Structured Review

Santa Cruz Biotechnology glyceraldehyde 3 phosphate dehydrogenase gapdh
PRL inhibits BCL6 expression via miR-339-5p pathways. (A) qRT-PCR analysis of miR-339-5p mRNA in MCF-7 and T47D cells treated with or without PRL for up to 48 hours. (B) MCF-7 and T47D cells were grown and transiently transfected with miR-339-5p ASO or scrambled sequence oligonucleotides as negative control and subjected to western blot assays. Forty-eight hours later, cells were treated with or without PRL for 6 hours. (C) Corresponding densitometry data of BCL6 normalized to <t>GAPDH</t> loading controls. (D) qRT-PCR analysis of BCL6 was performed in MCF-7 and T47D cells, respectively. PRL=prolactin; BCL6 =B-cell lymphoma 6; <t>GAPDH=glyceraldehyde-3-phosphate</t> dehydrogenase; qRT-PCR=quantitative reverse transcription-polymerase chain reaction; ASO=antisense oligonucleotide. * p
Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 116 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Santa Cruz Biotechnology
Average 96 stars, based on 116 article reviews
Price from $9.99 to $1999.99
glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
96/100 stars

Images

1) Product Images from "Prolactin Inhibits BCL6 Expression in Breast Cancer Cells through a MicroRNA-339-5p-Dependent Pathway"

Article Title: Prolactin Inhibits BCL6 Expression in Breast Cancer Cells through a MicroRNA-339-5p-Dependent Pathway

Journal: Journal of Breast Cancer

doi: 10.4048/jbc.2016.19.1.26

PRL inhibits BCL6 expression via miR-339-5p pathways. (A) qRT-PCR analysis of miR-339-5p mRNA in MCF-7 and T47D cells treated with or without PRL for up to 48 hours. (B) MCF-7 and T47D cells were grown and transiently transfected with miR-339-5p ASO or scrambled sequence oligonucleotides as negative control and subjected to western blot assays. Forty-eight hours later, cells were treated with or without PRL for 6 hours. (C) Corresponding densitometry data of BCL6 normalized to GAPDH loading controls. (D) qRT-PCR analysis of BCL6 was performed in MCF-7 and T47D cells, respectively. PRL=prolactin; BCL6 =B-cell lymphoma 6; GAPDH=glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR=quantitative reverse transcription-polymerase chain reaction; ASO=antisense oligonucleotide. * p
Figure Legend Snippet: PRL inhibits BCL6 expression via miR-339-5p pathways. (A) qRT-PCR analysis of miR-339-5p mRNA in MCF-7 and T47D cells treated with or without PRL for up to 48 hours. (B) MCF-7 and T47D cells were grown and transiently transfected with miR-339-5p ASO or scrambled sequence oligonucleotides as negative control and subjected to western blot assays. Forty-eight hours later, cells were treated with or without PRL for 6 hours. (C) Corresponding densitometry data of BCL6 normalized to GAPDH loading controls. (D) qRT-PCR analysis of BCL6 was performed in MCF-7 and T47D cells, respectively. PRL=prolactin; BCL6 =B-cell lymphoma 6; GAPDH=glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR=quantitative reverse transcription-polymerase chain reaction; ASO=antisense oligonucleotide. * p

Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Allele-specific Oligonucleotide, Sequencing, Negative Control, Western Blot, Reverse Transcription Polymerase Chain Reaction

PRL suppresses BCL6 protein and mRNA levels in breast cancer cells. (A) T47D cells were treated with or without the indicated doses of PRL for 24 hours. Detergent cell extracts were resolved by Western blot. (B) Western blot of representative over time showing protein levels of BCL6 and GAPDH in MCF-7 and T47D cells treated with or without PRL for up to 48 hours. (C) Corresponding densitometry data of BCL6 normalized to GAPDH loading controls. (D) Time course of BCL6 mRNA levels in MCF-7 and T47D cells in response to PRL treatment by qRT-PCR. The data are represented as mean±SD from three independent experiments. PRL=prolactin; BCL6 =B-cell lymphoma 6; GAPDH=glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR=quantitative reverse transcription-polymerase chain reaction. * p
Figure Legend Snippet: PRL suppresses BCL6 protein and mRNA levels in breast cancer cells. (A) T47D cells were treated with or without the indicated doses of PRL for 24 hours. Detergent cell extracts were resolved by Western blot. (B) Western blot of representative over time showing protein levels of BCL6 and GAPDH in MCF-7 and T47D cells treated with or without PRL for up to 48 hours. (C) Corresponding densitometry data of BCL6 normalized to GAPDH loading controls. (D) Time course of BCL6 mRNA levels in MCF-7 and T47D cells in response to PRL treatment by qRT-PCR. The data are represented as mean±SD from three independent experiments. PRL=prolactin; BCL6 =B-cell lymphoma 6; GAPDH=glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR=quantitative reverse transcription-polymerase chain reaction. * p

Techniques Used: Western Blot, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction

2) Product Images from "Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats"

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats

Journal: World Journal of Gastroenterology : WJG

doi: 10.3748/wjg.v19.i2.241

Atorvastatin effect on the expression of smooth muscle actin. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; SMA: Smooth muscle actin.
Figure Legend Snippet: Atorvastatin effect on the expression of smooth muscle actin. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; SMA: Smooth muscle actin.

Techniques Used: Expressing

3) Product Images from "Chaperone-Mediated Autophagy Promotes Beclin1 Degradation in Persistently Infected Hepatitis C Virus Cell Culture"

Article Title: Chaperone-Mediated Autophagy Promotes Beclin1 Degradation in Persistently Infected Hepatitis C Virus Cell Culture

Journal: The American Journal of Pathology

doi: 10.1016/j.ajpath.2018.06.022

Chaperone-mediated autophagy (CMA) targets beclin1 degradation in hepatitis C virus (HCV) infection. A: Schematic representation showing the presence of multiple pentapeptide motif (KFERQ-like), CMA motifs, and their location in beclin1 protein sequences. B: Western blot shows beclin1 and lysosome-associated membrane protein 2A (LAMP2A) expression in Huh-7.5 cells after serum starvation. C: Beclin1 expression in HCV-infected primary human hepatocytes (PHHs). D: Beclin1 expression in HCV-infected Huh-7.5 cells. E: Beclin1 mRNA levels in HCV-infected Huh-7.5 cells by real-time quantitative RT-PCR. F: Western blot analysis shows silencing LAMP2A expression restores beclin1 expression without altering HCV replication in infected Huh-7.5 cells. G: Co-immunoprecipitation shows interaction among beclin1, LAMP2A, and heat shock cognate 70 kDa (Hsc70) in uninfected and HCV-infected Huh-7.5 cells at 6 days and 21 days. H: Sulforaphane induces nuclear factor erythroid 2–related factor (Nrf2) activation and its nuclear translocation in uninfected Huh-7.5 cells. I: Western blot analysis demonstrating expression of LAMP2A and beclin1 in uninfected Huh-7.5 cells after treatment with increasing concentrations of sulforaphane. J: CMA functional assay showing lysosomal degradation of recombinant glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the presence and absence of protease inhibitors. K: Quantification of GAPDH bands in Western blot showing amount of GAPDH uptake and degradation during serum starvation and late HCV infection. ∗∗∗ P
Figure Legend Snippet: Chaperone-mediated autophagy (CMA) targets beclin1 degradation in hepatitis C virus (HCV) infection. A: Schematic representation showing the presence of multiple pentapeptide motif (KFERQ-like), CMA motifs, and their location in beclin1 protein sequences. B: Western blot shows beclin1 and lysosome-associated membrane protein 2A (LAMP2A) expression in Huh-7.5 cells after serum starvation. C: Beclin1 expression in HCV-infected primary human hepatocytes (PHHs). D: Beclin1 expression in HCV-infected Huh-7.5 cells. E: Beclin1 mRNA levels in HCV-infected Huh-7.5 cells by real-time quantitative RT-PCR. F: Western blot analysis shows silencing LAMP2A expression restores beclin1 expression without altering HCV replication in infected Huh-7.5 cells. G: Co-immunoprecipitation shows interaction among beclin1, LAMP2A, and heat shock cognate 70 kDa (Hsc70) in uninfected and HCV-infected Huh-7.5 cells at 6 days and 21 days. H: Sulforaphane induces nuclear factor erythroid 2–related factor (Nrf2) activation and its nuclear translocation in uninfected Huh-7.5 cells. I: Western blot analysis demonstrating expression of LAMP2A and beclin1 in uninfected Huh-7.5 cells after treatment with increasing concentrations of sulforaphane. J: CMA functional assay showing lysosomal degradation of recombinant glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the presence and absence of protease inhibitors. K: Quantification of GAPDH bands in Western blot showing amount of GAPDH uptake and degradation during serum starvation and late HCV infection. ∗∗∗ P

Techniques Used: Infection, Western Blot, Expressing, Quantitative RT-PCR, Immunoprecipitation, Activation Assay, Translocation Assay, Functional Assay, Recombinant

4) Product Images from "Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors"

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113247

Wnt5a expressing tumors have less Wnt/β-catenin signaling than MMTV-Wnt1 tumors. (A) Quantitative RT-PCR of Wnt/ β -catenin target genes . Expression of Axin2 mRNA in MMTV-Wnt1 versus MMTV-Wnt1;MMTV-Wnt5a tumors as determined by quantitative RT-PCR (n = 5 MMTV-Wnt1, n = 5 MMTV-Wnt1;MMTV-Wnt5a). Data are shown as tables obtained using REST software. Axin2 mRNA was significantly down-regulated in MMTV-Wnt1;MMTV-Wnt5a tumors. (B) Western blot for β-catenin protein . Protein lysates were prepared from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a tumors. β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin to β-catenin as determined by densitometic analysis is shown. MMTV-Wnt1;MMTV-Wnt5a tumors displayed decreased levels of active β-catenin compared to controls.
Figure Legend Snippet: Wnt5a expressing tumors have less Wnt/β-catenin signaling than MMTV-Wnt1 tumors. (A) Quantitative RT-PCR of Wnt/ β -catenin target genes . Expression of Axin2 mRNA in MMTV-Wnt1 versus MMTV-Wnt1;MMTV-Wnt5a tumors as determined by quantitative RT-PCR (n = 5 MMTV-Wnt1, n = 5 MMTV-Wnt1;MMTV-Wnt5a). Data are shown as tables obtained using REST software. Axin2 mRNA was significantly down-regulated in MMTV-Wnt1;MMTV-Wnt5a tumors. (B) Western blot for β-catenin protein . Protein lysates were prepared from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a tumors. β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin to β-catenin as determined by densitometic analysis is shown. MMTV-Wnt1;MMTV-Wnt5a tumors displayed decreased levels of active β-catenin compared to controls.

