glutamax  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher glutamax
    Media supplementation can influence the health and growth of the parasite. ( A ) Parasitemia graph showing the effect of <t>GlutaMAX</t> on parasitemia at different time points using three independent biologicals P . vivax Sal-1 parasites from MN23062a and b and MN23009a. Reticulocytes from hemochromatosis patients enriched by density were used for these experiments. ( B ) Histogram comparing parasite stages at different time points from the parasites in A: ( C ) Conversion percentages of rings to trophozoites and trophozoites to schizonts in media supplemented with or without GlutaMAX. Data from the three independent biological replicates in A. Error bars represent the standard error. While the parasitemia differences are not statically significant, we did observed a longer persistence of parasites in the cultures supplemented with GlutaMAX and we did observed reinvasion only in the GlutaMAX culture.
    Glutamax, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glutamax/product/Thermo Fisher
    Average 99 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    glutamax - by Bioz Stars, 2022-10
    99/100 stars

    Images

    1) Product Images from "Insights into an Optimization of Plasmodium vivax Sal-1 In Vitro Culture: The Aotus Primate Model"

    Article Title: Insights into an Optimization of Plasmodium vivax Sal-1 In Vitro Culture: The Aotus Primate Model

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0004870

    Media supplementation can influence the health and growth of the parasite. ( A ) Parasitemia graph showing the effect of GlutaMAX on parasitemia at different time points using three independent biologicals P . vivax Sal-1 parasites from MN23062a and b and MN23009a. Reticulocytes from hemochromatosis patients enriched by density were used for these experiments. ( B ) Histogram comparing parasite stages at different time points from the parasites in A: ( C ) Conversion percentages of rings to trophozoites and trophozoites to schizonts in media supplemented with or without GlutaMAX. Data from the three independent biological replicates in A. Error bars represent the standard error. While the parasitemia differences are not statically significant, we did observed a longer persistence of parasites in the cultures supplemented with GlutaMAX and we did observed reinvasion only in the GlutaMAX culture.
    Figure Legend Snippet: Media supplementation can influence the health and growth of the parasite. ( A ) Parasitemia graph showing the effect of GlutaMAX on parasitemia at different time points using three independent biologicals P . vivax Sal-1 parasites from MN23062a and b and MN23009a. Reticulocytes from hemochromatosis patients enriched by density were used for these experiments. ( B ) Histogram comparing parasite stages at different time points from the parasites in A: ( C ) Conversion percentages of rings to trophozoites and trophozoites to schizonts in media supplemented with or without GlutaMAX. Data from the three independent biological replicates in A. Error bars represent the standard error. While the parasitemia differences are not statically significant, we did observed a longer persistence of parasites in the cultures supplemented with GlutaMAX and we did observed reinvasion only in the GlutaMAX culture.

    Techniques Used:

    2) Product Images from "Expressed therapeutic protein yields are predicted by transiently transfected mammalian cell population"

    Article Title: Expressed therapeutic protein yields are predicted by transiently transfected mammalian cell population

    Journal: bioRxiv

    doi: 10.1101/2022.03.15.484372

    Transfected suspension cell population expressing green fluorescent reporter protein 1 h prior transfection 600,000-750,000 suspension cells per well were seeded on a 24-well plate in 500 μl of serum free media. For CHO cells Xell CHO TF media was used, and for HEK293FT cells Gibco Freestyle293 media was used. Both media were supplemented with GlutaMAX. The a) CHO-K1 and b) HEK293FT cells were transfected with CPP/pDNA complexes. 0.75 μg of green fluorescent protein encoding plasmid pGFP was used per well. As a control wells with cells treated with pDNA at the same dose were used. Reporter protein (GFP) expressing cell population was detected by flow cytometry 1 to 5 days post-transfection. c) The percentage of green fluorescent protein expressing cell population detected from suspension CHO-K1 cells 24 h and 48 h post-transfection of 0.75 μg of pGFP.
    Figure Legend Snippet: Transfected suspension cell population expressing green fluorescent reporter protein 1 h prior transfection 600,000-750,000 suspension cells per well were seeded on a 24-well plate in 500 μl of serum free media. For CHO cells Xell CHO TF media was used, and for HEK293FT cells Gibco Freestyle293 media was used. Both media were supplemented with GlutaMAX. The a) CHO-K1 and b) HEK293FT cells were transfected with CPP/pDNA complexes. 0.75 μg of green fluorescent protein encoding plasmid pGFP was used per well. As a control wells with cells treated with pDNA at the same dose were used. Reporter protein (GFP) expressing cell population was detected by flow cytometry 1 to 5 days post-transfection. c) The percentage of green fluorescent protein expressing cell population detected from suspension CHO-K1 cells 24 h and 48 h post-transfection of 0.75 μg of pGFP.

    Techniques Used: Transfection, Expressing, Plasmid Preparation, Flow Cytometry

    3) Product Images from "Metformin and temozolomide act synergistically to inhibit growth of glioma cells and glioma stem cells in vitro and in vivo"

    Article Title: Metformin and temozolomide act synergistically to inhibit growth of glioma cells and glioma stem cells in vitro and in vivo

    Journal: Oncotarget

    doi:

    Identification, characterization and differentiation GSCs After primary spheres formation was noted, the primary gliospheres were dissociated and sub-cultured in NBM with B27, N2, glutaMAX,2 μg/ml heparin and 20 ng/ml EGF+bFGF for 7 days, immunocytochemical staining of the cancer stem cell marker CD133 A. and the neural progenitor markers nestin B. in U87 GSCs and U251 GSCs. For immunostaining of differentiated tumor cells, gliospheres were tanslated to DMEM with 10% FBS for another 7 days, then the U87 and U251 glioma cells immunostained with β-tubulin-III and GFAP C. The fluorescent signals were detected and photographed (× 200) with a fluorescence microscope (Olympus IX51,Japan).
    Figure Legend Snippet: Identification, characterization and differentiation GSCs After primary spheres formation was noted, the primary gliospheres were dissociated and sub-cultured in NBM with B27, N2, glutaMAX,2 μg/ml heparin and 20 ng/ml EGF+bFGF for 7 days, immunocytochemical staining of the cancer stem cell marker CD133 A. and the neural progenitor markers nestin B. in U87 GSCs and U251 GSCs. For immunostaining of differentiated tumor cells, gliospheres were tanslated to DMEM with 10% FBS for another 7 days, then the U87 and U251 glioma cells immunostained with β-tubulin-III and GFAP C. The fluorescent signals were detected and photographed (× 200) with a fluorescence microscope (Olympus IX51,Japan).

