluation of enhancer activity in stable expression system by using lenti vectors. ( a ) Lenti-vector constructions with insertion of potential enhancers. pCL20cw650 p500hWAS/GFP vectors were used as control vectors on top panel. Middle and bottom panels are vectors with 900 bp or 1.3 kb enhancer insertion upstream of p500 WAS promoter. ( b ) Relative GFP and WAS expression in K562 cells. K562 cells were infected by various lentivirus expressing either GFP or WAS at MOI 5. On day 6 cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. The q-RT-PCR was run with triplicated samples . The error bars represent the mean ± SE (standard error). ( c ) Relative GFP or WAS expression in hCD34 cells. Human CD34 cells were transduced by various vectors at MOI 20. On day 6, cells were harvested for gDNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. ( d ) Relative WAS/GFP mRNA expression ratio from transduced control lenti-vectors. Cells with different level of endogenous WAS expression, Jurkat-T, K562, EBV WAS-, were transduced with pCL20cw650 p500hWAS and pCL20cw650 p500hGFP, On day 6, cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. The western blot of WAS protein was shown on the bottom. ( e ) Relative GFP or WAS expression in murine WAS deficient BM cells. Both Lin− and Lin+ murine BM cells were isolated and transduced by various vectors at MOI 5. On day 6, cells were harvested for genomic DNA and mRNA. GFP and WAS expressions were determined by q-RT-PCR using WPRE as probe, GAPDH as control. The relative expression was normalized by VCN. BM, bone marrow; GFP, green fluorescence protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MOI, multiplicity of infection; qRT-PCR, quantitative real-time polymerase chain reaction; VCN, vector copy number; WAS, Wiskott-Aldrich Syndrome; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element.

    Techniques Used: Activity Assay, Expressing, Plasmid Preparation, Infection, Reverse Transcription Polymerase Chain Reaction, Transduction, Western Blot, Isolation, Fluorescence, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    8) Product Images from "NLRP3 Inflammasome Mediates Dormant Neutrophil Recruitment following Sterile Lung Injury and Protects against Subsequent Bacterial Pneumonia in Mice"

    Article Title: NLRP3 Inflammasome Mediates Dormant Neutrophil Recruitment following Sterile Lung Injury and Protects against Subsequent Bacterial Pneumonia in Mice

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2017.01337

    Lung ischemia–reperfusion (IR) inflammation depends on the presence of the NOD-, LRR-, and pyrin domain-containing 3 (NLRP3) inflammasome in vivo . Wild-type, ASC KO, and NLRP3 KO mice (all BL/6 background) were either subjected to sham or left lung IR surgery and following 1 h of reperfusion, plasma was collected and represented cytokines and chemokine levels measured by enzyme-linked immunosorbant assay (ELISA) and presented as (A) absolute values of cytokine levels or (B) fold induction over sham. (C) Left lungs from the ASC KO and NLRP3 KO mice depicted in (A,B) were homogenized, RNA isolated, and mRNA levels measured by qPCR [normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and Actin] and presented as fold induction of interleukin (IL)-6 mRNA in IR over sham in relative quantity (RQ) units. Data in the figures are expressed as mean ± SD. Data from in vivo studies comparing two conditions were analyzed using two-tailed nonparametric Mann–Whitney analyses.
    Figure Legend Snippet: Lung ischemia–reperfusion (IR) inflammation depends on the presence of the NOD-, LRR-, and pyrin domain-containing 3 (NLRP3) inflammasome in vivo . Wild-type, ASC KO, and NLRP3 KO mice (all BL/6 background) were either subjected to sham or left lung IR surgery and following 1 h of reperfusion, plasma was collected and represented cytokines and chemokine levels measured by enzyme-linked immunosorbant assay (ELISA) and presented as (A) absolute values of cytokine levels or (B) fold induction over sham. (C) Left lungs from the ASC KO and NLRP3 KO mice depicted in (A,B) were homogenized, RNA isolated, and mRNA levels measured by qPCR [normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and Actin] and presented as fold induction of interleukin (IL)-6 mRNA in IR over sham in relative quantity (RQ) units. Data in the figures are expressed as mean ± SD. Data from in vivo studies comparing two conditions were analyzed using two-tailed nonparametric Mann–Whitney analyses.

    Techniques Used: In Vivo, Mouse Assay, Enzyme-linked Immunosorbent Assay, Isolation, Real-time Polymerase Chain Reaction, Two Tailed Test, MANN-WHITNEY

    9) Product Images from "Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands"

    Article Title: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands

    Journal: Biology of Sex Differences

    doi: 10.1186/2042-6410-2-13

    Effects of exo-mRNA fraction on reverse transcription (RT)-PCR for kallikrein 1b26 (klk1b26) mRNA and inhibition of klk1b26 translation by miRNA preparation from female submandibular glands (SMGs) . (A) Effect of exo-mRNA fraction on RT-PCR with a primer pair targeting the 5'-terminal region of klk1b26 mRNA. RT-PCR was carried out with the primer pair F21 forward and R552 reverse in the presence or absence of the exo-mRNA fraction (100 ng/μl) from male or female SMGs. (B) Quantitative determination of density of klk1b26 PCR products in Figure 4A was measured by computer-assisted image analysis (NIH image; http://rsbweb.nih.gov/nih-image/ ). Values are averages of the duplicate assay. (C, D) Inhibition of klk1b26 translation in vitro by miRNA preparation from female mouse SMGs. After the preincubation of mRNAs purified from male SMGs with miRNA preparation from male or female SMGs, the in vitro translation was performed and klk1b26 protein synthesized was analyzed as described in Methods. Representative results are shown. Similar results were obtained from three independent experiments (C). Quantitative determination of density of the [ 35 S]klk1b26 protein band. Values represent the mean ± SD (n = 3) of the relative density (D). (E) Representative autoradiograms of [ 35 S]methionine-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein on the SDS-PAGE gels. In vitro translation was performed as described in Methods. GAPDH protein was immunoprecipitated with anti-GAPDH antibody. (F) Quantitative determination of density of the [ 35 S]klk1b26 protein band. Values are the mean ± SD (n = 3) of the relative density.
    Figure Legend Snippet: Effects of exo-mRNA fraction on reverse transcription (RT)-PCR for kallikrein 1b26 (klk1b26) mRNA and inhibition of klk1b26 translation by miRNA preparation from female submandibular glands (SMGs) . (A) Effect of exo-mRNA fraction on RT-PCR with a primer pair targeting the 5'-terminal region of klk1b26 mRNA. RT-PCR was carried out with the primer pair F21 forward and R552 reverse in the presence or absence of the exo-mRNA fraction (100 ng/μl) from male or female SMGs. (B) Quantitative determination of density of klk1b26 PCR products in Figure 4A was measured by computer-assisted image analysis (NIH image; http://rsbweb.nih.gov/nih-image/ ). Values are averages of the duplicate assay. (C, D) Inhibition of klk1b26 translation in vitro by miRNA preparation from female mouse SMGs. After the preincubation of mRNAs purified from male SMGs with miRNA preparation from male or female SMGs, the in vitro translation was performed and klk1b26 protein synthesized was analyzed as described in Methods. Representative results are shown. Similar results were obtained from three independent experiments (C). Quantitative determination of density of the [ 35 S]klk1b26 protein band. Values represent the mean ± SD (n = 3) of the relative density (D). (E) Representative autoradiograms of [ 35 S]methionine-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein on the SDS-PAGE gels. In vitro translation was performed as described in Methods. GAPDH protein was immunoprecipitated with anti-GAPDH antibody. (F) Quantitative determination of density of the [ 35 S]klk1b26 protein band. Values are the mean ± SD (n = 3) of the relative density.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Inhibition, Polymerase Chain Reaction, In Vitro, Purification, Synthesized, Labeling, SDS Page, Immunoprecipitation

    10) Product Images from "The Effect of Cigarette Smoke Exposure on the Development of Inflammation in Lungs, Gut and Joints of TNFΔARE Mice"

    Article Title: The Effect of Cigarette Smoke Exposure on the Development of Inflammation in Lungs, Gut and Joints of TNFΔARE Mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0141570