Techniques Used: Expressing, Quantitative RT-PCR, Software, Western Blot

Wnt5a expressing tumors demonstrate a decrease in markers of the basal tumor subtype. (A) Western blot using protein lysates isolated from the epithelium of MMTV-Wnt1 and MMTV-1;MMTV-Wnt5a mammary tumors. The expression of molecular markers of basal and luminal tumor subtypes were compared. Keratin 6 and Keratin 5 were strongly down-regulated in Wnt5a expressing tumors. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B–D) Immunostaining for K6 . Sections from MMTV-Wnt1 (B) and MMTV-1;MMTV-Wnt5a (C) tumors were stained with anti-Keratin 6 antibody using immunofluorescence (K6 = green; nuclei = blue). The percentage of cells expressing K6 was determined and graphed (D). Values are means +/− standard error (n = 6 MMTV-Wnt1, 3 fields per tumor; n = 5 MMTV-Wnt1;MMTV-Wnt5a, 3 fields per tumor). MMTV-Wnt1;MMTV-Wnt5a tumors demonstrated a significant decrease in K6-expressing cells as measured by T-test (* = p
Figure Legend Snippet: Wnt5a expressing tumors demonstrate a decrease in markers of the basal tumor subtype. (A) Western blot using protein lysates isolated from the epithelium of MMTV-Wnt1 and MMTV-1;MMTV-Wnt5a mammary tumors. The expression of molecular markers of basal and luminal tumor subtypes were compared. Keratin 6 and Keratin 5 were strongly down-regulated in Wnt5a expressing tumors. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B–D) Immunostaining for K6 . Sections from MMTV-Wnt1 (B) and MMTV-1;MMTV-Wnt5a (C) tumors were stained with anti-Keratin 6 antibody using immunofluorescence (K6 = green; nuclei = blue). The percentage of cells expressing K6 was determined and graphed (D). Values are means +/− standard error (n = 6 MMTV-Wnt1, 3 fields per tumor; n = 5 MMTV-Wnt1;MMTV-Wnt5a, 3 fields per tumor). MMTV-Wnt1;MMTV-Wnt5a tumors demonstrated a significant decrease in K6-expressing cells as measured by T-test (* = p

Techniques Used: Expressing, Western Blot, Isolation, Immunostaining, Staining, Immunofluorescence

Ectopic expression of Wnt5a results in low expression of K6 and K14. Expression of molecular markers for basal and luminal progenitors in MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands was compared by western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Each lane contains protein isolated from a separate mouse.
Figure Legend Snippet: Ectopic expression of Wnt5a results in low expression of K6 and K14. Expression of molecular markers for basal and luminal progenitors in MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands was compared by western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Each lane contains protein isolated from a separate mouse.

Techniques Used: Expressing, Western Blot, Isolation

Wnt/β-catenin signaling is not down-regulated in Wnt5a expressing MMTV-Wnt1 glands. (A) Western blot analysis of β-catenin protein in MMTV-Wnt1mammary gland . The level of active β-catenin was compared in protein lysates from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands. Total β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin-to-β-catenin is shown at the bottom on the gel. Each lane represents a sample from a different mouse. (B) Quantitative RT-PCR of Axin2, a Wnt/β-catenin target gene, in unsorted primary mammary epithelial cells . Expression of Axin2 and hWnt5a m RNA in unsorted PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 12 MMTV-Wnt1, n = 11 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh. (C) Quantitative RT-PCR of Axin2 in E-cadherin negative primary mammary epithelial cells . Expression of Axin2 and hWnt5a mRNA in E-cadherin (Ecad) negative PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 2 MMTV-Wnt1, n = 2 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh.
Figure Legend Snippet: Wnt/β-catenin signaling is not down-regulated in Wnt5a expressing MMTV-Wnt1 glands. (A) Western blot analysis of β-catenin protein in MMTV-Wnt1mammary gland . The level of active β-catenin was compared in protein lysates from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands. Total β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin-to-β-catenin is shown at the bottom on the gel. Each lane represents a sample from a different mouse. (B) Quantitative RT-PCR of Axin2, a Wnt/β-catenin target gene, in unsorted primary mammary epithelial cells . Expression of Axin2 and hWnt5a m RNA in unsorted PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 12 MMTV-Wnt1, n = 11 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh. (C) Quantitative RT-PCR of Axin2 in E-cadherin negative primary mammary epithelial cells . Expression of Axin2 and hWnt5a mRNA in E-cadherin (Ecad) negative PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 2 MMTV-Wnt1, n = 2 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh.

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Mouse Assay, Software

5) Product Images from "Proteome of human colon cancer stem cells: A comparative analysis"

Article Title: Proteome of human colon cancer stem cells: A comparative analysis

Journal: World Journal of Gastroenterology : WJG

doi: 10.3748/wjg.v17.i10.1276

Expressions of CD133, CD29, Musashi-1, TERT, ABCG2, Oct-4 and Sca-1 genes (A) and CD133, CD29, Musashi-1, ABCG2 and TERT proteins (B) in SW1116csc and SW1116 cells (left: SW1116 cells, right: SW1116csc). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase;
Figure Legend Snippet: Expressions of CD133, CD29, Musashi-1, TERT, ABCG2, Oct-4 and Sca-1 genes (A) and CD133, CD29, Musashi-1, ABCG2 and TERT proteins (B) in SW1116csc and SW1116 cells (left: SW1116 cells, right: SW1116csc). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase;

Techniques Used:

6) Product Images from "Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition"

Article Title: Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition

Journal: PLoS ONE

doi: 10.1371/journal.pone.0128263

(A-C) Phosphorylation of NFATc1 on serine 259, phosphorylation of NFATc3 on serine 265, and expression of modulatory calcineurin-interacting protein 1 were similar in all four groups ( P = NS vs. Control in each case). (D) Representative immunoblotting results for phosphorylated and total NFATc1 and NFATc3, together with expression of modulatory calcineurin-interacting protein 1. The amount of phosphorylation (NFATc1 and NFATc3) or expression (modulatory calcineurin-interacting protein 1) in the Control was taken as 100% in each determination. p-NFATc1; phosphorylated NFATc1 at serine 259; t-NFATc1; total NFATc1; p-NFATc3, phosphorylated NFATc3 at serine 265, t-NFATc3; total NFATc3, GAPDH; glyceraldehyde 3- phosphate dehydrogenase
Figure Legend Snippet: (A-C) Phosphorylation of NFATc1 on serine 259, phosphorylation of NFATc3 on serine 265, and expression of modulatory calcineurin-interacting protein 1 were similar in all four groups ( P = NS vs. Control in each case). (D) Representative immunoblotting results for phosphorylated and total NFATc1 and NFATc3, together with expression of modulatory calcineurin-interacting protein 1. The amount of phosphorylation (NFATc1 and NFATc3) or expression (modulatory calcineurin-interacting protein 1) in the Control was taken as 100% in each determination. p-NFATc1; phosphorylated NFATc1 at serine 259; t-NFATc1; total NFATc1; p-NFATc3, phosphorylated NFATc3 at serine 265, t-NFATc3; total NFATc3, GAPDH; glyceraldehyde 3- phosphate dehydrogenase

Techniques Used: Expressing

7) Product Images from "Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells"

Article Title: Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells

Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

doi: 10.3390/molecules23051095

Kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells via Chk2. ( A , B ) Flow cytometry assays revealed that kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells; ( C ) Kaempferol increased the expression of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no influence on the expression of Cyclin B1 in A2780/CP70 cells; ( D ) Knockdown of Chk2 attenuated kaempferol-induced up-regulation of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no effect on the expression of p53 and cleavage of PARP-1 in A2780/CP70 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the loading control. Ctrl is short for control.
Figure Legend Snippet: Kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells via Chk2. ( A , B ) Flow cytometry assays revealed that kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells; ( C ) Kaempferol increased the expression of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no influence on the expression of Cyclin B1 in A2780/CP70 cells; ( D ) Knockdown of Chk2 attenuated kaempferol-induced up-regulation of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no effect on the expression of p53 and cleavage of PARP-1 in A2780/CP70 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the loading control. Ctrl is short for control.

Techniques Used: Flow Cytometry, Cytometry, Expressing

8) Product Images from "miR-506 suppresses neuroblastoma metastasis by targeting ROCK1"

Article Title: miR-506 suppresses neuroblastoma metastasis by targeting ROCK1

Journal: Oncology Letters

doi: 10.3892/ol.2016.5442

ROCK1 is a target gene of miR-506 in neuroblastoma cells. (A) According to bioinformatics analysis, the 3′-UTR of the ROCK1 gene contains binding sites for miR-506. (B) miR-506 suppressed the expression of a luciferase reporter gene harboring the 3′-UTR of ROCK1 in IMR-32 cells. The pGL4 plasmid was modified by adding either the human 3′-UTR or the 3′-UTR with mutations in regions complementary to miR-506 seed regions behind the firefly luciferase gene. IMR-32 cells were transiently co-transfected with a negative control (mock) or miR-506 together with the indicated luciferase constructs, and luciferase activity was analyzed 48 h later. Data are presented as relative firefly luciferase activity normalized to Renilla luciferase activity from the same construct. (C) miR-506 restoration downregulated ROCK1 in the neuroblastoma cells. The cells were transfected with miR-506 or miR control for 48 h, and were then collected for reverse transcription-quantitative polymerase chain reaction. (D) miR-506 restoration downregulated ROCK1 expression in the neuroblastoma IMR-32 and SH-SY5Y cell lines. The cells were transfected with miR-506 or miR-control for 48 h, and were then collected for western blot analysis. The data are presented as the mean ± standard deviation and the data were collected from three independent experiments. ROCK1, Rho-associated, coiled-coil containing protein kinase 1; 3′-UTR, 3′-untranslated region; miR, microRNA; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: ROCK1 is a target gene of miR-506 in neuroblastoma cells. (A) According to bioinformatics analysis, the 3′-UTR of the ROCK1 gene contains binding sites for miR-506. (B) miR-506 suppressed the expression of a luciferase reporter gene harboring the 3′-UTR of ROCK1 in IMR-32 cells. The pGL4 plasmid was modified by adding either the human 3′-UTR or the 3′-UTR with mutations in regions complementary to miR-506 seed regions behind the firefly luciferase gene. IMR-32 cells were transiently co-transfected with a negative control (mock) or miR-506 together with the indicated luciferase constructs, and luciferase activity was analyzed 48 h later. Data are presented as relative firefly luciferase activity normalized to Renilla luciferase activity from the same construct. (C) miR-506 restoration downregulated ROCK1 in the neuroblastoma cells. The cells were transfected with miR-506 or miR control for 48 h, and were then collected for reverse transcription-quantitative polymerase chain reaction. (D) miR-506 restoration downregulated ROCK1 expression in the neuroblastoma IMR-32 and SH-SY5Y cell lines. The cells were transfected with miR-506 or miR-control for 48 h, and were then collected for western blot analysis. The data are presented as the mean ± standard deviation and the data were collected from three independent experiments. ROCK1, Rho-associated, coiled-coil containing protein kinase 1; 3′-UTR, 3′-untranslated region; miR, microRNA; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Binding Assay, Expressing, Luciferase, Plasmid Preparation, Modification, Transfection, Negative Control, Construct, Activity Assay, Real-time Polymerase Chain Reaction, Western Blot, Standard Deviation

9) Product Images from "Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors"

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113247

Wnt5a expressing tumors have less Wnt/β-catenin signaling than MMTV-Wnt1 tumors. (A) Quantitative RT-PCR of Wnt/ β -catenin target genes . Expression of Axin2 mRNA in MMTV-Wnt1 versus MMTV-Wnt1;MMTV-Wnt5a tumors as determined by quantitative RT-PCR (n = 5 MMTV-Wnt1, n = 5 MMTV-Wnt1;MMTV-Wnt5a). Data are shown as tables obtained using REST software. Axin2 mRNA was significantly down-regulated in MMTV-Wnt1;MMTV-Wnt5a tumors. (B) Western blot for β-catenin protein . Protein lysates were prepared from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a tumors. β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin to β-catenin as determined by densitometic analysis is shown. MMTV-Wnt1;MMTV-Wnt5a tumors displayed decreased levels of active β-catenin compared to controls.
Figure Legend Snippet: Wnt5a expressing tumors have less Wnt/β-catenin signaling than MMTV-Wnt1 tumors. (A) Quantitative RT-PCR of Wnt/ β -catenin target genes . Expression of Axin2 mRNA in MMTV-Wnt1 versus MMTV-Wnt1;MMTV-Wnt5a tumors as determined by quantitative RT-PCR (n = 5 MMTV-Wnt1, n = 5 MMTV-Wnt1;MMTV-Wnt5a). Data are shown as tables obtained using REST software. Axin2 mRNA was significantly down-regulated in MMTV-Wnt1;MMTV-Wnt5a tumors. (B) Western blot for β-catenin protein . Protein lysates were prepared from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a tumors. β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin to β-catenin as determined by densitometic analysis is shown. MMTV-Wnt1;MMTV-Wnt5a tumors displayed decreased levels of active β-catenin compared to controls.