    Techniques Used: Cell Culture, Staining, Marker, Immunostaining, Fluorescence, Microscopy

    4) Product Images from "In vitro Lipolysis and Leptin Production of Elephant Seal Blubber Using Precision-Cut Adipose Tissue Slices"

    Article Title: In vitro Lipolysis and Leptin Production of Elephant Seal Blubber Using Precision-Cut Adipose Tissue Slices

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2020.615784

    Lipolytic treatments. Four different conditions were tested: (A) Lipolytic condition with a low glucose concentration “Lipolysis Low Glucose (LLG)” (culture medium with 1 g/L glucose, 5% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 1 μM isoproterenol and 2% (w:v) albumin), (B) Lipolytic condition with a high glucose concentration “Lipolysis High Glucose (LHG)” (culture medium with 4.5 g/L glucose, 5% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 1 μM isoproterenol and 2% (w:v) albumin), (C) Non-lipolytic condition (“No Lipolysis (NL)”) (culture medium with 4.5 g/L glucose, 10% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 2 mM Glutamax and 100 pg/mL insulin), and (D) Non-lipolytic condition (NL) followed by lipolysis (LLG) after 39 h of culture. The different media were collected and replaced by fresh media after 15 and 39 h of culture. Media were finally harvested after 63 h of culture.
    Figure Legend Snippet: Lipolytic treatments. Four different conditions were tested: (A) Lipolytic condition with a low glucose concentration “Lipolysis Low Glucose (LLG)” (culture medium with 1 g/L glucose, 5% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 1 μM isoproterenol and 2% (w:v) albumin), (B) Lipolytic condition with a high glucose concentration “Lipolysis High Glucose (LHG)” (culture medium with 4.5 g/L glucose, 5% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 1 μM isoproterenol and 2% (w:v) albumin), (C) Non-lipolytic condition (“No Lipolysis (NL)”) (culture medium with 4.5 g/L glucose, 10% (v:v) fetal bovine serum, antibiotic and antifungal mixture, 2 mM Glutamax and 100 pg/mL insulin), and (D) Non-lipolytic condition (NL) followed by lipolysis (LLG) after 39 h of culture. The different media were collected and replaced by fresh media after 15 and 39 h of culture. Media were finally harvested after 63 h of culture.

    Techniques Used: Concentration Assay

    5) Product Images from "Photobiomodulation with a 660-Nanometer Light-Emitting Diode Promotes Cell Proliferation in Astrocyte Culture"

    Article Title: Photobiomodulation with a 660-Nanometer Light-Emitting Diode Promotes Cell Proliferation in Astrocyte Culture

    Journal: Cells

    doi: 10.3390/cells10071664

    The 660-nanometer LED Irradiation Schedule. ( A ) Representative image of LED irradiation. Graph showing that the LED irradiation was delivered at 660 nm; ( B ) Schema of the astrocyte culturing method and experimental schedule. From DIV0 to DIV6, cells were incubated in DMEM+ (DMEM, FBS, P/S [P = 5000 U/mL, S = 5000 μg/mL]). On DIV6, cells were subcultured for isolation of astrocytes. Cells were incubated in NB+ medium (Neurobasal, B27, GlutaMAX, P/S (P = 5000 U/mL, S = 5000 μg/mL)). The LED irradiation protocol was divided into the following two methods: irradiation on DIV7 only, and irradiation on both DIV7 and DIV10. Each colored circle denotes the sampling time for several experiments. The red circle indicates verification for cell differentiation evidence, and the blue and green circles indicate cell proliferation and ROS assay, respectively.
    Figure Legend Snippet: The 660-nanometer LED Irradiation Schedule. ( A ) Representative image of LED irradiation. Graph showing that the LED irradiation was delivered at 660 nm; ( B ) Schema of the astrocyte culturing method and experimental schedule. From DIV0 to DIV6, cells were incubated in DMEM+ (DMEM, FBS, P/S [P = 5000 U/mL, S = 5000 μg/mL]). On DIV6, cells were subcultured for isolation of astrocytes. Cells were incubated in NB+ medium (Neurobasal, B27, GlutaMAX, P/S (P = 5000 U/mL, S = 5000 μg/mL)). The LED irradiation protocol was divided into the following two methods: irradiation on DIV7 only, and irradiation on both DIV7 and DIV10. Each colored circle denotes the sampling time for several experiments. The red circle indicates verification for cell differentiation evidence, and the blue and green circles indicate cell proliferation and ROS assay, respectively.

    Techniques Used: Irradiation, Incubation, Isolation, Sampling, Cell Differentiation, ROS Assay

    6) Product Images from "Frequency and Diversity of Hybrid Escherichia coli Strains Isolated from Urinary Tract Infections"

    Article Title: Frequency and Diversity of Hybrid Escherichia coli Strains Isolated from Urinary Tract Infections

    Journal: Microorganisms

    doi: 10.3390/microorganisms9040693

    Biofilm formation with incubation period of 24 h, in Dulbecco Modified Essential Medium (DMEM) + GlutaMAX medium ( A ) and Lysogeny-Broth (LB) ( B ). Positive control: EAEC (enteroaggregative E. coli ) prototype strain 042; Negative control: non-adherent E. coli strain HB101. The absorbance reading was performed at 620 nm. The One-way ANOVA followed by post-hoc Tukey HSD test was used to compare the results. p values: *
    Figure Legend Snippet: Biofilm formation with incubation period of 24 h, in Dulbecco Modified Essential Medium (DMEM) + GlutaMAX medium ( A ) and Lysogeny-Broth (LB) ( B ). Positive control: EAEC (enteroaggregative E. coli ) prototype strain 042; Negative control: non-adherent E. coli strain HB101. The absorbance reading was performed at 620 nm. The One-way ANOVA followed by post-hoc Tukey HSD test was used to compare the results. p values: *

    Techniques Used: Incubation, Modification, Positive Control, Negative Control

    7) Product Images from "Bacillus anthracis spores germinate extracellularly at air–liquid interface in an in vitro lung model under serum‐free conditions"

    Article Title: Bacillus anthracis spores germinate extracellularly at air–liquid interface in an in vitro lung model under serum‐free conditions

    Journal: Journal of Applied Microbiology

    doi: 10.1111/jam.12872

    Assessment of Dulbecco's modified eagle medium (DMEM) media‐only conditions that alter spore proliferation rates after 24 hpi at 37°C, 5% CO 2 . Dashed line represents initial 10 000 spore input. (a) l ‐glutamine derivatives that include No glutamine (black bars‐■), l ‐glutamine (grey bars‐ ), Ultra‐glutamine (diagonal‐lined bars‐ ) and Glutamax ™ (white bars‐□) all supplemented at 2 mmol l −1 in either phosphate buffered saline or DMEM. (b) DMEM media preincubated overnight without cells (lane 1, white bar‐□) vs DMEM media preconditioned overnight in normal human bronchial epithelial cells (lane 2, grey bar‐ ) in addition to DMEM that lacks either d ‐glucose (lane 3, chequered bar‐ ) or l ‐glutamine (lane 4, black bar‐■). In all bar graphs standard deviation represents triplicate wells and no less than five collective plate counts. (c) Microscopy images 12 h of after addition of either fresh (top row) or used (bottom row) DMEM supplemented with either 2 mmol l −1 l ‐glutamine, Ultra‐glutamine (top row) or Glutamax ™ . Scale bar = 100 microns imaged with 40× objective for 400× total magnification. Arrows denote irregular bacilli structures measuring > 100 microns in length.
    Figure Legend Snippet: Assessment of Dulbecco's modified eagle medium (DMEM) media‐only conditions that alter spore proliferation rates after 24 hpi at 37°C, 5% CO 2 . Dashed line represents initial 10 000 spore input. (a) l ‐glutamine derivatives that include No glutamine (black bars‐■), l ‐glutamine (grey bars‐ ), Ultra‐glutamine (diagonal‐lined bars‐ ) and Glutamax ™ (white bars‐□) all supplemented at 2 mmol l −1 in either phosphate buffered saline or DMEM. (b) DMEM media preincubated overnight without cells (lane 1, white bar‐□) vs DMEM media preconditioned overnight in normal human bronchial epithelial cells (lane 2, grey bar‐ ) in addition to DMEM that lacks either d ‐glucose (lane 3, chequered bar‐ ) or l ‐glutamine (lane 4, black bar‐■). In all bar graphs standard deviation represents triplicate wells and no less than five collective plate counts. (c) Microscopy images 12 h of after addition of either fresh (top row) or used (bottom row) DMEM supplemented with either 2 mmol l −1 l ‐glutamine, Ultra‐glutamine (top row) or Glutamax ™ . Scale bar = 100 microns imaged with 40× objective for 400× total magnification. Arrows denote irregular bacilli structures measuring > 100 microns in length.