    Inflammatory gene expression in lung tissue and BAL fluid of WT and TNF ΔARE mice. mRNA expression of (A) Tnf-α, (C) Tnfr1, (D) Tnfr2, (E) Ccl2, (F) Cxcl1 and (G) Cxcl2 in lung tissue of WT and TNF ΔARE mice exposed to air or CS during 2 weeks. (B) Protein levels of TNF-α in BAL fluid of WT and TNF ΔARE mice exposed to air or CS during 2 weeks. mRNA expression of (H) Tnf-α, (J) Tnfr1, (K) Tnfr2, (L) Ccl2, (M) Cxcl1 and (N) Cxcl2 in lung tissue of WT and TNF ΔARE mice exposed to air or CS during 4 weeks. (I) Protein levels of TNF-α in BAL fluid of WT and TNF ΔARE mice exposed to air or CS during 4 weeks. Expression levels are relative to the expression of 3 reference genes (hypoxanthine phosphoribosyltransferase 1 (Hprt1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transferring receptor protein 1 (Tfrc)). Values are expressed as mean ± SEM. * p
    Figure Legend Snippet: Inflammatory gene expression in lung tissue and BAL fluid of WT and TNF ΔARE mice. mRNA expression of (A) Tnf-α, (C) Tnfr1, (D) Tnfr2, (E) Ccl2, (F) Cxcl1 and (G) Cxcl2 in lung tissue of WT and TNF ΔARE mice exposed to air or CS during 2 weeks. (B) Protein levels of TNF-α in BAL fluid of WT and TNF ΔARE mice exposed to air or CS during 2 weeks. mRNA expression of (H) Tnf-α, (J) Tnfr1, (K) Tnfr2, (L) Ccl2, (M) Cxcl1 and (N) Cxcl2 in lung tissue of WT and TNF ΔARE mice exposed to air or CS during 4 weeks. (I) Protein levels of TNF-α in BAL fluid of WT and TNF ΔARE mice exposed to air or CS during 4 weeks. Expression levels are relative to the expression of 3 reference genes (hypoxanthine phosphoribosyltransferase 1 (Hprt1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transferring receptor protein 1 (Tfrc)). Values are expressed as mean ± SEM. * p

    Techniques Used: Expressing, Mouse Assay, Transferring

    11) Product Images from "Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells"

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells

    Journal: Journal of Breast Cancer

    doi: 10.4048/jbc.2017.20.3.234

    CFE inhibits TPA-induced MMP-9 expression in MCF-7 cells. (A) To assess the cytotoxicity of CFE, cells were treated with various concentrations of CFE for 24 hours. An EZ-cytox enhanced cell viability assay kit was used to detect the. (B) CFE inhibits TPA-induced MMP-9 expression in MCF-7 cells. MCF-7 cells grown in monolayer culture were treated with the indicated CFE concentrations in the presence of TPA for 24 hours. Cell lysates were analyzed by Western blot with anti-MMP-9 antibody and β-actin as a loading control. Conditioned medium was prepared and used for gelatin zymography (Zymo) to assess the effect of CFE on MMP-9 activity in MCF-7 cells. Cells were pretreated with CF for 1 hour and then stimulated with TPA for 24 hours. (C) MMP-9 mRNA levels were analyzed by RT-qPCR, and GAPDH was used as an internal control. Values are shown as mean±SEM of three independent experiments. CFE= Crotonis fructus extract; TPA=12-O-tetradecanoylphorbol-13-acetate; MMP-9=matrix metalloproteinase-9; Zymo=zymography; RT-qPCR=real-time quantitative polymerase chain reaction; GAPDH=glyceraldehyde 3-phosphate dehydrogenase; SEM=standard error of the mean. * p
    Figure Legend Snippet: CFE inhibits TPA-induced MMP-9 expression in MCF-7 cells. (A) To assess the cytotoxicity of CFE, cells were treated with various concentrations of CFE for 24 hours. An EZ-cytox enhanced cell viability assay kit was used to detect the. (B) CFE inhibits TPA-induced MMP-9 expression in MCF-7 cells. MCF-7 cells grown in monolayer culture were treated with the indicated CFE concentrations in the presence of TPA for 24 hours. Cell lysates were analyzed by Western blot with anti-MMP-9 antibody and β-actin as a loading control. Conditioned medium was prepared and used for gelatin zymography (Zymo) to assess the effect of CFE on MMP-9 activity in MCF-7 cells. Cells were pretreated with CF for 1 hour and then stimulated with TPA for 24 hours. (C) MMP-9 mRNA levels were analyzed by RT-qPCR, and GAPDH was used as an internal control. Values are shown as mean±SEM of three independent experiments. CFE= Crotonis fructus extract; TPA=12-O-tetradecanoylphorbol-13-acetate; MMP-9=matrix metalloproteinase-9; Zymo=zymography; RT-qPCR=real-time quantitative polymerase chain reaction; GAPDH=glyceraldehyde 3-phosphate dehydrogenase; SEM=standard error of the mean. * p

    Techniques Used: Expressing, Viability Assay, Western Blot, Zymography, Activity Assay, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    12) Product Images from "Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression"

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression

    Journal: The Journal of Physiology

    doi: 10.1111/j.1469-7793.1999.0331v.x

    IGF-1 enhances L-type Ca 2+ channel α1-subunit mRNA levels in single muscle cells A , 1 % agarose gel showing DNA ladder ( a ), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA fragment (448 bp; b ) and L-type Ca 2+ channel α1s cDNA fragment (1037 bp; c ). B-E, digital scanning of X-ray films illustrating the magnitude of the hybridization to the 448 and 1037 bp bands for control ( B and C ) and IGF-1-treated cells ( D and E ). Data were normalized to the hybridization signal at the GAPDH band. It is apparent that the level of L-type Ca 2+ channel α1s mRNA is higher in IGF-1-treated cells than in control.
    Figure Legend Snippet: IGF-1 enhances L-type Ca 2+ channel α1-subunit mRNA levels in single muscle cells A , 1 % agarose gel showing DNA ladder ( a ), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA fragment (448 bp; b ) and L-type Ca 2+ channel α1s cDNA fragment (1037 bp; c ). B-E, digital scanning of X-ray films illustrating the magnitude of the hybridization to the 448 and 1037 bp bands for control ( B and C ) and IGF-1-treated cells ( D and E ). Data were normalized to the hybridization signal at the GAPDH band. It is apparent that the level of L-type Ca 2+ channel α1s mRNA is higher in IGF-1-treated cells than in control.

    Techniques Used: Agarose Gel Electrophoresis, Hybridization

    13) Product Images from "Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium"

    Article Title: Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18091939

    Effects of early life exposure to cadmium on puberty onset in female offspring. Pregnant female rats were treated with cadmium (5 or 50 μg/kg bw) by i.p. injection on days 12 and 17 of gestation and the female offspring were examined. ( A ) Effect of early life exposure to cadmium on the time of vaginal opening. Pregnant female rats were treated with cadmium (5 or 50 μg/kg bw) and the female offspring were monitored for vaginal opening ( n = 17–28 offspring/group); ( B ) effect of early life exposure to cadmium on the expression of GnRH in the hypothalamus. Pregnant rats were treated with cadmium (5 μg/kg bw) and the expression of GnRH in the female offspring was determined on postnatal days 0, 5, 10, 15, 20, 25, and 30. The amount of GnRH mRNA was determined by a qRT-PCR assay and normalized to the amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (mean ± SEM; n = 2–3 offspring/group; * p
    Figure Legend Snippet: Effects of early life exposure to cadmium on puberty onset in female offspring. Pregnant female rats were treated with cadmium (5 or 50 μg/kg bw) by i.p. injection on days 12 and 17 of gestation and the female offspring were examined. ( A ) Effect of early life exposure to cadmium on the time of vaginal opening. Pregnant female rats were treated with cadmium (5 or 50 μg/kg bw) and the female offspring were monitored for vaginal opening ( n = 17–28 offspring/group); ( B ) effect of early life exposure to cadmium on the expression of GnRH in the hypothalamus. Pregnant rats were treated with cadmium (5 μg/kg bw) and the expression of GnRH in the female offspring was determined on postnatal days 0, 5, 10, 15, 20, 25, and 30. The amount of GnRH mRNA was determined by a qRT-PCR assay and normalized to the amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (mean ± SEM; n = 2–3 offspring/group; * p

    Techniques Used: Injection, Expressing, Quantitative RT-PCR

    14) Product Images from "TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells"

    Article Title: TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells

    Journal: Arthritis Research & Therapy

    doi: 10.1186/ar2038

    TWEAK/Fn14 interaction induces RANKL expression in MC3T3-E1 cells. (a) MC3T3-E1 cells were stimulated with 100 ng/ml TWEAK for the indicated times in the absence or presence of 1 μg/ml Fn14-Fc chimera, 10 μM LY2940002, or 10 μM PD98059. RNA was then extracted from the cells, and real-time PCR was performed using specific primers for RANKL and GAPDH (C, no treatment). The ratio of each gene to that of GAPDH was calculated, and the value of 1.0 was assigned to MC3T3-E1 cells that were incubated without TWEAK. (b) MC3T3-E1 cells were grown on slide chambers, stimulated with 100 ng/ml TWEAK for 24 and 48 hours, and then stained for RANKL as described in Materials and methods. RANKL-positive cells are shown in green. Goat IgG antibody was used as a negative control for the immunofluorescence staining. Fn14, fibroblast growth factor-inducible 14; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IgG, immunoglobulin G; RANKL, receptor activation of nuclear factor-κB ligand; TWEAK, tumour necrosis factor-like weak inducer of apoptosis.
    Figure Legend Snippet: TWEAK/Fn14 interaction induces RANKL expression in MC3T3-E1 cells. (a) MC3T3-E1 cells were stimulated with 100 ng/ml TWEAK for the indicated times in the absence or presence of 1 μg/ml Fn14-Fc chimera, 10 μM LY2940002, or 10 μM PD98059. RNA was then extracted from the cells, and real-time PCR was performed using specific primers for RANKL and GAPDH (C, no treatment). The ratio of each gene to that of GAPDH was calculated, and the value of 1.0 was assigned to MC3T3-E1 cells that were incubated without TWEAK. (b) MC3T3-E1 cells were grown on slide chambers, stimulated with 100 ng/ml TWEAK for 24 and 48 hours, and then stained for RANKL as described in Materials and methods. RANKL-positive cells are shown in green. Goat IgG antibody was used as a negative control for the immunofluorescence staining. Fn14, fibroblast growth factor-inducible 14; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IgG, immunoglobulin G; RANKL, receptor activation of nuclear factor-κB ligand; TWEAK, tumour necrosis factor-like weak inducer of apoptosis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Incubation, Staining, Negative Control, Immunofluorescence, Activation Assay