Techniques Used: Expressing, Quantitative RT-PCR, Software, Western Blot

Wnt5a expressing tumors demonstrate a decrease in markers of the basal tumor subtype. (A) Western blot using protein lysates isolated from the epithelium of MMTV-Wnt1 and MMTV-1;MMTV-Wnt5a mammary tumors. The expression of molecular markers of basal and luminal tumor subtypes were compared. Keratin 6 and Keratin 5 were strongly down-regulated in Wnt5a expressing tumors. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B–D) Immunostaining for K6 . Sections from MMTV-Wnt1 (B) and MMTV-1;MMTV-Wnt5a (C) tumors were stained with anti-Keratin 6 antibody using immunofluorescence (K6 = green; nuclei = blue). The percentage of cells expressing K6 was determined and graphed (D). Values are means +/− standard error (n = 6 MMTV-Wnt1, 3 fields per tumor; n = 5 MMTV-Wnt1;MMTV-Wnt5a, 3 fields per tumor). MMTV-Wnt1;MMTV-Wnt5a tumors demonstrated a significant decrease in K6-expressing cells as measured by T-test (* = p
Figure Legend Snippet: Wnt5a expressing tumors demonstrate a decrease in markers of the basal tumor subtype. (A) Western blot using protein lysates isolated from the epithelium of MMTV-Wnt1 and MMTV-1;MMTV-Wnt5a mammary tumors. The expression of molecular markers of basal and luminal tumor subtypes were compared. Keratin 6 and Keratin 5 were strongly down-regulated in Wnt5a expressing tumors. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. (B–D) Immunostaining for K6 . Sections from MMTV-Wnt1 (B) and MMTV-1;MMTV-Wnt5a (C) tumors were stained with anti-Keratin 6 antibody using immunofluorescence (K6 = green; nuclei = blue). The percentage of cells expressing K6 was determined and graphed (D). Values are means +/− standard error (n = 6 MMTV-Wnt1, 3 fields per tumor; n = 5 MMTV-Wnt1;MMTV-Wnt5a, 3 fields per tumor). MMTV-Wnt1;MMTV-Wnt5a tumors demonstrated a significant decrease in K6-expressing cells as measured by T-test (* = p

Techniques Used: Expressing, Western Blot, Isolation, Immunostaining, Staining, Immunofluorescence

Ectopic expression of Wnt5a results in low expression of K6 and K14. Expression of molecular markers for basal and luminal progenitors in MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands was compared by western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Each lane contains protein isolated from a separate mouse.
Figure Legend Snippet: Ectopic expression of Wnt5a results in low expression of K6 and K14. Expression of molecular markers for basal and luminal progenitors in MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands was compared by western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Each lane contains protein isolated from a separate mouse.

Techniques Used: Expressing, Western Blot, Isolation

Wnt/β-catenin signaling is not down-regulated in Wnt5a expressing MMTV-Wnt1 glands. (A) Western blot analysis of β-catenin protein in MMTV-Wnt1mammary gland . The level of active β-catenin was compared in protein lysates from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands. Total β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin-to-β-catenin is shown at the bottom on the gel. Each lane represents a sample from a different mouse. (B) Quantitative RT-PCR of Axin2, a Wnt/β-catenin target gene, in unsorted primary mammary epithelial cells . Expression of Axin2 and hWnt5a m RNA in unsorted PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 12 MMTV-Wnt1, n = 11 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh. (C) Quantitative RT-PCR of Axin2 in E-cadherin negative primary mammary epithelial cells . Expression of Axin2 and hWnt5a mRNA in E-cadherin (Ecad) negative PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 2 MMTV-Wnt1, n = 2 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh.
Figure Legend Snippet: Wnt/β-catenin signaling is not down-regulated in Wnt5a expressing MMTV-Wnt1 glands. (A) Western blot analysis of β-catenin protein in MMTV-Wnt1mammary gland . The level of active β-catenin was compared in protein lysates from MMTV-Wnt1 and MMTV-Wnt1;MMTV-Wnt5a mammary glands. Total β-catenin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as loading controls. The ratio of active β-catenin-to-β-catenin is shown at the bottom on the gel. Each lane represents a sample from a different mouse. (B) Quantitative RT-PCR of Axin2, a Wnt/β-catenin target gene, in unsorted primary mammary epithelial cells . Expression of Axin2 and hWnt5a m RNA in unsorted PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 12 MMTV-Wnt1, n = 11 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh. (C) Quantitative RT-PCR of Axin2 in E-cadherin negative primary mammary epithelial cells . Expression of Axin2 and hWnt5a mRNA in E-cadherin (Ecad) negative PMECs from MMTV-Wnt1;MMTV-Wnt5a vs. MMTV-Wnt1 mammary glands was determined by quantitative RT-PCR (n = 2 MMTV-Wnt1, n = 2 MMTV-Wnt1;MMTV-Wnt5a separate mice). Data are shown as tables obtained using REST analysis software. Expression = fold difference in MMTV-Wnt1;Wnt5a relative to MMTV-Wnt1 controls after normalization to Gapdh.

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Mouse Assay, Software

10) Product Images from "Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells"

Article Title: Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells

Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

doi: 10.3390/molecules23051095

Kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells via Chk2. ( A , B ) Flow cytometry assays revealed that kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells; ( C ) Kaempferol increased the expression of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no influence on the expression of Cyclin B1 in A2780/CP70 cells; ( D ) Knockdown of Chk2 attenuated kaempferol-induced up-regulation of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no effect on the expression of p53 and cleavage of PARP-1 in A2780/CP70 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the loading control. Ctrl is short for control.
Figure Legend Snippet: Kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells via Chk2. ( A , B ) Flow cytometry assays revealed that kaempferol induced G2/M cell cycle arrest in A2780/CP70 cells; ( C ) Kaempferol increased the expression of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no influence on the expression of Cyclin B1 in A2780/CP70 cells; ( D ) Knockdown of Chk2 attenuated kaempferol-induced up-regulation of p-Chk2, p-Cdc25C, p21 and p-Cdc2, but had no effect on the expression of p53 and cleavage of PARP-1 in A2780/CP70 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the loading control. Ctrl is short for control.

Techniques Used: Flow Cytometry, Cytometry, Expressing

11) Product Images from "Intermedin1–53 Protects Against Myocardial Fibrosis by Inhibiting Endoplasmic Reticulum Stress and Inflammation Induced by Homocysteine in Apolipoprotein E-Deficient Mice"

Article Title: Intermedin1–53 Protects Against Myocardial Fibrosis by Inhibiting Endoplasmic Reticulum Stress and Inflammation Induced by Homocysteine in Apolipoprotein E-Deficient Mice

Journal: Journal of Atherosclerosis and Thrombosis

doi: 10.5551/jat.34082

Intermedin 1–53 (IMD 1–53 ) inhibited myocardial fibrosis induced by homocysteine (Hcy) in vivo and in vitro . Picrosirius red staining (a) of myocardial interstitial collagen deposition. Bar, 50 µm. Quantitative real-time PCR analysis of mRNA levels (b) of collagen I and III in the myocardium of apolipoprotein E-deficient (ApoE-/-) mice in vivo . Results are relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Western blot analysis of protein levels (c) of collagen I and III in the myocardium of ApoE-/- mice in vivo . Western blot analysis of protein levels (d) of collagen I and III and α -smooth muscle actin ( α -SMA) in rat cardiac fibroblasts (CFs) in vitro . GAPDH was a loading control. Data are mean ± SD, n = 3 in each group; * P
Figure Legend Snippet: Intermedin 1–53 (IMD 1–53 ) inhibited myocardial fibrosis induced by homocysteine (Hcy) in vivo and in vitro . Picrosirius red staining (a) of myocardial interstitial collagen deposition. Bar, 50 µm. Quantitative real-time PCR analysis of mRNA levels (b) of collagen I and III in the myocardium of apolipoprotein E-deficient (ApoE-/-) mice in vivo . Results are relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Western blot analysis of protein levels (c) of collagen I and III in the myocardium of ApoE-/- mice in vivo . Western blot analysis of protein levels (d) of collagen I and III and α -smooth muscle actin ( α -SMA) in rat cardiac fibroblasts (CFs) in vitro . GAPDH was a loading control. Data are mean ± SD, n = 3 in each group; * P

Techniques Used: Radial Immuno Diffusion, In Vivo, In Vitro, Staining, Real-time Polymerase Chain Reaction, Mouse Assay, Western Blot

12) Product Images from "Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia"

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia

Journal: Genes & Cancer

doi: 10.18632/genesandcancer.117

Activation of apoptotic cascade by Givinostat on leukemia cell lines Western blotting of cultured cells treated with or without Givinostat (0.25μM) to reveal activation of apoptotic cascade in Ph+ leukemia cells. The data represents one of three repeats. The cleaved forms of caspase-3 were at 17 kDa, caspase-7 at 20 kDa, and PARP1 at 85 KDa. PARP1, Poly (ADP-Ribose) Polymerase 1; C7 Caspase 7; C3: Caspase 3; GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.
Figure Legend Snippet: Activation of apoptotic cascade by Givinostat on leukemia cell lines Western blotting of cultured cells treated with or without Givinostat (0.25μM) to reveal activation of apoptotic cascade in Ph+ leukemia cells. The data represents one of three repeats. The cleaved forms of caspase-3 were at 17 kDa, caspase-7 at 20 kDa, and PARP1 at 85 KDa. PARP1, Poly (ADP-Ribose) Polymerase 1; C7 Caspase 7; C3: Caspase 3; GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.

Techniques Used: Activation Assay, Western Blot, Cell Culture

Detection of expressions of CHK1, p53, and p21 in leukemia cells Western blotting of cultured cells treated with or without Givinostat (0.25μM) to reveal p53 integrality in SUP-B15 (left) and K562 (right) at 24 to 72hrs. GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.
Figure Legend Snippet: Detection of expressions of CHK1, p53, and p21 in leukemia cells Western blotting of cultured cells treated with or without Givinostat (0.25μM) to reveal p53 integrality in SUP-B15 (left) and K562 (right) at 24 to 72hrs. GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.

Techniques Used: Western Blot, Cell Culture

13) Product Images from "Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis"

Article Title: Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis

Journal: Journal of Cancer Prevention

doi: 10.15430/JCP.2019.24.4.233

Effect of docosahexaenoic acid (DHA) on protein expression levels of α-smooth muscle actin (α-SMA) and fibronectin in pancreas. Protein expression of α-SMA, fibronectin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was determined by Western blot analysis. Expression levels of α-SMA and fibronectin were compared to that of GAPDH (loading control) and expressed as a percentage ratio of the band density. None, untreated mice; Control, mice treated with cerulein alone; DHA, mice treated with cerulein and DHA. Values are presented as mean ± SE. a P
Figure Legend Snippet: Effect of docosahexaenoic acid (DHA) on protein expression levels of α-smooth muscle actin (α-SMA) and fibronectin in pancreas. Protein expression of α-SMA, fibronectin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was determined by Western blot analysis. Expression levels of α-SMA and fibronectin were compared to that of GAPDH (loading control) and expressed as a percentage ratio of the band density. None, untreated mice; Control, mice treated with cerulein alone; DHA, mice treated with cerulein and DHA. Values are presented as mean ± SE. a P

Techniques Used: Expressing, Western Blot, Mouse Assay

Effect of docosahexaenoic acid (DHA) on pancreatic damage and mRNA levels of α-smooth muscle actin (α-SMA) and fibronectin in pancreas. (A) Pancreatic weight and body weight were measured after treatment with cerulein and DHA. (B) mRNA levels of α-SMA and fibronectin were determined by reverse transcription-PCR. mRNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. None, untreated mice; Control, mice treated with cerulein alone; DHA, mice treated with cerulein and DHA. Values are presented as mean ± SE. a P
Figure Legend Snippet: Effect of docosahexaenoic acid (DHA) on pancreatic damage and mRNA levels of α-smooth muscle actin (α-SMA) and fibronectin in pancreas. (A) Pancreatic weight and body weight were measured after treatment with cerulein and DHA. (B) mRNA levels of α-SMA and fibronectin were determined by reverse transcription-PCR. mRNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. None, untreated mice; Control, mice treated with cerulein alone; DHA, mice treated with cerulein and DHA. Values are presented as mean ± SE. a P