    Techniques Used: Modification, Standard Deviation, Microscopy

    8) Product Images from "Antivirulence Activity of the Human Gut Metabolome"

    Article Title: Antivirulence Activity of the Human Gut Metabolome

    Journal: mBio

    doi: 10.1128/mBio.01183-14

    Molecules from human feces strongly repress the invasion of cultured host cells by Salmonella . HeLa cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, and 1% GlutaMAX. Salmonella was grown in LB broth with or without the addition of an extract from human feces at a concentration that approximates the concentration present in feces (1×). Salmonella cultures were centrifuged, and cells were resuspended in phosphate-buffered saline and diluted in tissue culture medium. HeLa cells were infected at a multiplicity of infection of 10 for a total of 2 h at 37°C and 5% CO 2 . Cells were washed with buffer and lysed, and serial dilutions of the lysates were plated on LB plates for bacterial enumeration. Each dot on the graph represents the average of the results of two wells using an individual bacterial culture, for a total of 6 independent measurements ( n = 6). Bars show the averages of the results obtained. ***, P
    Figure Legend Snippet: Molecules from human feces strongly repress the invasion of cultured host cells by Salmonella . HeLa cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, and 1% GlutaMAX. Salmonella was grown in LB broth with or without the addition of an extract from human feces at a concentration that approximates the concentration present in feces (1×). Salmonella cultures were centrifuged, and cells were resuspended in phosphate-buffered saline and diluted in tissue culture medium. HeLa cells were infected at a multiplicity of infection of 10 for a total of 2 h at 37°C and 5% CO 2 . Cells were washed with buffer and lysed, and serial dilutions of the lysates were plated on LB plates for bacterial enumeration. Each dot on the graph represents the average of the results of two wells using an individual bacterial culture, for a total of 6 independent measurements ( n = 6). Bars show the averages of the results obtained. ***, P

    Techniques Used: Cell Culture, Modification, Concentration Assay, Infection

    9) Product Images from "In Vitro and In Vivo Characterization of MCT1 Inhibitor AZD3965 Confirms Preclinical Safety Compatible with Breast Cancer Treatment"

    Article Title: In Vitro and In Vivo Characterization of MCT1 Inhibitor AZD3965 Confirms Preclinical Safety Compatible with Breast Cancer Treatment

    Journal: Cancers

    doi: 10.3390/cancers13030569

    AZD3965 is not cytotoxic for proliferative breast-associated cells when glucose and glutamine are available as metabolic fuels. ( A ) Density of T47D, MCF7, MCF10A cells and BJ fibroblasts over time when cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate ( white circles ) or in medium containing 10 mmol/L sodium L -lactate, no glucose, no glutamine and 1% FBS (black circles) ( n = 8–16). ( B , C ) Cell density was assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( B ) Cell density over time after a single treatment (arrow) with vehicle or different doses of AZD3965 ( n = 8). ( C ) Cell density over time upon daily treatments (arrows) with vehicle or a given dose of AZD3965 ( n = 7–8). All data are shown as means ± SEM. *** p
    Figure Legend Snippet: AZD3965 is not cytotoxic for proliferative breast-associated cells when glucose and glutamine are available as metabolic fuels. ( A ) Density of T47D, MCF7, MCF10A cells and BJ fibroblasts over time when cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate ( white circles ) or in medium containing 10 mmol/L sodium L -lactate, no glucose, no glutamine and 1% FBS (black circles) ( n = 8–16). ( B , C ) Cell density was assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( B ) Cell density over time after a single treatment (arrow) with vehicle or different doses of AZD3965 ( n = 8). ( C ) Cell density over time upon daily treatments (arrows) with vehicle or a given dose of AZD3965 ( n = 7–8). All data are shown as means ± SEM. *** p

    Techniques Used: Cell Culture

    When MCT1 is used by proliferating cells to export lactate, AZD3965 induces an oxidative switch supporting ATP production in malignant but not in nonmalignant breast-associated cells. ( A ) Glycolytic efficiency of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate, calculated as the lactate production/glucose consumption ratio ( n = 3–5). ( B ) Glucose and lactate uptake over 24 h by untreated T47D, MCF7, MCF10A cells and BJ fibroblasts cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate (to determine basal glucose uptake, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine basal lactate uptake, grey bars) ( n = 3–5). ( C ) Basal mito OCR of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate (to determine glucose-dependent OCR, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine lactate-dependent OCR, grey bars) ( n = 11–22). ( D – K ) Cells were metabolically characterized in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( D ) Lactate release (right panel), pyruvate release (middle panel) and glucose uptake (right panel) over 24 h by T47D cells treated with increasing doses of AZD3965 ( n = 3–6). ( E ) As in D, but using MCF7 cells ( n = 3–6). ( F ) As in D, but using MCF10A cells ( n = 3–6). ( G ) As in D, but using BJ fibroblasts ( n = 3). ( H ) Basal mito OCR (left panel), maximal mito OCR (middle panel) and mito OCR linked to ATP production (right panel) of T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 9–12). ( I ) As in H, but using MCF7 cells ( n = 11). ( J ) As in H, but using MCF10A cells ( n = 11). ( K ) As in H, but using BJ fibroblasts ( n = 11–12). All data are shown as means ± SEM. * p
    Figure Legend Snippet: When MCT1 is used by proliferating cells to export lactate, AZD3965 induces an oxidative switch supporting ATP production in malignant but not in nonmalignant breast-associated cells. ( A ) Glycolytic efficiency of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate, calculated as the lactate production/glucose consumption ratio ( n = 3–5). ( B ) Glucose and lactate uptake over 24 h by untreated T47D, MCF7, MCF10A cells and BJ fibroblasts cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate (to determine basal glucose uptake, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine basal lactate uptake, grey bars) ( n = 3–5). ( C ) Basal mito OCR of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate (to determine glucose-dependent OCR, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine lactate-dependent OCR, grey bars) ( n = 11–22). ( D – K ) Cells were metabolically characterized in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( D ) Lactate release (right panel), pyruvate release (middle panel) and glucose uptake (right panel) over 24 h by T47D cells treated with increasing doses of AZD3965 ( n = 3–6). ( E ) As in D, but using MCF7 cells ( n = 3–6). ( F ) As in D, but using MCF10A cells ( n = 3–6). ( G ) As in D, but using BJ fibroblasts ( n = 3). ( H ) Basal mito OCR (left panel), maximal mito OCR (middle panel) and mito OCR linked to ATP production (right panel) of T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 9–12). ( I ) As in H, but using MCF7 cells ( n = 11). ( J ) As in H, but using MCF10A cells ( n = 11). ( K ) As in H, but using BJ fibroblasts ( n = 11–12). All data are shown as means ± SEM. * p