    TWEAK expression in bone-related cell lines and the mouse bone tissue. (a) The indicated tissues were obtained from Balb/c mice, and RNA was extracted. Real-time PCR was then performed using specific primers for TWEAK and GAPDH. The ratio of each gene to that of GAPDH was calculated, and the value of 0.1 was assigned to the brain tissue. (b) RNA was extracted from MC3T3-E1, RAW264, ATDC5, and EL4 cells, and then real-time PCR was performed using specific primers for TWEAK and GAPDH. The ratio of each gene to that of GAPDH was calculated, and the value of 0.1 was assigned to MC3T3-E1 cells. (c) Immunohistochemical examination of the mouse bone tissue. Mouse tail bone tissues from Balb/c mice were stained with anti-TWEAK antibody. Representative images of weak enlargement (upper panel) and strong enlargement (lower panel) are shown. Positive staining is indicated as brown. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction; TWEAK, tumour necrosis factor-like weak inducer of apoptosis.
    Figure Legend Snippet: TWEAK expression in bone-related cell lines and the mouse bone tissue. (a) The indicated tissues were obtained from Balb/c mice, and RNA was extracted. Real-time PCR was then performed using specific primers for TWEAK and GAPDH. The ratio of each gene to that of GAPDH was calculated, and the value of 0.1 was assigned to the brain tissue. (b) RNA was extracted from MC3T3-E1, RAW264, ATDC5, and EL4 cells, and then real-time PCR was performed using specific primers for TWEAK and GAPDH. The ratio of each gene to that of GAPDH was calculated, and the value of 0.1 was assigned to MC3T3-E1 cells. (c) Immunohistochemical examination of the mouse bone tissue. Mouse tail bone tissues from Balb/c mice were stained with anti-TWEAK antibody. Representative images of weak enlargement (upper panel) and strong enlargement (lower panel) are shown. Positive staining is indicated as brown. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction; TWEAK, tumour necrosis factor-like weak inducer of apoptosis.

    Techniques Used: Expressing, Mouse Assay, Real-time Polymerase Chain Reaction, Immunohistochemistry, Staining, Polymerase Chain Reaction

    15) Product Images from "Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers"

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/cei.12325

    Comparison of miR-199a-5p and hypoxia-inducible factor (HIF)-1α expression between chronic obstructive pulmonary disease (COPD) and controls. Figures (a) and (c) depict relative expression (RQ) plot, based on ΔΔCT obtained from real-time reverse transcription–polymerase chain reaction (RT–PCR), showing fold change in expression of miR-199a-5p and HIF-1α in regulatory T cells (T reg ) in the three groups referenced to healthy non-smokers ( n = 35; 12 healthy non-smokers, 12 healthy smokers and 11 COPD patients). miR-199a-5p and HIF-1α were normalized to expression of endogenous control RNU48 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), respectively. The COPD group had one less subject because his RNA sample ran out after running the microarray. (b) Significant under-expression of HIF-1α in regulatory T cells (T reg ) compared to T effector (T eff ) cells (mean ± standard error of the mean).
    Figure Legend Snippet: Comparison of miR-199a-5p and hypoxia-inducible factor (HIF)-1α expression between chronic obstructive pulmonary disease (COPD) and controls. Figures (a) and (c) depict relative expression (RQ) plot, based on ΔΔCT obtained from real-time reverse transcription–polymerase chain reaction (RT–PCR), showing fold change in expression of miR-199a-5p and HIF-1α in regulatory T cells (T reg ) in the three groups referenced to healthy non-smokers ( n = 35; 12 healthy non-smokers, 12 healthy smokers and 11 COPD patients). miR-199a-5p and HIF-1α were normalized to expression of endogenous control RNU48 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), respectively. The COPD group had one less subject because his RNA sample ran out after running the microarray. (b) Significant under-expression of HIF-1α in regulatory T cells (T reg ) compared to T effector (T eff ) cells (mean ± standard error of the mean).

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Microarray

    Effects of miR-199a-5p inhibition on transforming growth factor (TGF)-β pathway in CCD-986Sk cells. (a) Western blot analysis of miR-199a-5p locked nucleic acid (LNA)-transfected CCD-986Sk cells treated with TGF-β compared to Lipofectamine control and negative control show no difference in pSmad2 expression when normalized to Smad2 ( P = 0·92). The same was noted when pSmad2 was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± standard deviation, n = 3. (b) Relative expression (RQ) plot obtained from the Taqman TGF-β array plate analysis of the pooled RNA of LNA-transfected CCD-986Sk cells showing fold change of genes that were overexpressed by > 20% versus negative control ( n = 3).
    Figure Legend Snippet: Effects of miR-199a-5p inhibition on transforming growth factor (TGF)-β pathway in CCD-986Sk cells. (a) Western blot analysis of miR-199a-5p locked nucleic acid (LNA)-transfected CCD-986Sk cells treated with TGF-β compared to Lipofectamine control and negative control show no difference in pSmad2 expression when normalized to Smad2 ( P = 0·92). The same was noted when pSmad2 was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± standard deviation, n = 3. (b) Relative expression (RQ) plot obtained from the Taqman TGF-β array plate analysis of the pooled RNA of LNA-transfected CCD-986Sk cells showing fold change of genes that were overexpressed by > 20% versus negative control ( n = 3).

    Techniques Used: Inhibition, Western Blot, Transfection, Negative Control, Expressing, Standard Deviation

    16) Product Images from "Aldosterone induces inflammatory cytokines in penile corpus cavernosum by activating the NF-κB pathway"

    Article Title: Aldosterone induces inflammatory cytokines in penile corpus cavernosum by activating the NF-κB pathway

    Journal: Asian Journal of Andrology

    doi: 10.4103/aja.aja_8_17

    The canonical nuclear factor (NF)-kappa B pathway is activated after aldosterone (Aldo) treatment. ( a ) Protein markers of NF-κB activation were detected by immunoblot analysis of freshly isolated penile corpus cavernosum tissues. ( b ) In the nuclear fraction of isolated penile corpus cavernosum tissues, p65 protein was increased in the experimental groups compared with dimethylsulfoxide vehicle control. In the cytosolic fraction, phosphorylation of inhibitor of NF-κB alpha (IκB-α) displayed a sharp increase and subsequently declined after aldosterone or tumor necrosis factor-alpha (TNF-α, 20 ng ml −1 ) treatment. DMSO: dimethylsulfoxide; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
    Figure Legend Snippet: The canonical nuclear factor (NF)-kappa B pathway is activated after aldosterone (Aldo) treatment. ( a ) Protein markers of NF-κB activation were detected by immunoblot analysis of freshly isolated penile corpus cavernosum tissues. ( b ) In the nuclear fraction of isolated penile corpus cavernosum tissues, p65 protein was increased in the experimental groups compared with dimethylsulfoxide vehicle control. In the cytosolic fraction, phosphorylation of inhibitor of NF-κB alpha (IκB-α) displayed a sharp increase and subsequently declined after aldosterone or tumor necrosis factor-alpha (TNF-α, 20 ng ml −1 ) treatment. DMSO: dimethylsulfoxide; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

    Techniques Used: Activation Assay, Isolation

    Related Articles

    Clone Assay:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: This fragment has a very low homology with other clones expressed in skeletal muscle according to database sequence analyses using the Wisconsin package software (Wisconsin, Madison, WI, USA). .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: Plasmids encoding C-terminal myc- and FLAG (DDK)-tagged nucleolin, pCMV6-Nucleolin (TrueORF complementary DNA clones), and the vector control pCMV-ENTRY (Origene), were used for transfections. .. To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations.

    Amplification:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: Paragraph title: Single cell antisense RNA amplification ... The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers
    Article Snippet: For HIF-1α, 50 ng of starting RNA was used for the Taqman qRT–PCR, normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Applied Biosystems). .. Forty cycles of amplification were used and data acquisition was carried out with StepOnePlus Real-Time PCR systems (Applied Biosystems).

    Article Title: Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium
    Article Snippet: For ERα, Aldh1, telomerase, Six1, keratin 15, keratin 8, Greb1, Areg, progesterone receptor, Arbp, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the primer and probe sets were obtained from Applied Biosystems and spanned exon–exon boundaries. .. For the ERα 5′UTRs, the primer and probe sets were designed to span exon–exon boundaries and produce an amplicon between 100 and 200 bp.