Techniques Used: Polymerase Chain Reaction, Expressing, Mouse Assay

14) Product Images from "Sulforaphane prevents doxorubicin-induced oxidative stress and cell death in rat H9c2 cells"

Article Title: Sulforaphane prevents doxorubicin-induced oxidative stress and cell death in rat H9c2 cells

Journal: International Journal of Molecular Medicine

doi: 10.3892/ijmm.2015.2199

Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor-2 (Nrf2) pathway by L-sulforaphane (L-Sul) and D,L-sulforaphane (D,L-Sul) in H9c2 cells. (A) H9c2 cells were treated with 1 µ M doxorubicin (Dox) or pre-treated with 10 µ M L-Sul or D,L-Sul for 2 h, and then treated with 1 µ M Dox for 24 h. Cells were double immunostained for Nrf2 and Keap1 and nuclei were visualized by DAPI staining. (B) H9c2 cells were treated with 1 µ M Dox or pre-treated with 10 µ M L-Sul or D,L-Sul for 2 h, and then treated with 1 µ M Dox for 24 h. In parallel, cells were also treated with 10 µ M L-Sul or D,L-Sul alone for 24 h. Nuclear and cytosolic fractions of H9c2 cells were obtained and subjected to western blot analysis using Nrf2 and Keap1 antibodies (top panel). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a cytosolic marker, while histone H3 was used to identify nuclear fractions. Densitometric analysis is shown on the lower panel. # P
Figure Legend Snippet: Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor-2 (Nrf2) pathway by L-sulforaphane (L-Sul) and D,L-sulforaphane (D,L-Sul) in H9c2 cells. (A) H9c2 cells were treated with 1 µ M doxorubicin (Dox) or pre-treated with 10 µ M L-Sul or D,L-Sul for 2 h, and then treated with 1 µ M Dox for 24 h. Cells were double immunostained for Nrf2 and Keap1 and nuclei were visualized by DAPI staining. (B) H9c2 cells were treated with 1 µ M Dox or pre-treated with 10 µ M L-Sul or D,L-Sul for 2 h, and then treated with 1 µ M Dox for 24 h. In parallel, cells were also treated with 10 µ M L-Sul or D,L-Sul alone for 24 h. Nuclear and cytosolic fractions of H9c2 cells were obtained and subjected to western blot analysis using Nrf2 and Keap1 antibodies (top panel). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a cytosolic marker, while histone H3 was used to identify nuclear fractions. Densitometric analysis is shown on the lower panel. # P

Techniques Used: Activation Assay, Staining, Western Blot, Marker

15) Product Images from "Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis"

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis

Journal: Critical Care

doi: 10.1186/cc7710

Pituitary expression of C5a receptor (R) during experimental sepsis in IgG or anti-C5a IgG treated sham animals and septic littermates 24 hours after caecal ligation and puncture (CLP) procedure. (a) Following total RNA isolation from pituitary tissue, pituitary C5aR mRNA expression was assessed by real-time PCR. For each bar, sample size was five to seven. (b) Five pituitary tissue samples were removed at indicated time-points, homogenised and C5aR protein expression was analysed by Western blotting. For sham groups, two samples were taken; for CLP groups, three samples were taken. Blot is representative for three independent experiments. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p
Figure Legend Snippet: Pituitary expression of C5a receptor (R) during experimental sepsis in IgG or anti-C5a IgG treated sham animals and septic littermates 24 hours after caecal ligation and puncture (CLP) procedure. (a) Following total RNA isolation from pituitary tissue, pituitary C5aR mRNA expression was assessed by real-time PCR. For each bar, sample size was five to seven. (b) Five pituitary tissue samples were removed at indicated time-points, homogenised and C5aR protein expression was analysed by Western blotting. For sham groups, two samples were taken; for CLP groups, three samples were taken. Blot is representative for three independent experiments. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p

Techniques Used: Expressing, Ligation, Isolation, Real-time Polymerase Chain Reaction, Western Blot

Expression of inflammatory mediators in the pituitary. Pituitary tissue samples were surgically removed, snap-frozen, homogenised and total RNA was extracted. Samples were then analysed by quantitative real-time PCR analysis. Expression of (a) TNF and (b) IL-6 mRNA in the pituitary 24 hours after sham procedure or caecal ligation and puncture (CLP). Five to seven samples were taken per experimental condition. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p
Figure Legend Snippet: Expression of inflammatory mediators in the pituitary. Pituitary tissue samples were surgically removed, snap-frozen, homogenised and total RNA was extracted. Samples were then analysed by quantitative real-time PCR analysis. Expression of (a) TNF and (b) IL-6 mRNA in the pituitary 24 hours after sham procedure or caecal ligation and puncture (CLP). Five to seven samples were taken per experimental condition. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Ligation

Evaluation of pituitary function after caecal ligation and puncture (CLP). Pituitary tissue samples were removed from four to five mice, snap-frozen, homogenised in Trizol and total RNA was extracted. Assessment of mRNA expression of (a) proopiomelanocortin (POMC) and (b) growth hormone (GH) 24 hours after CLP or sham operation by real-time PCR. Whole blood samples were drawn at given time-points by puncture of the inferior vena cava, plasma was obtained by centrifugation and subjected to ELISA analysis. Samples were assessed for (c) GH or (d) corticosterone under identical conditions. For all graphs, there were five to seven samples per experimental condition. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p
Figure Legend Snippet: Evaluation of pituitary function after caecal ligation and puncture (CLP). Pituitary tissue samples were removed from four to five mice, snap-frozen, homogenised in Trizol and total RNA was extracted. Assessment of mRNA expression of (a) proopiomelanocortin (POMC) and (b) growth hormone (GH) 24 hours after CLP or sham operation by real-time PCR. Whole blood samples were drawn at given time-points by puncture of the inferior vena cava, plasma was obtained by centrifugation and subjected to ELISA analysis. Samples were assessed for (c) GH or (d) corticosterone under identical conditions. For all graphs, there were five to seven samples per experimental condition. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. # p

Techniques Used: Ligation, Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Centrifugation, Enzyme-linked Immunosorbent Assay

16) Product Images from "Macrophage ubiquitin-specific protease 2 modifies insulin sensitivity in obese mice"

Article Title: Macrophage ubiquitin-specific protease 2 modifies insulin sensitivity in obese mice

Journal: Biochemistry and Biophysics Reports

doi: 10.1016/j.bbrep.2017.01.009

Effects of USP2 in macrophages on insulin signaling in adipocytes. Changes in insulin-elicited Akt phosphorylation (pAkt; A, C) and insulin receptor β chain (pIRβ; B, D) in 3T3-L1 cells conditioned by USP2 knockdown HL-60 cells (KD; A, B) or Usp2a overexpression isolated mouse macrophages(C, D). 3T3-L1 cells were pretreated with culture media from USP2 KD (A, B), Usp2a overexpression (C, D), or their respective control (Ctrl) cells for 10 h. After insulin (100 nM) treatment, the 3T3-L1 cells were subjected to Western blot (A, C) and immunoprecipitation Western blot (B, D) analyses. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was also detected as reference. Values presented are the mean±SD of three experiments. * P
Figure Legend Snippet: Effects of USP2 in macrophages on insulin signaling in adipocytes. Changes in insulin-elicited Akt phosphorylation (pAkt; A, C) and insulin receptor β chain (pIRβ; B, D) in 3T3-L1 cells conditioned by USP2 knockdown HL-60 cells (KD; A, B) or Usp2a overexpression isolated mouse macrophages(C, D). 3T3-L1 cells were pretreated with culture media from USP2 KD (A, B), Usp2a overexpression (C, D), or their respective control (Ctrl) cells for 10 h. After insulin (100 nM) treatment, the 3T3-L1 cells were subjected to Western blot (A, C) and immunoprecipitation Western blot (B, D) analyses. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was also detected as reference. Values presented are the mean±SD of three experiments. * P

Techniques Used: Over Expression, Isolation, Western Blot, Immunoprecipitation

17) Product Images from "Copine-7 binds to the cell surface receptor, nucleolin, and regulates ciliogenesis and Dspp expression during odontoblast differentiation"

Article Title: Copine-7 binds to the cell surface receptor, nucleolin, and regulates ciliogenesis and Dspp expression during odontoblast differentiation

Journal: Scientific Reports

doi: 10.1038/s41598-017-11641-y

Calcium dependence of Cpne7 endocytosis. Endocytosis of Cpne7 in MDPC-23 cells after treatment with CaCl 2 ( A ) or EGTA ( B ). MDPC-23 cells were pre-treated with varying concentrations of CaCl 2 or EGTA for 1 h before rCpne7 treatment. The internalized Cpne7 was detected by western blotting. Each data are representative of three independently performed experiments. Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Calcium dependence of Cpne7 endocytosis. Endocytosis of Cpne7 in MDPC-23 cells after treatment with CaCl 2 ( A ) or EGTA ( B ). MDPC-23 cells were pre-treated with varying concentrations of CaCl 2 or EGTA for 1 h before rCpne7 treatment. The internalized Cpne7 was detected by western blotting. Each data are representative of three independently performed experiments. Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Western Blot

Identification of a receptor, nucleolin which mediates Cpne7 endocytosis. ( A ) Total lysates obtained from Flag-Cpne7-overexpressed MDPC-23 cells were immunoprecipitated with anti-Flag antibody. The samples were subjected to SDS-PAGE followed by Coomassie blue staining. Eleven compartments were excised from the gel and analysed by tendem mass spectrometry. ( B ) The cell lysates were separated into membrane/cytoplasmic and nuclear fractions and then analysed for nucleolin proteins by western blotting. ( C ) The interaction with Cpne7 and nucleolin was analysed by co-immunoprecipitation. Lamin B served as nucleus fractionation control. ( D,E ) Endocytosis of Cpne7 in MDPC-23 cells after treatment with nucleolin siRNA. MDPC-23 cells were pre-treated with nucleolin siRNA for 1 h before Cpne7 protein (rCpne7) treatment. Internalized Cpne7 was detected by western blotting ( D ) or immunostaining ( E ). Each data are representative of two or three independently performed experiments. siCtl, control siRNA; siNcl, nucleolin siRNA; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Identification of a receptor, nucleolin which mediates Cpne7 endocytosis. ( A ) Total lysates obtained from Flag-Cpne7-overexpressed MDPC-23 cells were immunoprecipitated with anti-Flag antibody. The samples were subjected to SDS-PAGE followed by Coomassie blue staining. Eleven compartments were excised from the gel and analysed by tendem mass spectrometry. ( B ) The cell lysates were separated into membrane/cytoplasmic and nuclear fractions and then analysed for nucleolin proteins by western blotting. ( C ) The interaction with Cpne7 and nucleolin was analysed by co-immunoprecipitation. Lamin B served as nucleus fractionation control. ( D,E ) Endocytosis of Cpne7 in MDPC-23 cells after treatment with nucleolin siRNA. MDPC-23 cells were pre-treated with nucleolin siRNA for 1 h before Cpne7 protein (rCpne7) treatment. Internalized Cpne7 was detected by western blotting ( D ) or immunostaining ( E ). Each data are representative of two or three independently performed experiments. siCtl, control siRNA; siNcl, nucleolin siRNA; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Immunoprecipitation, SDS Page, Staining, Mass Spectrometry, Western Blot, Fractionation, Immunostaining

18) Product Images from "Reversal of Myofibroblast Differentiation by Prostaglandin E2"