    Techniques Used: Cell Culture, Metabolic Labelling

    Proliferative breast-associated cells upregulate MCT4 expression upon MCT1 inhibition by AZD3965. ( A – D ) Cells were assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( A ) mRNA (left panel) and protein (middle and right panels) expression of MCT1, MCT2, MCT4 and CD147/basigin in T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 3–6 for RT-qPCR, n = 3 for WB). ( B ) As in A, but using MCF7 cells ( n = 3–6 for RT-qPCR, n = 6 for WB). ( C ) As in A, but using MCF10A cells ( n = 3–6 for RT-qPCR, n = 3–9 for WB). ( D ) As in A, but using BJ fibroblasts ( n = 3–6 for RT-qPCR, n = 3–6 for WB). All data are shown as means ± SEM. * p
    Figure Legend Snippet: Proliferative breast-associated cells upregulate MCT4 expression upon MCT1 inhibition by AZD3965. ( A – D ) Cells were assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( A ) mRNA (left panel) and protein (middle and right panels) expression of MCT1, MCT2, MCT4 and CD147/basigin in T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 3–6 for RT-qPCR, n = 3 for WB). ( B ) As in A, but using MCF7 cells ( n = 3–6 for RT-qPCR, n = 6 for WB). ( C ) As in A, but using MCF10A cells ( n = 3–6 for RT-qPCR, n = 3–9 for WB). ( D ) As in A, but using BJ fibroblasts ( n = 3–6 for RT-qPCR, n = 3–6 for WB). All data are shown as means ± SEM. * p

    Techniques Used: Expressing, Inhibition, Quantitative RT-PCR, Western Blot

    10) Product Images from "Synergistic phase separation of two pathways promotes integrin clustering and nascent adhesion formation"

    Article Title: Synergistic phase separation of two pathways promotes integrin clustering and nascent adhesion formation

    Journal: eLife

    doi: 10.7554/eLife.72588

    Integrin adhesion complexes are sensitive to solvent perturbations that alter phase separation. ( A ) Solution turbidity measurements of solution containing 250 nM each of Nck, N-WASP, pCas, FAK, and Paxillin in buffer containing 50 mM Hepes pH 7.3, 50 mM KCl and 0.1% BSA. Solution incubated at indicated temperatures of 30 min prior to measurements. ( B ) Total adhesion area per cell quantified from spinning disk images of endogenous paxillin. Cells were incubated at indicated temperatures for 10 min prior to fixation and paxillin immunostaining. ( C ) Representative spinning disk confocal microscopy images. ( D ) Turbidity measurements of solution containing 250 nM each of Nck, N-WASP, pCas, FAK, and Paxillin in buffer containing 50 mM KCl, 0.1% BSA and either 50 mM of Hepes or Mes at the indicated pH. ( E ) Total adhesion area per cell quantified from spinning disk confocal microscopy images of endogenous paxillin. Cells were incubated for 10 min prior to fixation and paxillin immunostaining in buffer containing 10 μ M nigericin, 10 μ M valinomycin, 150 mM NaCl, 50 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , 2 mM Glutamax, and either 50 mM Mes pH 6.5 or 50 mM Hepes pH 7.5. Significance tested with unpaired t-test. ( F ) Representative spinning disk confocal microscopy images. All scale bars = 20 μm.
    Figure Legend Snippet: Integrin adhesion complexes are sensitive to solvent perturbations that alter phase separation. ( A ) Solution turbidity measurements of solution containing 250 nM each of Nck, N-WASP, pCas, FAK, and Paxillin in buffer containing 50 mM Hepes pH 7.3, 50 mM KCl and 0.1% BSA. Solution incubated at indicated temperatures of 30 min prior to measurements. ( B ) Total adhesion area per cell quantified from spinning disk images of endogenous paxillin. Cells were incubated at indicated temperatures for 10 min prior to fixation and paxillin immunostaining. ( C ) Representative spinning disk confocal microscopy images. ( D ) Turbidity measurements of solution containing 250 nM each of Nck, N-WASP, pCas, FAK, and Paxillin in buffer containing 50 mM KCl, 0.1% BSA and either 50 mM of Hepes or Mes at the indicated pH. ( E ) Total adhesion area per cell quantified from spinning disk confocal microscopy images of endogenous paxillin. Cells were incubated for 10 min prior to fixation and paxillin immunostaining in buffer containing 10 μ M nigericin, 10 μ M valinomycin, 150 mM NaCl, 50 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , 2 mM Glutamax, and either 50 mM Mes pH 6.5 or 50 mM Hepes pH 7.5. Significance tested with unpaired t-test. ( F ) Representative spinning disk confocal microscopy images. All scale bars = 20 μm.

    Techniques Used: Incubation, Immunostaining, Confocal Microscopy

    11) Product Images from "Use of bioreactors for culturing human retinal organoids improves photoreceptor yields"

    Article Title: Use of bioreactors for culturing human retinal organoids improves photoreceptor yields

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-018-0907-0

    Photoreceptor maturation following bioreactor differentiation. a Schematic showing different stages of differentiation protocol. Representative phase-contrast images: (i) hPSCs at day 0 of differentiation; (ii) developing neuroepithelia surrounded by RPE cells (black arrows) at week 4; (iii) isolated retinal cup at week 5; (iv) mature retinal organoid at week 17. Following retinal cup formation, samples cultured in 100-mm cell culture plates or 100-ml bioreactors to form retinal organoids. Mature photoreceptors observed between days 90 and 120. b, c RECOVERIN and RHODOPSIN-positive photoreceptor cells in both control and bioreactor conditions at indicated number of weeks of differentiation. d Immunohistochemistry of L/M-OPSIN, Cone Arrestin (ARRESTIN3) and S-OPSIN cone markers at week 16 of differentiation in control and bioreactor conditions. Scale bars: 20 μm (a), 25 μM (b, c), 10 μM (d). hPSC human pluripotent stem cell, NRV neuroretinal vesicle, RDM + F RDM supplemented with 10% foetal bovine serum + 2% Glutamax + 100 μM taurine, RA retinoic acid
    Figure Legend Snippet: Photoreceptor maturation following bioreactor differentiation. a Schematic showing different stages of differentiation protocol. Representative phase-contrast images: (i) hPSCs at day 0 of differentiation; (ii) developing neuroepithelia surrounded by RPE cells (black arrows) at week 4; (iii) isolated retinal cup at week 5; (iv) mature retinal organoid at week 17. Following retinal cup formation, samples cultured in 100-mm cell culture plates or 100-ml bioreactors to form retinal organoids. Mature photoreceptors observed between days 90 and 120. b, c RECOVERIN and RHODOPSIN-positive photoreceptor cells in both control and bioreactor conditions at indicated number of weeks of differentiation. d Immunohistochemistry of L/M-OPSIN, Cone Arrestin (ARRESTIN3) and S-OPSIN cone markers at week 16 of differentiation in control and bioreactor conditions. Scale bars: 20 μm (a), 25 μM (b, c), 10 μM (d). hPSC human pluripotent stem cell, NRV neuroretinal vesicle, RDM + F RDM supplemented with 10% foetal bovine serum + 2% Glutamax + 100 μM taurine, RA retinoic acid

    Techniques Used: Isolation, Cell Culture, Immunohistochemistry

    12) Product Images from "Developing an in vitro screening assay platform for evaluation of antifibrotic drugs using precision-cut liver slices"