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR. .. DLC-1 was amplified on the same plate under the control of GAPDH, using the Eva QPCR SuperMix kit (BioChain).

    Article Title: High expression of HEF1 is associated with poor prognosis in urinary bladder carcinoma
    Article Snippet: The amplification protocol was used as follows: denatured at 95°C for 4 minutes; and then followed by 40 cycles of 95°C for 10 seconds, 55°C for 20 seconds, and 72°C for 20 seconds. .. The sequence of the primers used for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was 5′-TGA AGG TCG GAG TCA ACG G-3′ (forward) and 5′-CTG GAA GAT GGT GAT GGG ATT-3′ (reverse; Thermo Fisher Scientific).

    Synthesized:

    Article Title: The Effect of Cigarette Smoke Exposure on the Development of Inflammation in Lungs, Gut and Joints of TNFΔARE Mice
    Article Snippet: Subsequently, cDNA was synthesized by reverse transcription using the iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Nazareth, Belgium) following the manufacturer’s instructions. cDNA from total lung RNA was prepared using Transcriptor First strand cDNA synthesis kit (Roche Diagnostics, Basel, Switzerland). .. In lungs, expression of target genes Tnf-α, Tnfr1 and Tnfr2, Cxcl1/Kc, Ccl2/Mcp-1, Cxcl2/Mip-2 and reference genes Hypoxanthine-guanine phosphoribosyltransferase (Hprt1), Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) and Transferrin receptor (Tfrc) was measured using TaqMan Gene Expression assays (Applied BioSystems, Forster City, CA, USA).

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: The cDNA was synthesized from 1 µg total RNA by using the PrimeScript™ RT reagent kit (TaKaRa, Shiga, Japan). .. The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA).

    Quantitative RT-PCR:

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers
    Article Snippet: .. For HIF-1α, 50 ng of starting RNA was used for the Taqman qRT–PCR, normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Applied Biosystems). ..

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: Paragraph title: RNA isolation and qRT-PCR ... The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany).

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies) ..

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: DLC-1 mRNA expression was evaluated by reverse transcription (RT)-qPCR. .. Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR.

    Real-time Polymerase Chain Reaction:

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers
    Article Snippet: Paragraph title: Validating potential miRNA and mRNA by real-time PCR ... For HIF-1α, 50 ng of starting RNA was used for the Taqman qRT–PCR, normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Applied Biosystems).

    Article Title: NLRP3 Inflammasome Mediates Dormant Neutrophil Recruitment following Sterile Lung Injury and Protects against Subsequent Bacterial Pneumonia in Mice
    Article Snippet: .. Quantitative Reverse Transcription Real-time Polymerase Chain Reaction TaqMan-specific inventoried gene primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta actin, interleukin (IL)-6, were used to measure the message levels of these genes in lung tissue (Life Technologies, Carlsbad, CA, USA). .. Lung tissue was homogenized (Tissue-Tearor) and total RNA isolated using Trizol® .

    Article Title: The Effect of Cigarette Smoke Exposure on the Development of Inflammation in Lungs, Gut and Joints of TNFΔARE Mice
    Article Snippet: Paragraph title: Quantitative real-time PCR ... In lungs, expression of target genes Tnf-α, Tnfr1 and Tnfr2, Cxcl1/Kc, Ccl2/Mcp-1, Cxcl2/Mip-2 and reference genes Hypoxanthine-guanine phosphoribosyltransferase (Hprt1), Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) and Transferrin receptor (Tfrc) was measured using TaqMan Gene Expression assays (Applied BioSystems, Forster City, CA, USA).

    Article Title: Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium
    Article Snippet: For the real-time polymerase chain reaction, each 10 μL reaction contained 5 μL of Sensimix II Probe Mastermix (Bioline, Cincinnati, OH, USA), 0.5 μL of 20× Assay on Demand (Applied Biosystems) and 4.5 μL of cDNA; or 5 μL of Sensimix SYBR (Bioline), 0.25 μL of 20 μM forward or reverse primer, and 4.5 μL of cDNA. .. For ERα, Aldh1, telomerase, Six1, keratin 15, keratin 8, Greb1, Areg, progesterone receptor, Arbp, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the primer and probe sets were obtained from Applied Biosystems and spanned exon–exon boundaries.

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany). .. The PCR assays were done using a real time PCR system (CFX384, Bio-Rad, Hercules, California, U.S.A) with the following cycling conditions: 50° C for 2 min, 95° C for 10 min, 40 cycles of 95° C for 15 sec and 60° C for 1 min.

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Paragraph title: qPCR and qRT-PCR for VCN and gene expression ... The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Article Title: TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells
    Article Snippet: Paragraph title: Quantitative real-time PCR ... Primers and probes for mouse RANKL (receptor activation of nuclear factor-κB ligand), mouse TWEAK, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Applied Biosystems.

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction ... The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA).

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: .. Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR. .. DLC-1 was amplified on the same plate under the control of GAPDH, using the Eva QPCR SuperMix kit (BioChain).

    Article Title: High expression of HEF1 is associated with poor prognosis in urinary bladder carcinoma
    Article Snippet: Paragraph title: Real-time polymerase chain reaction analysis ... The sequence of the primers used for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was 5′-TGA AGG TCG GAG TCA ACG G-3′ (forward) and 5′-CTG GAA GAT GGT GAT GGG ATT-3′ (reverse; Thermo Fisher Scientific).

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: .. One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific). .. Venous blood samples taken sequentially from patients on the day of presentation (day 1) and days 7 and 90 following ST-segment elevation myocardial infarction (STEMI) or non–ST-segment elevation myocardial infarction (NSTEMI), and venous blood samples from healthy volunteers were screened for TILRR expression, using an N-terminal probe (Thermo Fisher Scientific).

    Incubation:

    Article Title: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands
    Article Snippet: In vitro translations of klk1b26 protein and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with reticulocyte lysate Protein synthesis by in vitro translation with a reticulocyte lysate system was carried out by using a Retic Lysate IVT for in vitro translation of mRNA (Ambion). .. Messenger RNA (500 ng) purified from male SMGs in an 11.2 μl translation mixture containing 1.4 μl of [35 S]methionine (no. NEG709A; Perkin Elmer, Waltham, MA, USA) was mixed with 23.8 μl of reticulocyte lysate and incubated for 2 h at 30°C.

    Article Title: Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium
    Article Snippet: For the RT reaction, Taqman RT Buffer, dNTPs, RNase inhibitor, MultiScribe reverse transcriptase (Applied Biosystems, Foster City, CA, USA, and RNA were incubated in the thermal cycler for 10 min at 25 °C, 30 min at 48 °C, and 5 min at 95 °C. .. For ERα, Aldh1, telomerase, Six1, keratin 15, keratin 8, Greb1, Areg, progesterone receptor, Arbp, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the primer and probe sets were obtained from Applied Biosystems and spanned exon–exon boundaries.

    Article Title: Human Th17 Cells Lack HIV-Inhibitory RNases and Are Highly Permissive to Productive HIV Infection
    Article Snippet: Protein from the gel was transferred to polyvinylidene difluoride (PVDF) membranes (Life Technologies), blocked with a 5% (wt/vol) solution of powdered milk, washed, and then incubated at 4°C overnight in the presence of anti-human RNase antibodies (Abnova Inc., Taipei, Taiwan). .. As a loading control, blots were also probed with an HRP-conjugated antibody to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ThermoFisher Scientific Inc., Rockville, MD).

    Article Title: TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells
    Article Snippet: Primers and probes for mouse RANKL (receptor activation of nuclear factor-κB ligand), mouse TWEAK, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Applied Biosystems. .. The ratio of each gene to that of GAPDH was calculated, and the value of 1.0 was assigned to cells that were incubated without transforming growth factor (TGF)-β1 or TWEAK.

    Transfection:

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: .. To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations. .. Transfected cells were selected with 1 µg/mL of puromycin (Sigma Aldrich) for 2 weeks.

    Expressing:

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers
    Article Snippet: .. For HIF-1α, 50 ng of starting RNA was used for the Taqman qRT–PCR, normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Applied Biosystems). ..

    Article Title: The Effect of Cigarette Smoke Exposure on the Development of Inflammation in Lungs, Gut and Joints of TNFΔARE Mice
    Article Snippet: .. In lungs, expression of target genes Tnf-α, Tnfr1 and Tnfr2, Cxcl1/Kc, Ccl2/Mcp-1, Cxcl2/Mip-2 and reference genes Hypoxanthine-guanine phosphoribosyltransferase (Hprt1), Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) and Transferrin receptor (Tfrc) was measured using TaqMan Gene Expression assays (Applied BioSystems, Forster City, CA, USA). .. Quantitative real-time PCR was performed in duplicate using 10 ng cDNA with a LightCycler96 detection system (Roche Diagnostics).

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Paragraph title: qPCR and qRT-PCR for VCN and gene expression ... The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations. .. Cells were subsequently sorted for green fluorescent protein expression using an Aria flow-activated cell sorter (BD Biosciences).

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: DLC-1 mRNA expression was evaluated by reverse transcription (RT)-qPCR. .. Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR.