Article Title: Reversal of Myofibroblast Differentiation by Prostaglandin E2

Journal: American Journal of Respiratory Cell and Molecular Biology

doi: 10.1165/rcmb.2012-0262OC

Prostaglandin E 2 (PGE 2 ) reverses transforming growth factor (TGF)-β1–induced myofibroblast differentiation. ( A ) IMR-90 cells were pretreated with TGF-β1 (2 ng/ml) for 1 day to induce myofibroblast differentiation, after which medium was removed and cells were treated with or without PGE 2 (500 nM) for 1–5 days in serum-free medium. Lysates were collected at the indicated days after treatment and immunoblotted for α-smooth muscle actin (α-SMA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Densitometric values of α-SMA relative to GAPDH, normalized to the Day 1 no-PGE 2 control, are shown graphically ( n = 3) with a representative immunoblot shown above. * P
Figure Legend Snippet: Prostaglandin E 2 (PGE 2 ) reverses transforming growth factor (TGF)-β1–induced myofibroblast differentiation. ( A ) IMR-90 cells were pretreated with TGF-β1 (2 ng/ml) for 1 day to induce myofibroblast differentiation, after which medium was removed and cells were treated with or without PGE 2 (500 nM) for 1–5 days in serum-free medium. Lysates were collected at the indicated days after treatment and immunoblotted for α-smooth muscle actin (α-SMA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Densitometric values of α-SMA relative to GAPDH, normalized to the Day 1 no-PGE 2 control, are shown graphically ( n = 3) with a representative immunoblot shown above. * P

Techniques Used:

19) Product Images from "Antiproliferative and apoptotic effects of xanthohumol in cholangiocarcinoma"

Article Title: Antiproliferative and apoptotic effects of xanthohumol in cholangiocarcinoma

Journal: Oncotarget

doi: 10.18632/oncotarget.21422

XN induces cell cycle arrest and apoptosis in CCA cell lines (A) Treatment with XN increases p21, cyclin-dependent kinase inhibitor, in all three cell lines. Key cell cycle regulators cyclin D1, Cyclin D3, Cyclin E1, and CDK2 were reduced in CC-SW-1 whereas cyclin D3 and cyclin E1 and CDK2 and CDK4 were reduced at various levels in CCLP-1 and SG-231. (B) XN-treatment induces apoptosis as evidenced by the increase in cleaved PARP in three cell lines. Furthermore, pro survival protein survivin as well as anti-apoptotic protein XIAP was reduced with XN-treatment. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. (C) Caspase-3 and -7 activities were measured by caspase Glo3/7 assay ( * , p
Figure Legend Snippet: XN induces cell cycle arrest and apoptosis in CCA cell lines (A) Treatment with XN increases p21, cyclin-dependent kinase inhibitor, in all three cell lines. Key cell cycle regulators cyclin D1, Cyclin D3, Cyclin E1, and CDK2 were reduced in CC-SW-1 whereas cyclin D3 and cyclin E1 and CDK2 and CDK4 were reduced at various levels in CCLP-1 and SG-231. (B) XN-treatment induces apoptosis as evidenced by the increase in cleaved PARP in three cell lines. Furthermore, pro survival protein survivin as well as anti-apoptotic protein XIAP was reduced with XN-treatment. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. (C) Caspase-3 and -7 activities were measured by caspase Glo3/7 assay ( * , p

Techniques Used:

XN treatment alters Notch1 and PI3-K/AKT pathway (A) Dose-dependent reductions in Notch 1 in CCLP-1, SG-231, and CC-SW-1 correspond to increasing dose of XN were observed after 72 hours of XN treatment. Phosphorylated AKT at serine 473 (p-Akt Ser 473) is reduced when compared to total cellular AKT. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. (B) Time course experiments in SG-231 showed Notch1 reduction at 12 hr after XN treatment whereas no reduction in phosphorylated AKT at ser473 position even after 24 hr treatment. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control.
Figure Legend Snippet: XN treatment alters Notch1 and PI3-K/AKT pathway (A) Dose-dependent reductions in Notch 1 in CCLP-1, SG-231, and CC-SW-1 correspond to increasing dose of XN were observed after 72 hours of XN treatment. Phosphorylated AKT at serine 473 (p-Akt Ser 473) is reduced when compared to total cellular AKT. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. (B) Time course experiments in SG-231 showed Notch1 reduction at 12 hr after XN treatment whereas no reduction in phosphorylated AKT at ser473 position even after 24 hr treatment. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control.

Techniques Used:

20) Product Images from "The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis"

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

Journal: The Journal of Infectious Diseases

doi: 10.1093/infdis/jiw569

A , The mRNA of XBP1 is spliced by the endonuclease activity of IRE1α. Total RNA was extracted from C57epi cells cultured in various experimental conditions. Primer pair (forward: 5’-GAACCAGGAGTTAAGAACACG -3’; reverse: 5’AGGCAACAGTGTCAGAGTCC -3’) was used in PCR amplification. The DNA template was the complementary DNA reverse transcribed from the RNA extracted from each culture condition. The PCR product from each culture condition was ran on 2% agarose gel and stained with ethidium bromide. Lane 1: molecular weight marker. Lane 2: noninfected C57epi cells cultured for 48 hours showing the presence of unspliced 205-bp band used as negative control. Lane 3: C57epi cells infected with C. muridarum (MoPn) at MOI 5 for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band. Lane 4: C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. Lane 5: Noninfected C57epi cells treated with thapsigargin (chemical inducer of UPR) cultured for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band used as positive control. Lanes 6–8: PCR amplification of GAPDH gene products used as loading control for noninfected C57epi cells infected with MoPn at MOI 5 and C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. B , C57epi cells infected with C. muridarum induced the upregulation of XBP1 protein and inhibition of IRE1α RNase activity results in the downregulation of XBP1. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum for 48 hours and treated/nontreated with inhibitor of IRE1α RNase activity were prepared for Western blot analysis. Blot was probed with primary antibody against spliced XBP1. Lane 1: protein molecular weight marker. Lane 2 sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours. Lane 4: sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours. C , Western blot of eIF2α phosphorylation during Chlamydia infection. Ten μg total protein from C57epi cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against phosphorylated eIF2α. Lane 1: protein molecular weight marker. Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. Abbreviations: bp, base pairs; C57epi cells, mouse oviduct epithelial cells; eIF2α, eukaryotic initiation factor 2-α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; mRNA, messenger RNA; NI, noninfected; PCR, polymerase chain reaction; RNase, ribonuclease; Thap, thapsigargin; XBP1, X-box binding protein 1.
Figure Legend Snippet: A , The mRNA of XBP1 is spliced by the endonuclease activity of IRE1α. Total RNA was extracted from C57epi cells cultured in various experimental conditions. Primer pair (forward: 5’-GAACCAGGAGTTAAGAACACG -3’; reverse: 5’AGGCAACAGTGTCAGAGTCC -3’) was used in PCR amplification. The DNA template was the complementary DNA reverse transcribed from the RNA extracted from each culture condition. The PCR product from each culture condition was ran on 2% agarose gel and stained with ethidium bromide. Lane 1: molecular weight marker. Lane 2: noninfected C57epi cells cultured for 48 hours showing the presence of unspliced 205-bp band used as negative control. Lane 3: C57epi cells infected with C. muridarum (MoPn) at MOI 5 for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band. Lane 4: C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. Lane 5: Noninfected C57epi cells treated with thapsigargin (chemical inducer of UPR) cultured for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band used as positive control. Lanes 6–8: PCR amplification of GAPDH gene products used as loading control for noninfected C57epi cells infected with MoPn at MOI 5 and C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. B , C57epi cells infected with C. muridarum induced the upregulation of XBP1 protein and inhibition of IRE1α RNase activity results in the downregulation of XBP1. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum for 48 hours and treated/nontreated with inhibitor of IRE1α RNase activity were prepared for Western blot analysis. Blot was probed with primary antibody against spliced XBP1. Lane 1: protein molecular weight marker. Lane 2 sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours. Lane 4: sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours. C , Western blot of eIF2α phosphorylation during Chlamydia infection. Ten μg total protein from C57epi cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against phosphorylated eIF2α. Lane 1: protein molecular weight marker. Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. Abbreviations: bp, base pairs; C57epi cells, mouse oviduct epithelial cells; eIF2α, eukaryotic initiation factor 2-α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; mRNA, messenger RNA; NI, noninfected; PCR, polymerase chain reaction; RNase, ribonuclease; Thap, thapsigargin; XBP1, X-box binding protein 1.

Techniques Used: Activity Assay, Cell Culture, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Molecular Weight, Marker, Negative Control, Infection, Positive Control, Inhibition, Western Blot, Binding Assay

21) Product Images from "Rosuvastatin suppresses platelet-derived growth factor-BB-induced vascular smooth muscle cell proliferation and migration via the MAPK signaling pathway"

Article Title: Rosuvastatin suppresses platelet-derived growth factor-BB-induced vascular smooth muscle cell proliferation and migration via the MAPK signaling pathway

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2013.1265

Rosuvastatin inhibited the mitogen-activated protein kinase (MAPK) signaling pathway activated by platelet-derived growth factor-BB (PDGF-BB) in vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. Western blot analysis was used to determine the protein expression of phospho-extracellular signal-regulated kinase 1/2 (ERK1/2), ERK, phospho-p38, p38, phospho-c-Jun N-terminal kinase (JNK) and JNK. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference.
Figure Legend Snippet: Rosuvastatin inhibited the mitogen-activated protein kinase (MAPK) signaling pathway activated by platelet-derived growth factor-BB (PDGF-BB) in vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. Western blot analysis was used to determine the protein expression of phospho-extracellular signal-regulated kinase 1/2 (ERK1/2), ERK, phospho-p38, p38, phospho-c-Jun N-terminal kinase (JNK) and JNK. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference.

Techniques Used: Derivative Assay, Cell Culture, Western Blot, Expressing

Rosuvastatin suppressed the platelet-derived growth factor-BB (PDGF-BB)-stimulated migration of vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. (A) Transwell assay was used to determine the migration of VSMCs. (B) Protein expression of matrix metalloproteinase 2 (MMP2) and 9 (MMP9) was determined by western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. ** Significantly different from the NC group (P
Figure Legend Snippet: Rosuvastatin suppressed the platelet-derived growth factor-BB (PDGF-BB)-stimulated migration of vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. (A) Transwell assay was used to determine the migration of VSMCs. (B) Protein expression of matrix metalloproteinase 2 (MMP2) and 9 (MMP9) was determined by western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. ** Significantly different from the NC group (P

Techniques Used: Derivative Assay, Migration, Cell Culture, Transwell Assay, Expressing, Western Blot

Rosuvastatin inhibited the platelet-derived growth factor-BB (PDGF-BB)-induced phenotype switching of vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. The protein expression levels of the smooth muscle markers smooth muscle-α-actin (SMA), smoothelin and desmin were determined. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Rosuvastatin inhibited the platelet-derived growth factor-BB (PDGF-BB)-induced phenotype switching of vascular smooth muscle cells (VSMCs). Con, VSMCs were cultured without any treatment; NC, VSMCs were treated only with PDGF-BB (20 ng/ml) for 48 h; rosuvastatin, VSMCs were treated with rosuvastatin (10 μ M) and PDGF-BB (20 ng/ml) for 48 h. The protein expression levels of the smooth muscle markers smooth muscle-α-actin (SMA), smoothelin and desmin were determined. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Derivative Assay, Cell Culture, Expressing

22) Product Images from "Expression of Semaphorin 4A and its potential role in rheumatoid arthritis"

Article Title: Expression of Semaphorin 4A and its potential role in rheumatoid arthritis

Journal: Arthritis Research & Therapy

doi: 10.1186/s13075-015-0734-y

Increased expression of semaphorin 4A ( Sema4A ) in rheumatoid arthritis ( RA ). a Sema4A mRNA (relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH)) was detected by qRT-PCR and its expression increased in the synovial tissues in RA (n = 12) compared with those in osteoarthrits ( OA ) (n = 12). b Western blot analysis showed that Sema4A protein increased in the synovial tissues of RA (n = 12) compared with those of OA (n = 12) (ratio Sema4A/GAPDH RA 2.39 ± 0.15; OA 0.42 ± 0.12, P = 0.016
Figure Legend Snippet: Increased expression of semaphorin 4A ( Sema4A ) in rheumatoid arthritis ( RA ). a Sema4A mRNA (relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH)) was detected by qRT-PCR and its expression increased in the synovial tissues in RA (n = 12) compared with those in osteoarthrits ( OA ) (n = 12). b Western blot analysis showed that Sema4A protein increased in the synovial tissues of RA (n = 12) compared with those of OA (n = 12) (ratio Sema4A/GAPDH RA 2.39 ± 0.15; OA 0.42 ± 0.12, P = 0.016