    Article Title: Developing an in vitro screening assay platform for evaluation of antifibrotic drugs using precision-cut liver slices

    Journal: Fibrogenesis & Tissue Repair

    doi: 10.1186/s13069-014-0017-2

    Viability of liver slices. Liver slices of 150 μm thickness were obtained and incubated with Williams E media supplemented with 15% fetal bovine serum and 1% GlutaMAX for indicated time periods. ATP levels were estimated at the end of the experiment, and levels were normalized to total protein content. The ATP levels in the control slices (incubated for 4 hours) were normalized to 100 and the percent ATP levels were calculated accordingly. ** P
    Figure Legend Snippet: Viability of liver slices. Liver slices of 150 μm thickness were obtained and incubated with Williams E media supplemented with 15% fetal bovine serum and 1% GlutaMAX for indicated time periods. ATP levels were estimated at the end of the experiment, and levels were normalized to total protein content. The ATP levels in the control slices (incubated for 4 hours) were normalized to 100 and the percent ATP levels were calculated accordingly. ** P

    Techniques Used: Incubation

    13) Product Images from "A Metal-Free, Disulfide Oxidized Form of Superoxide Dismutase 1 as a Primary Misfolded Species with Prion-Like Properties in the Extracellular Environments Surrounding Motor Neuron-Like Cells"

    Article Title: A Metal-Free, Disulfide Oxidized Form of Superoxide Dismutase 1 as a Primary Misfolded Species with Prion-Like Properties in the Extracellular Environments Surrounding Motor Neuron-Like Cells

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms22084155

    The conditioned medium containing extracellular misfolded metal free, disulfide oxidized superoxide dismutase 1 (apo-SOD1 S-S ) exerted cytotoxicity to motor neuron-like cells. (white) NSC-34 cells expressing green fluorescence protein (GFP) untagged human wild-type SOD1 (hSOD1 WT ) were exposed to conditioned medium from NSC-34 harboring hSOD1-GFP containing misfolded apo-SOD1 S-S for 24 h. Cell viability and cytotoxicity were assessed using ( a ) a Cell Counting Kit 8 assay and ( b ) a lactate dehydrogenase (LDH) release assay, respectively. (black) Extracellular misfolded apo-SOD1 S-S was removed from the conditioned medium by immunoprecipitation with C4F6. (gray) As a control, the medium was immunoprecipitated with normal mouse IgG. In the data set of cell viability, the results are expressed as the cell viability of recipient cells relative to that of untransfected cells, which were incubated with normal culture medium, Dulbecco’s modified Eagle’s medium and F-12 with GlutaMAX™ containing 1% ( v / v ) fetal bovine serum and 0.1 mM non-essential amino acids, instead of the conditioned medium. In the data set of cytotoxicity, the results are given as the amounts of released LDH to the medium relative to that of cells exposed to 100 μM H 2 O 2 for 24 h. All data are expressed as the mean ± SD, n = 3 for each treatment. Statistical analysis was performed using one-way ANOVA followed by the Tukey–Kramer post hoc test. ** p
    Figure Legend Snippet: The conditioned medium containing extracellular misfolded metal free, disulfide oxidized superoxide dismutase 1 (apo-SOD1 S-S ) exerted cytotoxicity to motor neuron-like cells. (white) NSC-34 cells expressing green fluorescence protein (GFP) untagged human wild-type SOD1 (hSOD1 WT ) were exposed to conditioned medium from NSC-34 harboring hSOD1-GFP containing misfolded apo-SOD1 S-S for 24 h. Cell viability and cytotoxicity were assessed using ( a ) a Cell Counting Kit 8 assay and ( b ) a lactate dehydrogenase (LDH) release assay, respectively. (black) Extracellular misfolded apo-SOD1 S-S was removed from the conditioned medium by immunoprecipitation with C4F6. (gray) As a control, the medium was immunoprecipitated with normal mouse IgG. In the data set of cell viability, the results are expressed as the cell viability of recipient cells relative to that of untransfected cells, which were incubated with normal culture medium, Dulbecco’s modified Eagle’s medium and F-12 with GlutaMAX™ containing 1% ( v / v ) fetal bovine serum and 0.1 mM non-essential amino acids, instead of the conditioned medium. In the data set of cytotoxicity, the results are given as the amounts of released LDH to the medium relative to that of cells exposed to 100 μM H 2 O 2 for 24 h. All data are expressed as the mean ± SD, n = 3 for each treatment. Statistical analysis was performed using one-way ANOVA followed by the Tukey–Kramer post hoc test. ** p

    Techniques Used: Expressing, Fluorescence, Cell Counting, Lactate Dehydrogenase Assay, Immunoprecipitation, Incubation, Modification

    14) Product Images from "Current Status of 3-D Organoids as Pre-Clinical Models"

    Article Title: Current Status of 3-D Organoids as Pre-Clinical Models

    Journal: Stem cells (Dayton, Ohio)