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific). .. Venous blood samples taken sequentially from patients on the day of presentation (day 1) and days 7 and 90 following ST-segment elevation myocardial infarction (STEMI) or non–ST-segment elevation myocardial infarction (NSTEMI), and venous blood samples from healthy volunteers were screened for TILRR expression, using an N-terminal probe (Thermo Fisher Scientific).

    Modification:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: The cDNA encoding the L-type Ca2+ channel α1-subunit ( ; ) was subcloned into the transcription competent vector pAGA2 (modified pGEM3) ( ; ), which was linearized with Hin dIII. .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Hybridization:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: A fragment of 1037 bp corresponding to the α1-subunit domain I was obtained with Eco RI digestion and used for hybridization onto nylon membranes (see below). .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Flow Cytometry:

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations. .. Cells were subsequently sorted for green fluorescent protein expression using an Aria flow-activated cell sorter (BD Biosciences).

    Concentration Assay:

    Article Title: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands
    Article Snippet: In vitro translations of klk1b26 protein and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with reticulocyte lysate Protein synthesis by in vitro translation with a reticulocyte lysate system was carried out by using a Retic Lysate IVT for in vitro translation of mRNA (Ambion). .. When the effects of miRNA preparations from SMGs were examined, the mRNA (500 ng) purified from male SMGs was preincubated with miRNA preparations from male or female SMGs (final concentration of 90 or 30 ng/ml each for Figure , and of 90 ng/ml each for Figure ) for 30 min at 4°C in a 11.2 μl translation mixture containing [35 S]methionine (no. NEG709A; Perkin Elmer, Waltham, MA, USA).

    Northern Blot:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA). .. Membranes resulting from antisense RNA/cDNA reverse Northern blots of control and IGF-1-treated cells were exposed simultaneously to the same X-ray film for 48 h and digitally scanned.

    Cell Culture:

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: Extracted and cultured bone marrow–derived macrophages were lysed using Buffer RLT and total RNA isolated using RNeasy kit (Qiagen). .. One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific).

    Polymerase Chain Reaction:

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: Real time polymerase chain reactions (RT-PCR) were done with a TaqMan® probe-based detection kit (TaqMan® PCR universal mastermix, Applied Biosystems, Darmstadt, Germany). .. The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany).

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: .. Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR. .. DLC-1 was amplified on the same plate under the control of GAPDH, using the Eva QPCR SuperMix kit (BioChain).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: Real time polymerase chain reactions (RT-PCR) were done with a TaqMan® probe-based detection kit (TaqMan® PCR universal mastermix, Applied Biosystems, Darmstadt, Germany). .. The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany).

    Injection:

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: qPCR analysis RNA was prepared from extracted spleen tissue from TILRR–/– and wild-type mice, injected with LPS (10 mg/kg, Enzo Life Sciences), as described previously. .. One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific).

    TaqMan Assay:

    Article Title: Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers
    Article Snippet: For miR-199a-5p, 10 ng of RNA was used in a TaqMan assay (Applied Biosystems), as per the manufacturer's protocol, to confirm the differential expression normalized to expression of endogenous control RNU48. .. For HIF-1α, 50 ng of starting RNA was used for the Taqman qRT–PCR, normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Applied Biosystems).

    DNA Extraction:

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: qPCR and qRT-PCR for VCN and gene expression Proviral copy number was determined using qRT-PCR on genomic DNA samples prepared using the Gentra genomic DNA Isolation Kit (Qiagen, Valencia, CA). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Mutagenesis:

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: Partial nucleolin mutants and corresponding DNA primers (Sigma Aldrich) (supplemental ) were designed according to the manufacturer’s protocol for Quick Change II XL site-directed mutagenesis (Stratagene, Cedar Creek, TX) using pCMV6-Nucleolin as a template. .. To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations.

    Isolation:

    Article Title: NLRP3 Inflammasome Mediates Dormant Neutrophil Recruitment following Sterile Lung Injury and Protects against Subsequent Bacterial Pneumonia in Mice
    Article Snippet: Quantitative Reverse Transcription Real-time Polymerase Chain Reaction TaqMan-specific inventoried gene primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta actin, interleukin (IL)-6, were used to measure the message levels of these genes in lung tissue (Life Technologies, Carlsbad, CA, USA). .. Lung tissue was homogenized (Tissue-Tearor) and total RNA isolated using Trizol® .

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: Paragraph title: RNA isolation and qRT-PCR ... The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany).

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: RNA was prepared using a RNA isolation kit (Qiagen). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: Quantitative real-time polymerase chain reaction Total RNA was isolated using TRIzol® Reagent (Life Technologies, Grand Island, USA). .. The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA).

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: Extracted and cultured bone marrow–derived macrophages were lysed using Buffer RLT and total RNA isolated using RNeasy kit (Qiagen). .. One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific).

    Size-exclusion Chromatography:

    Article Title: Retinal pH and acid regulation during metabolic acidosis
    Article Snippet: The following FAM-primers were used: Carbonic Anhydrase II, Car2, #Rn01462065_m1; Carbonic Anhydrase XIV, Car14, #Rn01534442_m1; Acid Sensing Ion Channel 1, ASIC1,#Rn00577292_m1; Acid Sensing Ion Channel 4, ASIC4, #Rn01637758_m1; Anion Exchange Protein-3, Slc4a3, #Rn00436642_m1; Sodium/Hydrogen Exchanger-1, Slc9a1, #Rn00561924_m1 and Glyceraldehyde 3-phosphate dehydrogenase GAPDH, Gapdh, #Rn01775763_g1, all from Applied Biosystems, (Darmstadt, Germany). .. The PCR assays were done using a real time PCR system (CFX384, Bio-Rad, Hercules, California, U.S.A) with the following cycling conditions: 50° C for 2 min, 95° C for 10 min, 40 cycles of 95° C for 15 sec and 60° C for 1 min.

    Purification:

    Article Title: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands
    Article Snippet: In vitro translations of klk1b26 protein and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with reticulocyte lysate Protein synthesis by in vitro translation with a reticulocyte lysate system was carried out by using a Retic Lysate IVT for in vitro translation of mRNA (Ambion). .. Messenger RNA (500 ng) purified from male SMGs in an 11.2 μl translation mixture containing 1.4 μl of [35 S]methionine (no. NEG709A; Perkin Elmer, Waltham, MA, USA) was mixed with 23.8 μl of reticulocyte lysate and incubated for 2 h at 30°C.

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific). .. RNA was purified from human blood stored in Tempus tubes using Maxwell 16 miRNA Blood Kit (Promega) and the Maxwell 16 Instrument (Promega) as per manufacturer’s instructions.

    Sequencing:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: This fragment has a very low homology with other clones expressed in skeletal muscle according to database sequence analyses using the Wisconsin package software (Wisconsin, Madison, WI, USA). .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Article Title: NLRP3 Inflammasome Mediates Dormant Neutrophil Recruitment following Sterile Lung Injury and Protects against Subsequent Bacterial Pneumonia in Mice
    Article Snippet: Quantitative Reverse Transcription Real-time Polymerase Chain Reaction TaqMan-specific inventoried gene primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta actin, interleukin (IL)-6, were used to measure the message levels of these genes in lung tissue (Life Technologies, Carlsbad, CA, USA). .. Quantitative real-time polymerase chain reaction was performed using the ABI Prism 7000 Sequence Detection System (Life Technologies).

    Article Title: Alteration of Mammary Gland Development and Gene Expression by In Utero Exposure to Cadmium
    Article Snippet: For ERα, Aldh1, telomerase, Six1, keratin 15, keratin 8, Greb1, Areg, progesterone receptor, Arbp, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the primer and probe sets were obtained from Applied Biosystems and spanned exon–exon boundaries. .. The sequence of the primers and probes and the size of the amplicon are as follows: For exon E1, forward E1: 5′-CTGCGCTGAGCCTCTTTTAAC-3′; reverse E1: CGGATGAGCCACCTGGAA, TaqMan® probe: TCGGGCTCTACTCTT, and amplicon size 114 bp.

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Each sample was assayed for the vector sequence (Fwd 5′CCTCAGACCCTTTTAGTCAGTGT3′, Rev 5′CTTTCGCTTTCAAGTCCCTGTTC3′ Probe 5′6FAMCCACTGCTAGAGATTTTMGBNFQ3 ′) and as a control assay detecting RNase P (cat#4403328, Life technologies). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: .. The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA). ..

    Article Title: Identification of DLC-1 expression and methylation status in patients with non-small-cell lung cancer
    Article Snippet: .. Following the RT reaction, sequence-specific PCR primers ( ) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR. .. DLC-1 was amplified on the same plate under the control of GAPDH, using the Eva QPCR SuperMix kit (BioChain).