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

Semaphorin 4A ( Sema4A ) regulates the invasive phenotype of synovial fibroblasts of rheumatoid arthritis (RASFs). The invasive ability of RASFs as investigated by transwell apparatus after recombinant human semaphorin 4A ( rhSema4A ) ( a ) or silencing Sema4A ( b ) treatment, which were depicted in × 100 magnification. Western blot was applied to detect the expression of matrix metalloproteinase ( MMP )3 and MMP9 ( c ), as well as alpha smooth actin ( α-SMA ) and vimentin ( d ) in RASFs after rhSema4A treatment at different concentrations. GAPDH glyceraldehyde-3-phosphate dehydrogenase
Figure Legend Snippet: Semaphorin 4A ( Sema4A ) regulates the invasive phenotype of synovial fibroblasts of rheumatoid arthritis (RASFs). The invasive ability of RASFs as investigated by transwell apparatus after recombinant human semaphorin 4A ( rhSema4A ) ( a ) or silencing Sema4A ( b ) treatment, which were depicted in × 100 magnification. Western blot was applied to detect the expression of matrix metalloproteinase ( MMP )3 and MMP9 ( c ), as well as alpha smooth actin ( α-SMA ) and vimentin ( d ) in RASFs after rhSema4A treatment at different concentrations. GAPDH glyceraldehyde-3-phosphate dehydrogenase

Techniques Used: Recombinant, Western Blot, Expressing

23) Product Images from "Serum containing Tongqiaohuoxue decoction suppresses glutamate-induced PC12 cell injury ☆"

Article Title: Serum containing Tongqiaohuoxue decoction suppresses glutamate-induced PC12 cell injury ☆

Journal: Neural Regeneration Research

doi: 10.3969/j.issn.1673-5374.2012.15.001

Effect of serum with Tongqiaohuoxue decoction (TQHXD) on the expression of calmodulin-dependent protein kinase II (CaMKII) and phosphorylated CaMKII (P-CaMKII) in PC12 cells (western blotting). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the loading control. A high gray value ( Table 1 ) represents low protein expression.
Figure Legend Snippet: Effect of serum with Tongqiaohuoxue decoction (TQHXD) on the expression of calmodulin-dependent protein kinase II (CaMKII) and phosphorylated CaMKII (P-CaMKII) in PC12 cells (western blotting). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the loading control. A high gray value ( Table 1 ) represents low protein expression.

Techniques Used: Expressing, Western Blot

24) Product Images from "Jaeumganghwa-Tang, a traditional herbal formula, improves muscle function and attenuates muscle loss in aged mice"

Article Title: Jaeumganghwa-Tang, a traditional herbal formula, improves muscle function and attenuates muscle loss in aged mice

Journal: Journal of Exercise Nutrition & Biochemistry

doi: 10.20463/jenb.2017.0059

Western blot analysis of TGF-β expression in tibialis anterior (A) and gastrocnemius (B) muscles of young and old mice. GAPDH was used as the internal control. Y, young mice; O, old mice; JGT, Jaeumganghwa-tang; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure Legend Snippet: Western blot analysis of TGF-β expression in tibialis anterior (A) and gastrocnemius (B) muscles of young and old mice. GAPDH was used as the internal control. Y, young mice; O, old mice; JGT, Jaeumganghwa-tang; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Techniques Used: Western Blot, Expressing, Mouse Assay

25) Product Images from "Mice overexpressing chromogranin A display hypergranulogenic adrenal glands with attenuated ATP levels contributing to the hypertensive phenotype"

Article Title: Mice overexpressing chromogranin A display hypergranulogenic adrenal glands with attenuated ATP levels contributing to the hypertensive phenotype

Journal: Journal of hypertension

doi: 10.1097/HJH.0000000000001678

Homeostasis of granin expression in the large dense core vesicles of adrenal glands. (a) qPCR analysis of other granin family members – chromogranin B ( Chgb ) and secretogranin 2 ( Scg2 ) mRNA levels showed no difference in expression between the two-copy and four-copy mice adrenal glands. Data were normalized against IBS ribosomal RNA. (b) Total adrenal extracts were also analyzed by western blots for expression of CHGB and SCG2 proteins. Both CHGB and SCG2 protein expression was significantly reduced in four-copy mice that express excess CHGA indicating, translational regulation of total granin expression. Even loading was confirmed by probing blots with housekeeping protein GAPDH. (c) Bar graph showing quantitative difference in protein expression of CHGB and SCG2. CHGA, chromogranin A; CHGB, chromogranin B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure Legend Snippet: Homeostasis of granin expression in the large dense core vesicles of adrenal glands. (a) qPCR analysis of other granin family members – chromogranin B ( Chgb ) and secretogranin 2 ( Scg2 ) mRNA levels showed no difference in expression between the two-copy and four-copy mice adrenal glands. Data were normalized against IBS ribosomal RNA. (b) Total adrenal extracts were also analyzed by western blots for expression of CHGB and SCG2 proteins. Both CHGB and SCG2 protein expression was significantly reduced in four-copy mice that express excess CHGA indicating, translational regulation of total granin expression. Even loading was confirmed by probing blots with housekeeping protein GAPDH. (c) Bar graph showing quantitative difference in protein expression of CHGB and SCG2. CHGA, chromogranin A; CHGB, chromogranin B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Mouse Assay, Western Blot

26) Product Images from "Proteome of human colon cancer stem cells: A comparative analysis"

Article Title: Proteome of human colon cancer stem cells: A comparative analysis

Journal: World Journal of Gastroenterology : WJG

doi: 10.3748/wjg.v17.i10.1276

Expressions of CD133, CD29, Musashi-1, TERT, ABCG2, Oct-4 and Sca-1 genes (A) and CD133, CD29, Musashi-1, ABCG2 and TERT proteins (B) in SW1116csc and SW1116 cells (left: SW1116 cells, right: SW1116csc). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase;
Figure Legend Snippet: Expressions of CD133, CD29, Musashi-1, TERT, ABCG2, Oct-4 and Sca-1 genes (A) and CD133, CD29, Musashi-1, ABCG2 and TERT proteins (B) in SW1116csc and SW1116 cells (left: SW1116 cells, right: SW1116csc). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase;

Techniques Used:

27) Product Images from "Nuclear fragments of the neural cell adhesion molecule NCAM with or without polysialic acid differentially regulate gene expression"

Article Title: Nuclear fragments of the neural cell adhesion molecule NCAM with or without polysialic acid differentially regulate gene expression

Journal: Scientific Reports

doi: 10.1038/s41598-017-14056-x

NCAM fragments without or with PSA regulate the protein expression of Snca and Lrp2 or Nr2f6. Cerebellar neurons from wild-type mice were treated for 30 or 180 min without (−Ab) or with function-triggering guinea pig NCAM antibody (+Ab). Cell lysates were subjected to immunoblot (IB) analysis with antibodies against Nr2f6 ( a ), Snca ( b ), Lrp2 ( c ) protein or against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ( a , b ) or L1 ( c ) to control gel loading. ( a – c ) Representative immunoblots out of three independent experiments are shown. For clarity, only parts of the blot with Nr2f6-, Lrp2-, Snca-, GAPDH-, and L1-positive bands are shown. The Lrp2 immunoblot ( c ) is shown after long exposure time (upper panel) and short exposure (lower panel). Full-length Lrp2 (~600 kDa) and the 60 kDa Lrp2 fragment are indicated by arrows. ( d) Levels of Nr2f6 and Snca as well as the sums of the full-length Lrp2 and the 60 kDa Lrp2 fragment levels were quantified by densitometry and normalized to GAPDH or L1 levels. Single values (circles) and mean values (line) from 3 independent experiments are shown for the levels of Nr2f6, Snca and Lrp2 proteins.
Figure Legend Snippet: NCAM fragments without or with PSA regulate the protein expression of Snca and Lrp2 or Nr2f6. Cerebellar neurons from wild-type mice were treated for 30 or 180 min without (−Ab) or with function-triggering guinea pig NCAM antibody (+Ab). Cell lysates were subjected to immunoblot (IB) analysis with antibodies against Nr2f6 ( a ), Snca ( b ), Lrp2 ( c ) protein or against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ( a , b ) or L1 ( c ) to control gel loading. ( a – c ) Representative immunoblots out of three independent experiments are shown. For clarity, only parts of the blot with Nr2f6-, Lrp2-, Snca-, GAPDH-, and L1-positive bands are shown. The Lrp2 immunoblot ( c ) is shown after long exposure time (upper panel) and short exposure (lower panel). Full-length Lrp2 (~600 kDa) and the 60 kDa Lrp2 fragment are indicated by arrows. ( d) Levels of Nr2f6 and Snca as well as the sums of the full-length Lrp2 and the 60 kDa Lrp2 fragment levels were quantified by densitometry and normalized to GAPDH or L1 levels. Single values (circles) and mean values (line) from 3 independent experiments are shown for the levels of Nr2f6, Snca and Lrp2 proteins.

Techniques Used: Expressing, Mouse Assay, Western Blot

28) Product Images from "GPE Promotes the Proliferation and Migration of Mouse Embryonic Neural Stem Cells and Their Progeny In Vitro"

Article Title: GPE Promotes the Proliferation and Migration of Mouse Embryonic Neural Stem Cells and Their Progeny In Vitro

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms18061280

Both GPE and GH stimulate Akt and extracellular signal-regulated kinase (ERK) phosphorylation. Cells were serum-starved and treated with GPE (100 µM), GH (500 ng/mL), or GPE + GH for the indicated times. ( A – C ) Akt, phospho-Akt, ERK, phospho-ERK, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) immunoreactivities were determined by western blot; ( D ) Densitometric analysis of results presented in panels ( A , C ). Results are shown as the pAkt/Akt ( upper ) or pERK/ERK ratio ( lower ); ( E , F ) Akt and ERK phosphorylation were investigated in the presence of the specific inhibitors LY294002 (LY) and U0126 (U). C+ indicates the positive control (not serum-starved cells); ( G ) Densitometric analysis of results presented in panels A to C . Results are shown as the pAkt/Akt ( upper ) or pERK/ERK ratio ( lower ).
Figure Legend Snippet: Both GPE and GH stimulate Akt and extracellular signal-regulated kinase (ERK) phosphorylation. Cells were serum-starved and treated with GPE (100 µM), GH (500 ng/mL), or GPE + GH for the indicated times. ( A – C ) Akt, phospho-Akt, ERK, phospho-ERK, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) immunoreactivities were determined by western blot; ( D ) Densitometric analysis of results presented in panels ( A , C ). Results are shown as the pAkt/Akt ( upper ) or pERK/ERK ratio ( lower ); ( E , F ) Akt and ERK phosphorylation were investigated in the presence of the specific inhibitors LY294002 (LY) and U0126 (U). C+ indicates the positive control (not serum-starved cells); ( G ) Densitometric analysis of results presented in panels A to C . Results are shown as the pAkt/Akt ( upper ) or pERK/ERK ratio ( lower ).

Techniques Used: Western Blot, Positive Control

Related Articles

MTT Assay:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: The methylthiazol tetrazolium reduction (MTT) testing kit was purchased from Promega (Madison, WI). .. The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Flow Cytometry:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). .. The Annexin V-fluorescein isothiocyanate (FITC) kit for detection of apoptosis by flow cytometry was purchased from BD Biosciences (San Jose, CA), and Propidium Iodide (PI) from Life technologies (Grand Island, NY).

Recombinant:

Article Title: Prolactin Inhibits BCL6 Expression in Breast Cancer Cells through a MicroRNA-339-5p-Dependent Pathway
Article Snippet: Reagents and antibodies Antibodies against BCL6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were obtained from Santa Cruz Biotechnology (Santa Cruz, USA). .. Cells were treated with 10 nM recombinant human PRL (ProSpec-Tany TechnoGene, Rehovot, Israel).