    doi: 10.1002/stem.2852

    Representation of the organoids generated, and the media compositions required These hosts of organoids have been generated from different source materials, including iPSCs, AdSC, embryonic tissues or cells and adult tissue explants. Different media compositions are required for each type of source material used and the type of differentiation to be achieved (organ specific), which is elaborated in detail in the text. Specifically, cerebral organoids need a stepwise incubation of PSC in neural induction media (DMEM-F12, N2 supplement, GlutaMAX supplement, MEM-NEAA, heparin) followed by cerebral induction media (DMEM-F12, Neurobasal medium, N2 supplement, insulin, GlutaMAX supplement, MEM-NEAA, penicillin-streptomycin, 2-mercaptoethanol, B27 supplement). Mammary organoids can be developed from tissue fragments using media composed of DMEM/F12, FBS, ITS Selenite media supplement, FGF2, FGF10 for mouse or EpiCult B medium supplemented with hydrocortisone, insulin, FGF10, HGF for humans. Liver organoids can be generated by mixing tissue fragments in DMEM/F12 media supplemented with FBS, EGF, RSPO1, FGF, HGF, Nicotinamide, and insulin. Pancreatic organoids need a media comprising of DMEM/F12, B27 supplement, Nicotinamide, Noggin, EGF, FGF and RSPO1. Ovarian organoids are generated by seeding fallopian epithelial cells in matrigel with media comprising AdDMEM/F12, Wnt3A, RSPO1, HEPES, GlutaMAX, B27, N2 Supplement, EGF, noggin, FGF10, Nicotinamide, Y-27632, and SB431542. Prostate organoids need a media containing DMEM/F12, B27 Supplement, N-acetylcysteine, EGF, Noggin, RSPO1, A83-01, and DHT. Kidney organoids need a media containing DMEM high glucose, FBS, NEAA, GlutaMAX, Heaparin, APEL media, FGF9, SB431542 and CHIR99021. Gut or intestinal organoids need a media composition of DMEM/F12, FBS, B27, EGF, RSPO1, Noggin and Wnt. Specific cultivation of stomach organoids need media composition same as intestinal organoids with addition of FGF. Lung organoids can be generated and grown in media containing DMEM/F12, FBS, B27, N2 Supplement, GlutaMAX, FGF4, Noggin, SB431542 and CHIR99021. Abbreviation used are: Y-27632:ROCK inhibitor, SB431542:TGF-β R Kinase Inhibitor IV, ITS: Insulin Transferrin-Sodium, NEAA: Non Essential Amino Acid Culture Supplement, EGF: Epidermal Growth Factor, RSPO1: R-spondin-1, Wnt3A: Wingless-Type MMTV Integration Site Family Member 3A, T3: Triiodothyronine, FBS: Fetal Bovine Serum, FGF: Fibroblast Growth Factor, HGF: Hepatocyte Growth factor, DMEM/F12: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12, DHT: Dihydrotestosterone, CHIR99021: glycogen synthase kinase 3 inhibitor.
    Figure Legend Snippet: Representation of the organoids generated, and the media compositions required These hosts of organoids have been generated from different source materials, including iPSCs, AdSC, embryonic tissues or cells and adult tissue explants. Different media compositions are required for each type of source material used and the type of differentiation to be achieved (organ specific), which is elaborated in detail in the text. Specifically, cerebral organoids need a stepwise incubation of PSC in neural induction media (DMEM-F12, N2 supplement, GlutaMAX supplement, MEM-NEAA, heparin) followed by cerebral induction media (DMEM-F12, Neurobasal medium, N2 supplement, insulin, GlutaMAX supplement, MEM-NEAA, penicillin-streptomycin, 2-mercaptoethanol, B27 supplement). Mammary organoids can be developed from tissue fragments using media composed of DMEM/F12, FBS, ITS Selenite media supplement, FGF2, FGF10 for mouse or EpiCult B medium supplemented with hydrocortisone, insulin, FGF10, HGF for humans. Liver organoids can be generated by mixing tissue fragments in DMEM/F12 media supplemented with FBS, EGF, RSPO1, FGF, HGF, Nicotinamide, and insulin. Pancreatic organoids need a media comprising of DMEM/F12, B27 supplement, Nicotinamide, Noggin, EGF, FGF and RSPO1. Ovarian organoids are generated by seeding fallopian epithelial cells in matrigel with media comprising AdDMEM/F12, Wnt3A, RSPO1, HEPES, GlutaMAX, B27, N2 Supplement, EGF, noggin, FGF10, Nicotinamide, Y-27632, and SB431542. Prostate organoids need a media containing DMEM/F12, B27 Supplement, N-acetylcysteine, EGF, Noggin, RSPO1, A83-01, and DHT. Kidney organoids need a media containing DMEM high glucose, FBS, NEAA, GlutaMAX, Heaparin, APEL media, FGF9, SB431542 and CHIR99021. Gut or intestinal organoids need a media composition of DMEM/F12, FBS, B27, EGF, RSPO1, Noggin and Wnt. Specific cultivation of stomach organoids need media composition same as intestinal organoids with addition of FGF. Lung organoids can be generated and grown in media containing DMEM/F12, FBS, B27, N2 Supplement, GlutaMAX, FGF4, Noggin, SB431542 and CHIR99021. Abbreviation used are: Y-27632:ROCK inhibitor, SB431542:TGF-β R Kinase Inhibitor IV, ITS: Insulin Transferrin-Sodium, NEAA: Non Essential Amino Acid Culture Supplement, EGF: Epidermal Growth Factor, RSPO1: R-spondin-1, Wnt3A: Wingless-Type MMTV Integration Site Family Member 3A, T3: Triiodothyronine, FBS: Fetal Bovine Serum, FGF: Fibroblast Growth Factor, HGF: Hepatocyte Growth factor, DMEM/F12: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12, DHT: Dihydrotestosterone, CHIR99021: glycogen synthase kinase 3 inhibitor.

    Techniques Used: Generated, Incubation, Modification

    15) Product Images from "Multidrug Resistance-Associated Protein 3 (Mrp3/Abcc3/Moat-D) Is Expressed in the SAE Squalus acanthias Shark Embryo-Derived Cell Line"

    Article Title: Multidrug Resistance-Associated Protein 3 (Mrp3/Abcc3/Moat-D) Is Expressed in the SAE Squalus acanthias Shark Embryo-Derived Cell Line

    Journal: Zebrafish

    doi: 10.1089/zeb.2007.0520

    Induction of Mrp3 mRNA in SAE shark embryo cells in vitro . Cultures were incubated with the indicated compounds, and mRNA abundance was determined by qPCR as described in “Materials and Methods” section. Briefly, SAE cells were incubated for 4 days in basal LDF nutrient medium containing amino acids, 10 nM selenous acid, 10 μg/mL transferrin, and 2 mM GlutaMax. Following this, other medium supplements (2% FBS, insulin, 50 ng/mL FGF, 50 ng/mL EGF, and 1:1000 CDL) were added to individual wells. A control was also included, in which none of the medium supplements were added. After incubation for 24 h, total RNA was isolated from each well, and cDNA was synthesized. The expression of shark Mrp3 was compared by qPCR with shark EF-1α as the normalizer. Data were analyzed with MX pro software (Stratagene).
    Figure Legend Snippet: Induction of Mrp3 mRNA in SAE shark embryo cells in vitro . Cultures were incubated with the indicated compounds, and mRNA abundance was determined by qPCR as described in “Materials and Methods” section. Briefly, SAE cells were incubated for 4 days in basal LDF nutrient medium containing amino acids, 10 nM selenous acid, 10 μg/mL transferrin, and 2 mM GlutaMax. Following this, other medium supplements (2% FBS, insulin, 50 ng/mL FGF, 50 ng/mL EGF, and 1:1000 CDL) were added to individual wells. A control was also included, in which none of the medium supplements were added. After incubation for 24 h, total RNA was isolated from each well, and cDNA was synthesized. The expression of shark Mrp3 was compared by qPCR with shark EF-1α as the normalizer. Data were analyzed with MX pro software (Stratagene).

    Techniques Used: In Vitro, Incubation, Real-time Polymerase Chain Reaction, Isolation, Synthesized, Expressing, Software

    16) Product Images from "The Importance of Multifrequency Impedance Sensing of Endothelial Barrier Formation Using ECIS Technology for the Generation of a Strong and Durable Paracellular Barrier"

    Article Title: The Importance of Multifrequency Impedance Sensing of Endothelial Barrier Formation Using ECIS Technology for the Generation of a Strong and Durable Paracellular Barrier

    Journal: Biosensors

    doi: 10.3390/bios8030064

    Changes in R b as a consequence of altering growth medium components as shown by brain endothelium. Endothelial cells were seeded at 20,000 cells per well on a 96w20idf ECIS array. Time 0 h denotes the time cells were seeded. The dotted vertical line indicates 48 h of cell growth in each respective media type, with a subsequent media change carried out at this time. ( A ) Brain endothelium grown in Enriched Media containing either 10%, 5%, or 2% FBS; ( B ) Brain endothelium grown in Enriched Media containing either 160 µM, 80 µM, 40 µM, or 0 µM cAMP; ( C ) Brain endothelium grown in Enriched Media containing either 1 µg/mL, 39 ng/mL, or 0 ng/mL hydrocortisone; ( D ) Brain endothelium grown in Enriched Media containing either 1 ng/mL or 0 ng/mL EGF; ( E ) Brain endothelium grown in Enriched Media containing either 3 ng/mL or 0 ng/mL FGF; ( F ) Brain endothelium grown in Enriched Media containing either 10 µg/mL or 0 µg/mL heparin; ( G ) Brain endothelium grown in Enriched Media containing either 1× or no Glutamax. Data show the mean ± SD (n = 3 wells) of one independent experiment representative of three experimental repeats. Graphical representations of p values are * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.
    Figure Legend Snippet: Changes in R b as a consequence of altering growth medium components as shown by brain endothelium. Endothelial cells were seeded at 20,000 cells per well on a 96w20idf ECIS array. Time 0 h denotes the time cells were seeded. The dotted vertical line indicates 48 h of cell growth in each respective media type, with a subsequent media change carried out at this time. ( A ) Brain endothelium grown in Enriched Media containing either 10%, 5%, or 2% FBS; ( B ) Brain endothelium grown in Enriched Media containing either 160 µM, 80 µM, 40 µM, or 0 µM cAMP; ( C ) Brain endothelium grown in Enriched Media containing either 1 µg/mL, 39 ng/mL, or 0 ng/mL hydrocortisone; ( D ) Brain endothelium grown in Enriched Media containing either 1 ng/mL or 0 ng/mL EGF; ( E ) Brain endothelium grown in Enriched Media containing either 3 ng/mL or 0 ng/mL FGF; ( F ) Brain endothelium grown in Enriched Media containing either 10 µg/mL or 0 µg/mL heparin; ( G ) Brain endothelium grown in Enriched Media containing either 1× or no Glutamax. Data show the mean ± SD (n = 3 wells) of one independent experiment representative of three experimental repeats. Graphical representations of p values are * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.