    Article Title: High expression of HEF1 is associated with poor prognosis in urinary bladder carcinoma
    Article Snippet: .. The sequence of the primers used for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was 5′-TGA AGG TCG GAG TCA ACG G-3′ (forward) and 5′-CTG GAA GAT GGT GAT GGG ATT-3′ (reverse; Thermo Fisher Scientific). ..

    shRNA:

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: .. To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations. .. Transfected cells were selected with 1 µg/mL of puromycin (Sigma Aldrich) for 2 weeks.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Each sample was assayed for the vector sequence (Fwd 5′CCTCAGACCCTTTTAGTCAGTGT3′, Rev 5′CTTTCGCTTTCAAGTCCCTGTTC3′ Probe 5′6FAMCCACTGCTAGAGATTTTMGBNFQ3 ′) and as a control assay detecting RNase P (cat4403328, Life technologies). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Mouse Assay:

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: qPCR analysis RNA was prepared from extracted spleen tissue from TILRR–/– and wild-type mice, injected with LPS (10 mg/kg, Enzo Life Sciences), as described previously. .. One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific).

    Plasmid Preparation:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: The cDNA encoding the L-type Ca2+ channel α1-subunit ( ; ) was subcloned into the transcription competent vector pAGA2 (modified pGEM3) ( ; ), which was linearized with Hin dIII. .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Each sample was assayed for the vector sequence (Fwd 5′CCTCAGACCCTTTTAGTCAGTGT3′, Rev 5′CTTTCGCTTTCAAGTCCCTGTTC3′ Probe 5′6FAMCCACTGCTAGAGATTTTMGBNFQ3 ′) and as a control assay detecting RNase P (cat#4403328, Life technologies). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Article Title: Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex
    Article Snippet: Plasmids encoding C-terminal myc- and FLAG (DDK)-tagged nucleolin, pCMV6-Nucleolin (TrueORF complementary DNA clones), and the vector control pCMV-ENTRY (Origene), were used for transfections. .. To produce the nucleolin partial knockdown (pKO) BJAB cells, lentiviral pGIPZ plasmids (1.2 μg) (Open Biosystems – Thermo Scientific) encoding green fluorescent protein and one of the following short hairpin RNA expressed as microRNA-30 transcripts (miR30): nonsilencing, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or nucleolin, were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s recommendations.

    Software:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: This fragment has a very low homology with other clones expressed in skeletal muscle according to database sequence analyses using the Wisconsin package software (Wisconsin, Madison, WI, USA). .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA).

    Article Title: The IL-1RI Co-Receptor TILRR (FREM1 Isoform 2) Controls Aberrant Inflammatory Responses and Development of Vascular Disease
    Article Snippet: One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) (Applied Biosystems) and 1 μl was added to standard Taqman qPCR reaction (Applied Biosystems) containing relevant TaqMan MGB probes (murine probes): glyceraldehyde 3-phosphate dehydrogenase (GAPDH), chemokine ligand 2 (CCL2), C-X3-C motif chemokine ligand 1 (CX3CL1), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 (Thermo Fisher Scientific). .. Results were analyzed by RQ Manager analysis software (Thermo Fisher Scientific).

    SYBR Green Assay:

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: .. The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA). ..

    RNA Expression:

    Article Title: Crotonis Fructus Extract Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Expression of Matrix Metalloproteinase-9 via the Activator Protein-1 Pathway in MCF-7 Cells
    Article Snippet: .. The RNA expression levels of MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined using the ABI PRISM 7900 sequence detection system and SYBR® Green (Applied Biosystems, Foster City, USA). ..

    Agarose Gel Electrophoresis:

    Article Title: Insulin-like growth factor-1 enhances rat skeletal muscle charge movement and L-type Ca2+ channel gene expression
    Article Snippet: .. The L-type Ca2+ channel α1s-subunit together with a 448 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) clone (Ambion Inc., Austin, TX, USA) were run on a 1 % agarose gel and transferred to Magnacharge nylon membranes (MSI, Westborough, MA, USA). .. Membranes were hybridized with the labelled probes in Church buffer (7 % of 20 % SDS, 0·25 M NaH2 PO4 , 0·25 M Na2 HPO4 and 1 mM EDTA) overnight at 52°C in a hybridization oven.

    In Vitro:

    Article Title: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands
    Article Snippet: .. In vitro translations of klk1b26 protein and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with reticulocyte lysate Protein synthesis by in vitro translation with a reticulocyte lysate system was carried out by using a Retic Lysate IVT for in vitro translation of mRNA (Ambion). .. Messenger RNA (500 ng) purified from male SMGs in an 11.2 μl translation mixture containing 1.4 μl of [35 S]methionine (no. NEG709A; Perkin Elmer, Waltham, MA, USA) was mixed with 23.8 μl of reticulocyte lysate and incubated for 2 h at 30°C.

    Activation Assay:

    Article Title: TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells
    Article Snippet: .. Primers and probes for mouse RANKL (receptor activation of nuclear factor-κB ligand), mouse TWEAK, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Applied Biosystems. .. The ratio of each gene to that of GAPDH was calculated, and the value of 1.0 was assigned to cells that were incubated without transforming growth factor (TGF)-β1 or TWEAK.

    Control Assay:

    Article Title: The identification of hematopoietic-specific regulatory elements for WASp gene expression
    Article Snippet: Each sample was assayed for the vector sequence (Fwd 5′CCTCAGACCCTTTTAGTCAGTGT3′, Rev 5′CTTTCGCTTTCAAGTCCCTGTTC3′ Probe 5′6FAMCCACTGCTAGAGATTTTMGBNFQ3 ′) and as a control assay detecting RNase P (cat#4403328, Life technologies). .. The relative RNA level of GFP or WASp was determined by qRT-PCR using the WPRE probe (WPRE-F 5′ CCCGTTGTCAGGCAACGTGGC 3′, WPRE-R 5′ GAGCTGACAGGTGGTGGCAA 3′, the probe WPRE Probe 5′ FAM TGCTGACGCAACCCCCACTGGT TAMRA3′) and control primers for detecting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Life technologies)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher gene exp gapdh mm99999915 g1
    Analysis of Dll4-mCherry, Dll1-mCherry, and Jag1-mCherry reporter animals. a , Reverse-transcription PCR of Dll4, Dll1 and Jag1 in vascular cells (red), perivascular LEPR + cells (purple) and osteoblasts (blue), normalized to <t>Gapdh</t> ( n = 4 mice). b , Low-magnification immunofluorescence images of thymus sections from Dll4-mCherry, Dll1-mCherry and Jag1-mCherry mice. c , Representative flow cytometry, measuring mCherry fluorescence in total bone marrow of Dll4-mCherry, Dll1-mCherry and JAG1-mCherry mice. Indicated values represent percentages of the complete CD144 + and mCherry + CD144 − populations. Cells were pre-gated on DAPI − cells. d , Representative mCherry levels in DAPI − CD45 low TER119 low CD144 + bone marrow endothelial cells from Dll4-mCherry (red) ( n = 4), Dll1-mCherry (blue) ( n = 3), Jag1-mCherry (black) ( n = 4) and control (grey) ( n = 5) mice. e, f , Representative immunofluorescence metaphysis and diaphysis of Dll4-mCherry ( e ) and Dll1-mCherry ( f ) bone marrow ( n = 3 mice). mCherry (red) and LAMA1 (blue). g, h , Representative two-photon images of bone marrow from intact (left) or dextran-injected (right) Dll4-mCherry ( g ) and Dll1-mCherry ( h ) mice ( n = 3 mice). i , Normalized counts of key differentially expressed genes from bulk RNA-seq performed on CD144 − DLL1 + cells (purple) (from n = 2 mice) and CD144 + DLL1 + cells (black) (from n = 2 mice). j , Representative flow cytometry histogram measuring mCherry fluorescence in NK1.1 + population from Dll1-mCherry (pink) and control (black) mice ( n = 3 mice). The data are mean ± s.d. N.S., not significant, * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, Student’s t -test, two-tailed. Data are representative of two ( a, e–h, j ) or three ( b–d ) independent experiments.
    Gene Exp Gapdh Mm99999915 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 986 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh mm99999915 g1/product/Thermo Fisher
    Average 92 stars, based on 986 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh mm99999915 g1 - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher sirnas
    Modulation of tetraspanins by <t>siRNA</t> reduces meningococcal adherence to HEC-1-B epithelial cells. HEC-1-B cells were incubated in either medium alone or a variety of <t>siRNAs</t> (nontargeting siRNAs, glyceraldehyde-3-phosphate dehydrogenase [GAPD], CD9, CD63,
    Sirnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirnas/product/Thermo Fisher
    Average 99 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    sirnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher gene exp gapdh hs02758991 g1
    Non-esterified fatty acid (NEFA) release in human subcutaneous adipocytes: a Adipocytes purchased from ZenBio were incubated with increasing concentrations (1 pM–10 μM) of positive control isoproterenol (EC 50 = 1.46 ± 0.34 nM), ACTH, α-MSH, PG-901 and LY2112688 (n = 4). NEFA release was measured as described. Experiments were carried out in duplicates. Data are shown as average values ± SEM. b MC1-5R and <t>GAPDH</t> mRNA expression was measured in same adipocytes (n = 3 pooled). cDNA was synthesized and mRNA levels determined by standard PCR (cDNA 1:10 from 1 μg RNA, 45 cycles)
    Gene Exp Gapdh Hs02758991 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 503 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02758991 g1/product/Thermo Fisher
    Average 92 stars, based on 503 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02758991 g1 - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of Dll4-mCherry, Dll1-mCherry, and Jag1-mCherry reporter animals. a , Reverse-transcription PCR of Dll4, Dll1 and Jag1 in vascular cells (red), perivascular LEPR + cells (purple) and osteoblasts (blue), normalized to Gapdh ( n = 4 mice). b , Low-magnification immunofluorescence images of thymus sections from Dll4-mCherry, Dll1-mCherry and Jag1-mCherry mice. c , Representative flow cytometry, measuring mCherry fluorescence in total bone marrow of Dll4-mCherry, Dll1-mCherry and JAG1-mCherry mice. Indicated values represent percentages of the complete CD144 + and mCherry + CD144 − populations. Cells were pre-gated on DAPI − cells. d , Representative mCherry levels in DAPI − CD45 low TER119 low CD144 + bone marrow endothelial cells from Dll4-mCherry (red) ( n = 4), Dll1-mCherry (blue) ( n = 3), Jag1-mCherry (black) ( n = 4) and control (grey) ( n = 5) mice. e, f , Representative immunofluorescence metaphysis and diaphysis of Dll4-mCherry ( e ) and Dll1-mCherry ( f ) bone marrow ( n = 3 mice). mCherry (red) and LAMA1 (blue). g, h , Representative two-photon images of bone marrow from intact (left) or dextran-injected (right) Dll4-mCherry ( g ) and Dll1-mCherry ( h ) mice ( n = 3 mice). i , Normalized counts of key differentially expressed genes from bulk RNA-seq performed on CD144 − DLL1 + cells (purple) (from n = 2 mice) and CD144 + DLL1 + cells (black) (from n = 2 mice). j , Representative flow cytometry histogram measuring mCherry fluorescence in NK1.1 + population from Dll1-mCherry (pink) and control (black) mice ( n = 3 mice). The data are mean ± s.d. N.S., not significant, * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, Student’s t -test, two-tailed. Data are representative of two ( a, e–h, j ) or three ( b–d ) independent experiments.