Article Title: Chaperone-Mediated Autophagy Promotes Beclin1 Degradation in Persistently Infected Hepatitis C Virus Cell Culture
Article Snippet: Antibodies to ATF6α, total Nrf2, p62, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). .. Recombinant GAPDH (G2267) and epidermal growth factor (EGF) were purchased from Sigma-Aldrich (St. Louis, MO).

Radio Immunoprecipitation:

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Western blot analysis of C5aR Following decapitation, rat brains were immediately removed surgically, the pituitary identified and excised, homogenised in ice-cold radio immunoprecipitation assay (RIPA) buffer (Upstate, Temecula, CA, USA) and subjected to BCA Protein Assay analysis (Thermo Scientific, Rockford, IL, USA) for equal protein loading. .. Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein.

Protease Inhibitor:

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: Total proteins were extracted by incubating the cells for 30 min on ice in RIPA buffer containing a 1:100 dilution of a protease inhibitor cocktail (Sigma-Aldrich, Inc., St. Louis, MO, United States). .. Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody.

Centrifugation:

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: After 20 min centrifugation at 14 000 rpm at 4 °C, extracts were normalized to total protein content, determined using the BCA Reagent (Sigma-Aldrich, Inc., St. Louis, MO, United States). .. Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody.

Western Blot:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: Antibodies used in Western blots for detection of Caspase 3 and 7, pBCR-ABL, pStat5, and pCrkL were purchased from Cell Signaling (Danvers, MA). .. The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Article Title: Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis
Article Snippet: Paragraph title: 3. Western blot analysis ... Membranes were then incubated with antibodies against α-SMA (1:5,000, sc-53015; Santa Cruz Biotechnology, Dallas, TX, USA), fibronectin (1:100, sc-8422; Santa Cruz Biotechnology), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:3,000, sc-47724; Santa Cruz Biotechnology) at 4°C overnight.

Article Title: Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition
Article Snippet: Paragraph title: Western blotting ... The primary antibodies against glucocorticoid receptor (#12041), Akt (#9272), phospho-Akt (Ser-473, #9271), 70-kDa ribosomal S6 kinase 1 (S6K1) (#9202), phospho-S6K1 (Thr-389, #9205), FOXO1 (#2880), phospho-FOXO1 (Ser-256, #9461), FOXO3a (#12829), phospho-FOXO3a (Ser-253, #13129) were purchased from Cell Signaling Technology (Boston, MA, USA) and the primary antibodies against β2 -adrenergic receptor (β2 -AR) (sc-569), insulin growth factor 1 (IGF1) (sc-9013), myostatin (sc-6885-R), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-25778), n uclear f actor of a ctivated T cells (NFAT) c1 (sc-13033), phospho-NFATc1 (Ser-259, sc-32979), NFATc3 (sc-8321), phospho-NFATc3 (Ser-265, sc-32982), and modulatory calcineurin-interacting protein 1 (sc-66864) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors
Article Snippet: Paragraph title: Western blot ... To ensure equal protein loading between lanes, the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1∶1000, Santa Cruz) was determined for each blot.

Article Title: Proteome of human colon cancer stem cells: A comparative analysis
Article Snippet: .. The antibodies used for Western blotting were CD133, CD29, Musashi-1, ABCG2, TERT and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA). .. Cultured SW1116 cells were harvested, washed with PBS, and lysed in a lysis buffer containing 8 mol/L urea, 4% CHAPS, 40 mmol/L Tris, 65 mmol/L DTT, 2% Bio-Lytes+ and centrifuged at 25 000 × g for 1 h at 4°C.

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: Paragraph title: Western blotting ... Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody.

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Paragraph title: Western blot analysis of C5aR ... Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein.

Cytometry:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). .. The Annexin V-fluorescein isothiocyanate (FITC) kit for detection of apoptosis by flow cytometry was purchased from BD Biosciences (San Jose, CA), and Propidium Iodide (PI) from Life technologies (Grand Island, NY).

Cell Culture:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: Paragraph title: Reagents and cell culture ... The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Article Title: Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells
Article Snippet: Paragraph title: 4.1. Cell Culture and Reagents ... Antibodies against phosphor-checkpoint kinase 2 (Chk2) (Thr68), Chk2, poly [ADP-ribose] polymerase 1 (PARP-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA).

Article Title: Chaperone-Mediated Autophagy Promotes Beclin1 Degradation in Persistently Infected Hepatitis C Virus Cell Culture
Article Snippet: Paragraph title: Cell Culture, Antibodies, and Chemicals ... Antibodies to ATF6α, total Nrf2, p62, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Article Title: miR-506 suppresses neuroblastoma metastasis by targeting ROCK1
Article Snippet: Paragraph title: Cell culture and antibodies ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Mouse Assay:

Article Title: Intermedin1–53 Protects Against Myocardial Fibrosis by Inhibiting Endoplasmic Reticulum Stress and Inflammation Induced by Homocysteine in Apolipoprotein E-Deficient Mice
Article Snippet: Male ApoE-/- mice (25 ± 1 g) were obtained from the Animal Center, Peking University Health Science Center (Beijing). .. Antibodies for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), α -smooth muscle actin (α -SMA), tumor necrosis factor-α (TNF-α ), interleukin-6 (IL-6), IL-1α , monocyte chemotactic protein-1 (MCP-1), and all secondary antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Electrophoresis:

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Total protein from pituitary lysates (50 μg) was separated by electrophoresis in a denaturing 12% polyacrylamide gel and then transferred to a polyvinylidene fluoride membrane. .. Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein.

Incubation:

Article Title: Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis
Article Snippet: .. Membranes were then incubated with antibodies against α-SMA (1:5,000, sc-53015; Santa Cruz Biotechnology, Dallas, TX, USA), fibronectin (1:100, sc-8422; Santa Cruz Biotechnology), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:3,000, sc-47724; Santa Cruz Biotechnology) at 4°C overnight. .. Following incubation, membranes were washed with TBS with Tween-20.

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors
Article Snippet: Blots were then incubated in horseradish peroxidase-conjugated anti-mouse (1∶3000, Cell Signaling Technology), horseradish peroxidase-conjugated anti-rabbit (1∶3000, Cell Signaling Technology), horseradish peroxidase-conjugated anti-rat (1∶3000, Santa Cruz, Santa Cruz, USA), or horseradish peroxidase-conjugated anti-goat (1∶3000, Santa Cruz). .. To ensure equal protein loading between lanes, the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1∶1000, Santa Cruz) was determined for each blot.

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: .. Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody. .. Expression of proteins was normalized to the expression of GAPDH.

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein. .. Following washing in TBST, the membrane was incubated with rabbit anti-rat C5aR antibody (kindly provided by P.A.

Expressing:

Article Title: Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis
Article Snippet: Western blot analysis Western blotting was performed to evaluate the protein expression levels of α-SMA and fibronectin. .. Membranes were then incubated with antibodies against α-SMA (1:5,000, sc-53015; Santa Cruz Biotechnology, Dallas, TX, USA), fibronectin (1:100, sc-8422; Santa Cruz Biotechnology), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:3,000, sc-47724; Santa Cruz Biotechnology) at 4°C overnight.

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors
Article Snippet: .. Changes in gene expression levels were determined using beta-2-microglobulin (B2M) as the normalization gene in primary mammary cells in culture and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the normalization gene in non-tumor and tumor tissue. ..

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody. .. Expression of proteins was normalized to the expression of GAPDH.

Protein Concentration:

Article Title: Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition
Article Snippet: The supernatant was collected and the protein concentration was measured using a DC protein assay kit (Bio-Rad, Hercules, CA, USA). .. The primary antibodies against glucocorticoid receptor (#12041), Akt (#9272), phospho-Akt (Ser-473, #9271), 70-kDa ribosomal S6 kinase 1 (S6K1) (#9202), phospho-S6K1 (Thr-389, #9205), FOXO1 (#2880), phospho-FOXO1 (Ser-256, #9461), FOXO3a (#12829), phospho-FOXO3a (Ser-253, #13129) were purchased from Cell Signaling Technology (Boston, MA, USA) and the primary antibodies against β2 -adrenergic receptor (β2 -AR) (sc-569), insulin growth factor 1 (IGF1) (sc-9013), myostatin (sc-6885-R), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-25778), n uclear f actor of a ctivated T cells (NFAT) c1 (sc-13033), phospho-NFATc1 (Ser-259, sc-32979), NFATc3 (sc-8321), phospho-NFATc3 (Ser-265, sc-32982), and modulatory calcineurin-interacting protein 1 (sc-66864) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Modification:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: Reagents and cell culture Iscove's Modified Dulbecco's Medium (IMDM), heat-activated fetal bovine serum (FBS), and antibiotic/antifungal reagents were purchased from Life technologies (Grand Island, NY). .. The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Article Title: Sulforaphane prevents doxorubicin-induced oxidative stress and cell death in rat H9c2 cells
Article Snippet: Antibodies against cytochrome c (sc-13156), Bcl-2 (sc-7382), HO-1 (sc-10789), histone H3 (sc-8654), Nrf2 (sc-722), Keap1 (sc-365626), Hsp60 (sc-13966) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-25778) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). .. Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), trypsin and other tissue culture reagents were obtained from Invitrogen Life Technologies, Inc. (Carlsbad, CA, USA).

Article Title: miR-506 suppresses neuroblastoma metastasis by targeting ROCK1
Article Snippet: IMR-32, N2A, SK-N-SH and SH-SY5Y cells were originally obtained from the American Type Culture Collection (Manassas, VA, USA), and were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA). .. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Caspase-Glo Assay:

Article Title: Kaempferol Induces G2/M Cell Cycle Arrest via Checkpoint Kinase 2 and Promotes Apoptosis via Death Receptors in Human Ovarian Carcinoma A2780/CP70 Cells
Article Snippet: Caspase-Glo® 3/7 Assay Systems, Caspase-Glo® 8 Assay Systems and Caspase-Glo® 9 Assay Systems were purchased from Promega (Madison, WI, USA). .. Antibodies against phosphor-checkpoint kinase 2 (Chk2) (Thr68), Chk2, poly [ADP-ribose] polymerase 1 (PARP-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA).

Lysis:

Article Title: Givinostat, a type II histone deacetylase inhibitor, induces potent caspase-dependent apoptosis in human lymphoblastic leukemia
Article Snippet: The antibodies for detection of Checkpoint kinase 1 (CHK1), cyclin-dependent kinase inhibitor 1 (p21, or p21Cip1, or p21Waf1), tumor protein p53 (p53, DO-1), Poly (ADP-Ribose) Polymerase 1 (PARP1) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). .. Phosphate-buffered saline (PBS) and Radioimmunoprecipitation (RIPA) lysis buffer were purchased from Santa Cruz.

Binding Assay:

Article Title: Chaperone-Mediated Autophagy Promotes Beclin1 Degradation in Persistently Infected Hepatitis C Virus Cell Culture
Article Snippet: Antibodies to glucose-regulated protein 78 [binding immunoglobulin protein (BiP)], PERK, IRE1α, Beclin1, β-actin, autophagy-related 7 (ATG7), autophagy-related 16-like 1 (ATG16L1), Rab5, Rab7, VPS34, LAMP1, light chain 3B (LC3B), EGFR, phosphorylated EGFR, and Hsc70 were obtained from Cell Signaling (Beverly, MA). .. Antibodies to ATF6α, total Nrf2, p62, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein. .. Non-specific binding sites were blocked with Tris-buffered saline Tween-20 (TBST) plus 5% nonfat dry milk for one hour at room temperature.

BIA-KA:

Article Title: Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats
Article Snippet: After 20 min centrifugation at 14 000 rpm at 4 °C, extracts were normalized to total protein content, determined using the BCA Reagent (Sigma-Aldrich, Inc., St. Louis, MO, United States). .. Equal amounts of total protein-were separated in 4%-12% bis-tris (BT) gels (NuPAGE, Gibco-BRL Life Technologies, Grand Island, NY), blotted onto Hybond C extra membranes, blocked overnight in 5% milk, and incubated with antibodies against α smooth muscle actin (αSMA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA, United States) and then incubated with horseradish peroxidase-conjugated secondary antibody.