    Techniques Used: Electric Cell-substrate Impedance Sensing

    17) Product Images from "Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: a comparative analysis on the Umbilical Cord and Dental Pulp derived Stem/ Stromal Cells secretome"

    Article Title: Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: a comparative analysis on the Umbilical Cord and Dental Pulp derived Stem/ Stromal Cells secretome

    Journal: bioRxiv

    doi: 10.1101/728550

    Dynamics of GlutaMAX™ breakdown to glutamine and alanine of UC-MSCs (A) and DPSCs (B) populations; and Dynamics of Pyruvate catabolism into acetate, lactate and ethanol of UC-MSCs (C) and DPSCs (D) populations.
    Figure Legend Snippet: Dynamics of GlutaMAX™ breakdown to glutamine and alanine of UC-MSCs (A) and DPSCs (B) populations; and Dynamics of Pyruvate catabolism into acetate, lactate and ethanol of UC-MSCs (C) and DPSCs (D) populations.

    Techniques Used:

    18) Product Images from "Use of bioreactors for culturing human retinal organoids improves photoreceptor yields"

    Article Title: Use of bioreactors for culturing human retinal organoids improves photoreceptor yields

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-018-0907-0

    Photoreceptor maturation following bioreactor differentiation. a Schematic showing different stages of differentiation protocol. Representative phase-contrast images: (i) hPSCs at day 0 of differentiation; (ii) developing neuroepithelia surrounded by RPE cells (black arrows) at week 4; (iii) isolated retinal cup at week 5; (iv) mature retinal organoid at week 17. Following retinal cup formation, samples cultured in 100-mm cell culture plates or 100-ml bioreactors to form retinal organoids. Mature photoreceptors observed between days 90 and 120. b, c RECOVERIN and RHODOPSIN-positive photoreceptor cells in both control and bioreactor conditions at indicated number of weeks of differentiation. d Immunohistochemistry of L/M-OPSIN, Cone Arrestin (ARRESTIN3) and S-OPSIN cone markers at week 16 of differentiation in control and bioreactor conditions. Scale bars: 20 μm (a), 25 μM (b, c), 10 μM (d). hPSC human pluripotent stem cell, NRV neuroretinal vesicle, RDM + F RDM supplemented with 10% foetal bovine serum + 2% Glutamax + 100 μM taurine, RA retinoic acid
    Figure Legend Snippet: Photoreceptor maturation following bioreactor differentiation. a Schematic showing different stages of differentiation protocol. Representative phase-contrast images: (i) hPSCs at day 0 of differentiation; (ii) developing neuroepithelia surrounded by RPE cells (black arrows) at week 4; (iii) isolated retinal cup at week 5; (iv) mature retinal organoid at week 17. Following retinal cup formation, samples cultured in 100-mm cell culture plates or 100-ml bioreactors to form retinal organoids. Mature photoreceptors observed between days 90 and 120. b, c RECOVERIN and RHODOPSIN-positive photoreceptor cells in both control and bioreactor conditions at indicated number of weeks of differentiation. d Immunohistochemistry of L/M-OPSIN, Cone Arrestin (ARRESTIN3) and S-OPSIN cone markers at week 16 of differentiation in control and bioreactor conditions. Scale bars: 20 μm (a), 25 μM (b, c), 10 μM (d). hPSC human pluripotent stem cell, NRV neuroretinal vesicle, RDM + F RDM supplemented with 10% foetal bovine serum + 2% Glutamax + 100 μM taurine, RA retinoic acid

    Techniques Used: Isolation, Cell Culture, Immunohistochemistry

    19) Product Images from "Therapeutic application of PPE2 protein of Mycobacterium tuberculosis in inhibiting tissue inflammation"

    Article Title: Therapeutic application of PPE2 protein of Mycobacterium tuberculosis in inhibiting tissue inflammation