    Journal: Nature

    Article Title: The bone marrow microenvironment at single-cell resolution

    doi: 10.1038/s41586-019-1104-8

    Figure Lengend Snippet: Analysis of Dll4-mCherry, Dll1-mCherry, and Jag1-mCherry reporter animals. a , Reverse-transcription PCR of Dll4, Dll1 and Jag1 in vascular cells (red), perivascular LEPR + cells (purple) and osteoblasts (blue), normalized to Gapdh ( n = 4 mice). b , Low-magnification immunofluorescence images of thymus sections from Dll4-mCherry, Dll1-mCherry and Jag1-mCherry mice. c , Representative flow cytometry, measuring mCherry fluorescence in total bone marrow of Dll4-mCherry, Dll1-mCherry and JAG1-mCherry mice. Indicated values represent percentages of the complete CD144 + and mCherry + CD144 − populations. Cells were pre-gated on DAPI − cells. d , Representative mCherry levels in DAPI − CD45 low TER119 low CD144 + bone marrow endothelial cells from Dll4-mCherry (red) ( n = 4), Dll1-mCherry (blue) ( n = 3), Jag1-mCherry (black) ( n = 4) and control (grey) ( n = 5) mice. e, f , Representative immunofluorescence metaphysis and diaphysis of Dll4-mCherry ( e ) and Dll1-mCherry ( f ) bone marrow ( n = 3 mice). mCherry (red) and LAMA1 (blue). g, h , Representative two-photon images of bone marrow from intact (left) or dextran-injected (right) Dll4-mCherry ( g ) and Dll1-mCherry ( h ) mice ( n = 3 mice). i , Normalized counts of key differentially expressed genes from bulk RNA-seq performed on CD144 − DLL1 + cells (purple) (from n = 2 mice) and CD144 + DLL1 + cells (black) (from n = 2 mice). j , Representative flow cytometry histogram measuring mCherry fluorescence in NK1.1 + population from Dll1-mCherry (pink) and control (black) mice ( n = 3 mice). The data are mean ± s.d. N.S., not significant, * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, Student’s t -test, two-tailed. Data are representative of two ( a, e–h, j ) or three ( b–d ) independent experiments.

    Article Snippet: The following genes were analysed with TaqMan Gene Expression Assays: Gapdh (Mm99999915_g1), Dll4 (Mm00444619), Dll1 (Mm01279269_m1), Jag1 (Mm00496902_m1), Cdh5 (Mm00486938_m1), Lepr (Mm00440181_m1), Col1a1 (Mm00801666_g1).

    Techniques: Polymerase Chain Reaction, Mouse Assay, Immunofluorescence, Flow Cytometry, Cytometry, Fluorescence, Injection, RNA Sequencing Assay, Two Tailed Test

    Modulation of tetraspanins by siRNA reduces meningococcal adherence to HEC-1-B epithelial cells. HEC-1-B cells were incubated in either medium alone or a variety of siRNAs (nontargeting siRNAs, glyceraldehyde-3-phosphate dehydrogenase [GAPD], CD9, CD63,

    Journal: Infection and Immunity

    Article Title: Cooperative Role for Tetraspanins in Adhesin-Mediated Attachment of Bacterial Species to Human Epithelial Cells ▿Cooperative Role for Tetraspanins in Adhesin-Mediated Attachment of Bacterial Species to Human Epithelial Cells ▿ †

    doi: 10.1128/IAI.01354-10

    Figure Lengend Snippet: Modulation of tetraspanins by siRNA reduces meningococcal adherence to HEC-1-B epithelial cells. HEC-1-B cells were incubated in either medium alone or a variety of siRNAs (nontargeting siRNAs, glyceraldehyde-3-phosphate dehydrogenase [GAPD], CD9, CD63,

    Article Snippet: HEC-1-B cells seeded at 7.5 × 104 were incubated for 48 h with either medium alone or a variety of siRNAs (siGENOME nontargeting siRNA 1, human GAPDH [glyceraldehyde-3-phosphate dehydrogenase] control, CD9, CD63, and CD151 at 40 nM) (Thermo Scientific, United States).

    Techniques: Incubation

    Non-esterified fatty acid (NEFA) release in human subcutaneous adipocytes: a Adipocytes purchased from ZenBio were incubated with increasing concentrations (1 pM–10 μM) of positive control isoproterenol (EC 50 = 1.46 ± 0.34 nM), ACTH, α-MSH, PG-901 and LY2112688 (n = 4). NEFA release was measured as described. Experiments were carried out in duplicates. Data are shown as average values ± SEM. b MC1-5R and GAPDH mRNA expression was measured in same adipocytes (n = 3 pooled). cDNA was synthesized and mRNA levels determined by standard PCR (cDNA 1:10 from 1 μg RNA, 45 cycles)

    Journal: BMC Research Notes

    Article Title: Melanocortin agonists stimulate lipolysis in human adipose tissue explants but not in adipocytes

    doi: 10.1186/s13104-015-1539-4

    Figure Lengend Snippet: Non-esterified fatty acid (NEFA) release in human subcutaneous adipocytes: a Adipocytes purchased from ZenBio were incubated with increasing concentrations (1 pM–10 μM) of positive control isoproterenol (EC 50 = 1.46 ± 0.34 nM), ACTH, α-MSH, PG-901 and LY2112688 (n = 4). NEFA release was measured as described. Experiments were carried out in duplicates. Data are shown as average values ± SEM. b MC1-5R and GAPDH mRNA expression was measured in same adipocytes (n = 3 pooled). cDNA was synthesized and mRNA levels determined by standard PCR (cDNA 1:10 from 1 μg RNA, 45 cycles)

    Article Snippet: The gene expression assays used were: hsMC1R ( NM_002386.3): Hs00267168-S1; hsMC2R ( NM_000529.2): Hs003000820-S1; hsMC3R ( NM_019888.3): Hs01562847-S1; hsMC4R ( NM_005912.2): Hs00271877_S1; hsMC5R ( NM_005913.1): Hs00271882_S1; hsGAPDH (NM_002046.4): Hs02758991_g1.