Article Title: Inhibition of complement C5a prevents breakdown of the blood-brain barrier and pituitary dysfunction in experimental sepsis
Article Snippet: Western blot analysis of C5aR Following decapitation, rat brains were immediately removed surgically, the pituitary identified and excised, homogenised in ice-cold radio immunoprecipitation assay (RIPA) buffer (Upstate, Temecula, CA, USA) and subjected to BCA Protein Assay analysis (Thermo Scientific, Rockford, IL, USA) for equal protein loading. .. Equal loading was confirmed by detection of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Santa Cruz, CA, USA) as a 'housekeeping' protein.

SDS Page:

Article Title: Docosahexaenoic Acid Inhibits Expression of Fibrotic Mediators in Mice With Chronic Pancreatitis
Article Snippet: Pancreatic tissue homogenates (120 μg protein/lane) were separated by 8% to 12% SDS-PAGE and transferred onto nitrocellulose membranes (Amersham Inc., Arlington Heights, IL, USA) by electroblotting. .. Membranes were then incubated with antibodies against α-SMA (1:5,000, sc-53015; Santa Cruz Biotechnology, Dallas, TX, USA), fibronectin (1:100, sc-8422; Santa Cruz Biotechnology), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:3,000, sc-47724; Santa Cruz Biotechnology) at 4°C overnight.

Article Title: Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition
Article Snippet: Equal amounts of protein (5 μg) were subjected to 12.5% SDS-PAGE and blotted onto 0.2 mm PVDF membrane (Millipore, Billerica, MA, USA). .. The primary antibodies against glucocorticoid receptor (#12041), Akt (#9272), phospho-Akt (Ser-473, #9271), 70-kDa ribosomal S6 kinase 1 (S6K1) (#9202), phospho-S6K1 (Thr-389, #9205), FOXO1 (#2880), phospho-FOXO1 (Ser-256, #9461), FOXO3a (#12829), phospho-FOXO3a (Ser-253, #13129) were purchased from Cell Signaling Technology (Boston, MA, USA) and the primary antibodies against β2 -adrenergic receptor (β2 -AR) (sc-569), insulin growth factor 1 (IGF1) (sc-9013), myostatin (sc-6885-R), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-25778), n uclear f actor of a ctivated T cells (NFAT) c1 (sc-13033), phospho-NFATc1 (Ser-259, sc-32979), NFATc3 (sc-8321), phospho-NFATc3 (Ser-265, sc-32982), and modulatory calcineurin-interacting protein 1 (sc-66864) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Article Title: Wnt5a Suppresses Tumor Formation and Redirects Tumor Phenotype in MMTV-Wnt1 Tumors
Article Snippet: 15 µg of the protein lysate was separated on either an 8% SDS-PAGE gel or an Any kD Mini-Protean TGX Gel (Biorad) and transferred to a polyvinylidene fluoride membrane (Bio-Rad) using the semi-dry transfer technique. .. To ensure equal protein loading between lanes, the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1∶1000, Santa Cruz) was determined for each blot.

Article Title: Proteome of human colon cancer stem cells: A comparative analysis
Article Snippet: Cellular extracts containing 50 μg total protein were subjected to 10% SDS-PAGE, and then transferred electrophoretically to polyvinylidene difluoride membranes (Invitrogen, Carlsbad, CA, USA). .. The antibodies used for Western blotting were CD133, CD29, Musashi-1, ABCG2, TERT and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology, Santa Cruz, CA).

DC Protein Assay:

Article Title: Protective Effects of Clenbuterol against Dexamethasone-Induced Masseter Muscle Atrophy and Myosin Heavy Chain Transition
Article Snippet: The supernatant was collected and the protein concentration was measured using a DC protein assay kit (Bio-Rad, Hercules, CA, USA). .. The primary antibodies against glucocorticoid receptor (#12041), Akt (#9272), phospho-Akt (Ser-473, #9271), 70-kDa ribosomal S6 kinase 1 (S6K1) (#9202), phospho-S6K1 (Thr-389, #9205), FOXO1 (#2880), phospho-FOXO1 (Ser-256, #9461), FOXO3a (#12829), phospho-FOXO3a (Ser-253, #13129) were purchased from Cell Signaling Technology (Boston, MA, USA) and the primary antibodies against β2 -adrenergic receptor (β2 -AR) (sc-569), insulin growth factor 1 (IGF1) (sc-9013), myostatin (sc-6885-R), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-25778), n uclear f actor of a ctivated T cells (NFAT) c1 (sc-13033), phospho-NFATc1 (Ser-259, sc-32979), NFATc3 (sc-8321), phospho-NFATc3 (Ser-265, sc-32982), and modulatory calcineurin-interacting protein 1 (sc-66864) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Santa Cruz Biotechnology mouse anti bax
    Cisplatin treatment in miR-203 knockdown MCF-7 cells enhances <t>p53</t> and <t>Bax</t> expression. MCF-anti-miR-203 and MCF-Cont cells were treated with cisplatin for 48 hours. Cell lysates were analyzed for p53 (A) and p21 and Bax (B) expression. The blot was reprobed with an antibody to actin for comparison of equal protein load.
    Mouse Anti Bax, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 98/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti bax/product/Santa Cruz Biotechnology
    Average 98 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    mouse anti bax - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    99
    Santa Cruz Biotechnology gapdh
    <t>RanGAP1</t> RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with <t>GAPDH</t> normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.
    Gapdh, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gapdh/product/Santa Cruz Biotechnology
    Average 99 stars, based on 129 article reviews
    Price from $9.99 to $1999.99
    gapdh - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh
    Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH).</t>
    Antibodies Against Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Santa Cruz Biotechnology
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    antibodies against glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Santa Cruz Biotechnology anti bax antibody
    Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and <t>p53.</t> MPTQ treatment also upregulates <t>Bax</t> protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.
    Anti Bax Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti bax antibody/product/Santa Cruz Biotechnology
    Average 99 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    anti bax antibody - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Cisplatin treatment in miR-203 knockdown MCF-7 cells enhances p53 and Bax expression. MCF-anti-miR-203 and MCF-Cont cells were treated with cisplatin for 48 hours. Cell lysates were analyzed for p53 (A) and p21 and Bax (B) expression. The blot was reprobed with an antibody to actin for comparison of equal protein load.

    Journal: Genes & Cancer

    Article Title: Anti-miR-203 Upregulates SOCS3 Expression in Breast Cancer Cells and Enhances Cisplatin Chemosensitivity

    doi: 10.1177/1947601911425832

    Figure Lengend Snippet: Cisplatin treatment in miR-203 knockdown MCF-7 cells enhances p53 and Bax expression. MCF-anti-miR-203 and MCF-Cont cells were treated with cisplatin for 48 hours. Cell lysates were analyzed for p53 (A) and p21 and Bax (B) expression. The blot was reprobed with an antibody to actin for comparison of equal protein load.

    Article Snippet: Mouse anti-p53-HRP, mouse anti-p21, mouse anti-Bax, rabbit anti-SOCS3, and goat anti-actin-HRP antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Expressing

    RanGAP1 RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with GAPDH normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.

    Journal: PLoS ONE

    Article Title: Ran GTPase-Activating Protein 1 Is a Therapeutic Target in Diffuse Large B-Cell Lymphoma

    doi: 10.1371/journal.pone.0079863

    Figure Lengend Snippet: RanGAP1 RNA interference increased tumor cell death and cell-cycle arrest but had no effect on non-neoplastic LCL cells. ( A ) After transfection, the effect of inhibiting RanGAP1 was evaluated in the LCL (upper panel), HT (middle panel), and SU-DHL-5 cell lines (lower panel) for cell death, measured using annexin V and PI (propidium iodide). LCL cells show no difference in cell apoptosis between control vector (9.5%) and shRANGAP1 (RANGAP1-specific shRNA) (10.2%; NS, not significant). In contrast, apoptosis was higher in the HT (vector, 40.9% vs. shRANGAP1, 60.2%, p = 0.035) and SU-DHL-5 cell lines (vector, 43.0% vs. shRANGAP1, 59.2%, p = 0.037). None: non-transfected maternal cells. ( B ) Cell-cycle analysis shows no effect on LCL (left panel, 1: G0/G1, vector, 49.4% vs. shRANGAP1, 46.9%; 2: G2/M, vector, 9.3% vs. shRANGAP1, 8.9%; NS, not significant), but it does show G0/G1 cell-cycle arrest in SU-DHL-5 cells (right panel, M1: G0/G1, vector, 38.5% vs. shRANGAP1, 48.8%; M2: G2/M, vector, 19.0% vs. shRANGAP1, 7.5%, p = 0.030). ( C ) Western blotting shows a marked decrease (vector, 1.0 vs. shRANGAP1, 0.2 with GAPDH normalization) of RanGAP1 expression in SU-DHL-5 and HT (vector, 1.0 vs. shRANGAP1, 0.4) after RNA interference of RANGAP1 by shRNA.

    Article Snippet: The ratio was expressed as the amount of RanGAP1 divided by the corresponding amount of GAPDH (glyceraldehyde 3-phosphate dehydrogenase, 1:5000, 6C5, sc-32233; Santa Cruz) using an imaging analyzer (White Light Transilluminator; Bio-Rad Laboratories, Hercules, CA, USA).

    Techniques: Transfection, Plasmid Preparation, shRNA, Cell Cycle Assay, Western Blot, Expressing

    Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

    Journal: International Journal of Molecular Sciences

    Article Title: Low Amount of Salinomycin Greatly Increases Akt Activation, but Reduces Activated p70S6K Levels

    doi: 10.3390/ijms140917304

    Figure Lengend Snippet: Low concentration of Sal highly activates Akt. Hs578T cell extracts were collected at ( A ) 12 h and ( B ) 24 h after treatment with 0.5 μM Sal or from Dimethylsulfoxide (DMSO)-treated samples (Con). Western blot analyses were performed using antibodies against pJnk1, pAkt, Akt, PI3K, Jnk1, pp38, p38, pJak2, Jak2, pErk1/2, Erk1/2, pIKKα/β, Jak1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

    Article Snippet: Antibodies against glyceraldehyde 3-phosphate dehydrogenase (GAPDH), phosphorylated p38, p38, Erk1/2, Jak1, Jak2, survivin, and pRb were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Techniques: Concentration Assay, Western Blot

    Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and p53. MPTQ treatment also upregulates Bax protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.

    Journal: PLoS ONE

    Article Title: A Novel Anticancer Agent, 8-Methoxypyrimido[4?,5?:4,5]thieno(2,3-b) Quinoline-4(3H)-One Induces Neuro 2a Neuroblastoma Cell Death through p53-Dependent, Caspase-Dependent and -Independent Apoptotic Pathways

    doi: 10.1371/journal.pone.0066430

    Figure Lengend Snippet: Working model of MPTQ-mediated apoptosis in neuro 2a neuroblastoma cells. MPTQ activates ATM (an indicator of DNA double strand breaks) and p53. MPTQ treatment also upregulates Bax protein level which activates caspase-dependent intrinsic apoptosis pathway by activating caspase-9 followed by caspase-3 and -7 which in turn inactivates PARP. Caspase-independent intrinsic apoptosis pathway was also activated by nuclear translocation of AIF. MOMP = mitochondrial outer membrane permeabilization.

    Article Snippet: Mouse anti-GAPDH antibody (6C5, monoclonal; SC32233), mouse anti-PARP-1 antibody (C2-10, monoclonal; S53643), rabbit anti-phopho-p53 (Ser20) antibody (SC-21872-R), Goat anti-AIF antibody (SC-9416) and anti-Bax antibody (SC-526) were purchased from Santa Cruz Biotechnology (Santa Cruz, USA).

    Techniques: Translocation Assay