    Techniques: Incubation, Positive Control, Expressing, Synthesized, Polymerase Chain Reaction

    The 5-HT1A mRNA 3′-UTR is alternatively spliced in human cells to give rise to several mRNA isoforms. A , Schematic representation of the human 5-HT1A 3′-UTR construct used for 3′-RACE experiments, and of primers A–D used to quantify the resulting mRNA variants upon its transfection in human cells (unspliced, LS, and SS). Dashed lines represent the intron removed following splicing of the 3′-UTR. The relative location of the poly-adenylation site (polyA signal), miR135 site, and splice donor (gt dinucleotides) and acceptor (cag) sites are indicated. B , Top, RT-PCR analysis of the 5-HT1A 3′-UTR splice variants in HEK293 cells. RNA from HEK293 cells transfected with luciferase vector pGL3P or pGL3P 5-HT1A-3′-UTR was assessed by RT-PCR for the expression of unspliced (U, top, primers A/B) and spliced 3′UTR isoforms, short (SS) and long (LS) (bottom, primers C/D). M, DNA size markers; 1, negative control; 2, pGL3P; 3, pGL3P 5-HT1A-3′-UTR. Bottom, Real-time PCR quantification of unspliced (100%) and spliced HTR1A mRNA in HEK293 cells transfected with pGL3P 5-HT1A-3′-UTR using probes specific for unspliced, total spliced (S), or LS isoform 5-HT1A mRNA. C , Splicing of human 5-HT1A minigene in stably transfected SKN-SH cells. Top, RT-PCR: cDNA from uninfected cells (Lane 1) or cells infected with the 5-HT1A minigene (Lane 2) were analyzed for the unspliced 3′-UTR (U) or spliced isoforms (SS, LS) using primers shown in A . Below, real-time PCR: relative mRNA levels were normalized to GAPDH using the ΔΔCt method. Data are presented as mean ± SEM of the %unspliced from three independent experiments. D , Undetectable HTR1A RNA splicing in mouse brain. Full-length cDNA from human SKN-SH cells expressing the human 5-HT1A minigene or mouse PFC and hippocampus (HP) tissue was analyzed using two human primers C and D in A or the corresponding mouse 3′-UTR primers (521–2444 bp downstream of the stop codon). Spliced 5-HT1A mRNA isoforms (S) were only detected for the human transcript, while the unspliced form (U) was present in both. M, DNA size markers; 1, negative control. E ).

    Journal: The Journal of Neuroscience

    Article Title: A Novel Alternative Splicing Mechanism That Enhances Human 5-HT1A Receptor RNA Stability Is Altered in Major Depression

    doi: 10.1523/JNEUROSCI.0902-18.2018

    Figure Lengend Snippet: The 5-HT1A mRNA 3′-UTR is alternatively spliced in human cells to give rise to several mRNA isoforms. A , Schematic representation of the human 5-HT1A 3′-UTR construct used for 3′-RACE experiments, and of primers A–D used to quantify the resulting mRNA variants upon its transfection in human cells (unspliced, LS, and SS). Dashed lines represent the intron removed following splicing of the 3′-UTR. The relative location of the poly-adenylation site (polyA signal), miR135 site, and splice donor (gt dinucleotides) and acceptor (cag) sites are indicated. B , Top, RT-PCR analysis of the 5-HT1A 3′-UTR splice variants in HEK293 cells. RNA from HEK293 cells transfected with luciferase vector pGL3P or pGL3P 5-HT1A-3′-UTR was assessed by RT-PCR for the expression of unspliced (U, top, primers A/B) and spliced 3′UTR isoforms, short (SS) and long (LS) (bottom, primers C/D). M, DNA size markers; 1, negative control; 2, pGL3P; 3, pGL3P 5-HT1A-3′-UTR. Bottom, Real-time PCR quantification of unspliced (100%) and spliced HTR1A mRNA in HEK293 cells transfected with pGL3P 5-HT1A-3′-UTR using probes specific for unspliced, total spliced (S), or LS isoform 5-HT1A mRNA. C , Splicing of human 5-HT1A minigene in stably transfected SKN-SH cells. Top, RT-PCR: cDNA from uninfected cells (Lane 1) or cells infected with the 5-HT1A minigene (Lane 2) were analyzed for the unspliced 3′-UTR (U) or spliced isoforms (SS, LS) using primers shown in A . Below, real-time PCR: relative mRNA levels were normalized to GAPDH using the ΔΔCt method. Data are presented as mean ± SEM of the %unspliced from three independent experiments. D , Undetectable HTR1A RNA splicing in mouse brain. Full-length cDNA from human SKN-SH cells expressing the human 5-HT1A minigene or mouse PFC and hippocampus (HP) tissue was analyzed using two human primers C and D in A or the corresponding mouse 3′-UTR primers (521–2444 bp downstream of the stop codon). Spliced 5-HT1A mRNA isoforms (S) were only detected for the human transcript, while the unspliced form (U) was present in both. M, DNA size markers; 1, negative control. E ).

    Article Snippet: Real-time PCR quantifications of total 5-HT1A, PTBP1/2, nSR100, and GAPDH RNA were performed using TaqMan Gene expression assay kits (Thermo Fisher Scientific) for human 5-HT1A (Hs00265014_s1), PTBP1 (Hs00243060p_m1), PTBP2 (Hs00221842_m1), nSR100 (Hs00916552_m1), and GAPDH (Hs02758991_g1) in a 20 μl reaction.

    Techniques: Construct, Transfection, Reverse Transcription Polymerase Chain Reaction, Luciferase, Plasmid Preparation, Expressing, Negative Control, Real-time Polymerase Chain Reaction, Stable Transfection, Infection

    Opposite regulation of 5-HT1A mRNA splicing and protein levels by splicing factors PTBP1 and nSR100. A–C , Effect of PTBP1 and PTBP2 knockdown on 5-HT1A RNA splicing. SKN-SH cells were infected with lentiviruses expressing shRNAs against PTBP1, PTBP2, or a nontargeting control (Ctrl) shRNA at multiplicity of infection of 10 and selected using puromycin. Puromycin-resistant cells were infected with the WT 5-HT1A minigene at multiplicity of infection of 20 for 72 h and RNA and protein were extracted and analyzed. Relative expression of PTBP1, PTBP2, and Flag-5-HT1A proteins was determined by Western blot ( A ), while the expression of the various 5-HT1A mRNA variants was assessed by RT-PCR ( B ) and quantified by real-time PCR ( C ) using probes specific for the spliced mRNA isoforms (total spliced (Tot spliced) or LS isoform), unspliced mRNA isoforms, or total 5-HT1A mRNA (Total 1A). Relative mRNA levels were normalized to GAPDH using the ΔΔCt method. D–F , Effect of Nova1, Nova2, and nSR100 overexpression on 5-HT1A RNA splicing. SKN-SH cells were infected with the WT 5-HT1A minigene at multiplicity of infection of 20 for 72 h, and then transfected with vector (pTRIEX) or plasmids encoding the S-tagged Nova1, Nova2, and nSR100 neuronal splice regulators. The relative expression of the S-tagged proteins (S-tag), Flag-5-HT1A receptor and alpha-tubulin was determined by Western blot ( D ), while the expression of the various 5-HT1A mRNA isoforms was assessed by RT-PCR ( E ) and quantified by real-time PCR ( F ). Data presented as the mean and SEM of 3–4 independent experiments ( C , F ). * p

    Journal: The Journal of Neuroscience

    Article Title: A Novel Alternative Splicing Mechanism That Enhances Human 5-HT1A Receptor RNA Stability Is Altered in Major Depression

    doi: 10.1523/JNEUROSCI.0902-18.2018

    Figure Lengend Snippet: Opposite regulation of 5-HT1A mRNA splicing and protein levels by splicing factors PTBP1 and nSR100. A–C , Effect of PTBP1 and PTBP2 knockdown on 5-HT1A RNA splicing. SKN-SH cells were infected with lentiviruses expressing shRNAs against PTBP1, PTBP2, or a nontargeting control (Ctrl) shRNA at multiplicity of infection of 10 and selected using puromycin. Puromycin-resistant cells were infected with the WT 5-HT1A minigene at multiplicity of infection of 20 for 72 h and RNA and protein were extracted and analyzed. Relative expression of PTBP1, PTBP2, and Flag-5-HT1A proteins was determined by Western blot ( A ), while the expression of the various 5-HT1A mRNA variants was assessed by RT-PCR ( B ) and quantified by real-time PCR ( C ) using probes specific for the spliced mRNA isoforms (total spliced (Tot spliced) or LS isoform), unspliced mRNA isoforms, or total 5-HT1A mRNA (Total 1A). Relative mRNA levels were normalized to GAPDH using the ΔΔCt method. D–F , Effect of Nova1, Nova2, and nSR100 overexpression on 5-HT1A RNA splicing. SKN-SH cells were infected with the WT 5-HT1A minigene at multiplicity of infection of 20 for 72 h, and then transfected with vector (pTRIEX) or plasmids encoding the S-tagged Nova1, Nova2, and nSR100 neuronal splice regulators. The relative expression of the S-tagged proteins (S-tag), Flag-5-HT1A receptor and alpha-tubulin was determined by Western blot ( D ), while the expression of the various 5-HT1A mRNA isoforms was assessed by RT-PCR ( E ) and quantified by real-time PCR ( F ). Data presented as the mean and SEM of 3–4 independent experiments ( C , F ). * p

    Article Snippet: Real-time PCR quantifications of total 5-HT1A, PTBP1/2, nSR100, and GAPDH RNA were performed using TaqMan Gene expression assay kits (Thermo Fisher Scientific) for human 5-HT1A (Hs00265014_s1), PTBP1 (Hs00243060p_m1), PTBP2 (Hs00221842_m1), nSR100 (Hs00916552_m1), and GAPDH (Hs02758991_g1) in a 20 μl reaction.

    Techniques: Infection, Expressing, shRNA, Western Blot, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Over Expression, Transfection, Plasmid Preparation