    Journal: EMBO Molecular Medicine

    doi: 10.15252/emmm.202114891

    Effect of rPPE2 on mast cell activity RBL‐2H3 cells were cultured in 15% fetal bovine serum (Invitrogen) in DMEM with 1× Glutamax and 1× Anti‐Anti. The cells were treated with LPS (1 μg/ml) for 3 h followed by treatment with rPPE2 (3 μg/ml). After 3 h, cells were harvested and stained with Toluidine blue. For this, cells were washed and fixed by 4% formaldehyde, washed with PBS and dehydrated using 95% ethanol followed by 100% ethanol for 30 s each. Cells were next dipped in xylene mounted on slides with mounting medium, and observed under Nikon ECLIPSE Ni‐U light upright microscope. Photographs of representative images were visualized at 10× magnification (scale bar = 50 μm) (A). For β‐hexosaminidase assay, these cells were harvested and lysed using lysis buffer (50 mM Phosphate buffer with 1% Triton X‐100) Equal amounts of cell lysates were incubated with 200 μl of 1 mM P‐nitrophenyl N‐acetyl‐beta‐D‐glucosamine (Sigma‐Aldrich, USA) dissolved in 0.05 M citrate buffer (pH 4.5). After 1 h of incubation at 37°C, absorbance was measured at 405 nm. (B). Also, these cells were used for cDNA synthesis to perform qPCR to observe transcription levels of MCP‐3 (C) and Mcpt4 (D). GAPDH transcript levels were used as an internal control. RBL‐2H3 cells were treated with either PBS or rPPE2 (3 μg/ml). After 3 h of treatment, cells were stained with propidium iodide for 2 min and percentage of the propidium iodide‐stained population was assessed by flow cytometry. RBL‐2H3 cells were treated with either PBS or rPPE2 (3 μg/ml) for 3 h. MTT (3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide; Sigma‐Aldrich, USA) was added to the cell culture at a final concentration of 1 mg/ml for 4 h after which cells were lysed with a lysis buffer (20% SDS in 50% dimethylformamide) and absorbance was recorded at 590 nm. Data information: Data shown are Mean ± SEM of three independent experiments. (NS, no significance). For (B–D, F), Unpaired t ‐test was used to calculate P values. [MCP‐3 (Forward primer 5‐GCATGGAAGTCTGTGCTGAA‐3; reverse primer 5‐CCGTTCCTACCCCTTAGGAC‐3); Mcpt4 (Forward primer 5‐GGAGCTGGAGCTGAGGAGAT‐3; 5‐reverse primer CTCCGAGGGTGACAGTGATT‐3)].
    Figure Legend Snippet: Effect of rPPE2 on mast cell activity RBL‐2H3 cells were cultured in 15% fetal bovine serum (Invitrogen) in DMEM with 1× Glutamax and 1× Anti‐Anti. The cells were treated with LPS (1 μg/ml) for 3 h followed by treatment with rPPE2 (3 μg/ml). After 3 h, cells were harvested and stained with Toluidine blue. For this, cells were washed and fixed by 4% formaldehyde, washed with PBS and dehydrated using 95% ethanol followed by 100% ethanol for 30 s each. Cells were next dipped in xylene mounted on slides with mounting medium, and observed under Nikon ECLIPSE Ni‐U light upright microscope. Photographs of representative images were visualized at 10× magnification (scale bar = 50 μm) (A). For β‐hexosaminidase assay, these cells were harvested and lysed using lysis buffer (50 mM Phosphate buffer with 1% Triton X‐100) Equal amounts of cell lysates were incubated with 200 μl of 1 mM P‐nitrophenyl N‐acetyl‐beta‐D‐glucosamine (Sigma‐Aldrich, USA) dissolved in 0.05 M citrate buffer (pH 4.5). After 1 h of incubation at 37°C, absorbance was measured at 405 nm. (B). Also, these cells were used for cDNA synthesis to perform qPCR to observe transcription levels of MCP‐3 (C) and Mcpt4 (D). GAPDH transcript levels were used as an internal control. RBL‐2H3 cells were treated with either PBS or rPPE2 (3 μg/ml). After 3 h of treatment, cells were stained with propidium iodide for 2 min and percentage of the propidium iodide‐stained population was assessed by flow cytometry. RBL‐2H3 cells were treated with either PBS or rPPE2 (3 μg/ml) for 3 h. MTT (3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide; Sigma‐Aldrich, USA) was added to the cell culture at a final concentration of 1 mg/ml for 4 h after which cells were lysed with a lysis buffer (20% SDS in 50% dimethylformamide) and absorbance was recorded at 590 nm. Data information: Data shown are Mean ± SEM of three independent experiments. (NS, no significance). For (B–D, F), Unpaired t ‐test was used to calculate P values. [MCP‐3 (Forward primer 5‐GCATGGAAGTCTGTGCTGAA‐3; reverse primer 5‐CCGTTCCTACCCCTTAGGAC‐3); Mcpt4 (Forward primer 5‐GGAGCTGGAGCTGAGGAGAT‐3; 5‐reverse primer CTCCGAGGGTGACAGTGATT‐3)].

    Techniques Used: Activity Assay, Cell Culture, Staining, Microscopy, Beta Hexosaminidase Assay, Lysis, Incubation, Real-time Polymerase Chain Reaction, Flow Cytometry, MTT Assay, Concentration Assay

    20) Product Images from "In vitro differentiation of rat spermatogonia into round spermatids in tissue culture"

    Article Title: In vitro differentiation of rat spermatogonia into round spermatids in tissue culture

    Journal: Molecular Human Reproduction

    doi: 10.1093/molehr/gaw047

    Assessment of the rat male germ cell differentiation in vitro .Double immunofluorescent staining for 5 days postpartum (d pp ) rat testicular tissue after culturing in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) for 52 days, showing cells double positive for Ddx4 (DEAD box polypeptide 4; in green) and Crem (cAMp (cyclic adenosine mono phosphate) response element modulator; in red) labeled with red arrowheads (A and B), and Acrosin positive cells (in red) labeled with the red arrowheads (C and D). Rabbit IgGs were used instead of the primary antibodies in the negative control and DAPI (4’,6-Diamidino-2-Phenylindole) was utilized in counterstaining (in blue). The scale bars are 20 µm A and B, and negative controls), and 10 µm (C and D). The graph (E) shows the percentage of tubules containing Crem positive cells (in blue) or Acrosin positive cells (in red) after culturing the 5 d pp rat testicular tissue for 52 days in the different culture conditions. Values are mean ± SD ( n = 3–12 (Crem), n = 3–9 (Acrosin)). For statistical analysis, ANOVA on ranks test was applied to compare between the percentages of tubules from the different culture conditions. Abbreviations: minimal essential medium α (MEMα), melatonin (mel.), knock-out serum replacement (KSR), Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).
    Figure Legend Snippet: Assessment of the rat male germ cell differentiation in vitro .Double immunofluorescent staining for 5 days postpartum (d pp ) rat testicular tissue after culturing in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) for 52 days, showing cells double positive for Ddx4 (DEAD box polypeptide 4; in green) and Crem (cAMp (cyclic adenosine mono phosphate) response element modulator; in red) labeled with red arrowheads (A and B), and Acrosin positive cells (in red) labeled with the red arrowheads (C and D). Rabbit IgGs were used instead of the primary antibodies in the negative control and DAPI (4’,6-Diamidino-2-Phenylindole) was utilized in counterstaining (in blue). The scale bars are 20 µm A and B, and negative controls), and 10 µm (C and D). The graph (E) shows the percentage of tubules containing Crem positive cells (in blue) or Acrosin positive cells (in red) after culturing the 5 d pp rat testicular tissue for 52 days in the different culture conditions. Values are mean ± SD ( n = 3–12 (Crem), n = 3–9 (Acrosin)). For statistical analysis, ANOVA on ranks test was applied to compare between the percentages of tubules from the different culture conditions. Abbreviations: minimal essential medium α (MEMα), melatonin (mel.), knock-out serum replacement (KSR), Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).

    Techniques Used: Cell Differentiation, In Vitro, Staining, Knock-Out, Labeling, Negative Control

    Schematic overview of different culture conditions used for culturing 5 days post parum (d pp ) rat testicular tissue. In total, 66 testes of 5d pp old rats were used to obtain 198 testicular tissue samples sized about 1 mm 3 . Twenty-seven tissue samples were used as controls. The remaining samples were cultured on agarose pillars in organ culture conditions containing cell culture medium (minimal essential medium α + 1% penicillin/streptomycin + 10% (v/v) knock-out serum replacement) with the additions as stated in the figure. A representative picture of a 5d pp old rat testis is shown demonstrating the presence of gonocytes (white arrowheads) and spermatogonia (black arrowheads) in the tissue at the beginning of the culture. The scale bar is 20 µm. Abbreviations: Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).
    Figure Legend Snippet: Schematic overview of different culture conditions used for culturing 5 days post parum (d pp ) rat testicular tissue. In total, 66 testes of 5d pp old rats were used to obtain 198 testicular tissue samples sized about 1 mm 3 . Twenty-seven tissue samples were used as controls. The remaining samples were cultured on agarose pillars in organ culture conditions containing cell culture medium (minimal essential medium α + 1% penicillin/streptomycin + 10% (v/v) knock-out serum replacement) with the additions as stated in the figure. A representative picture of a 5d pp old rat testis is shown demonstrating the presence of gonocytes (white arrowheads) and spermatogonia (black arrowheads) in the tissue at the beginning of the culture. The scale bar is 20 µm. Abbreviations: Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).

    Techniques Used: Cell Culture, Organ Culture, Knock-Out

    Morphological evaluation results for spermatocytes obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) with haematoxylin counter staining for Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 d pp adult rat testis control (C and D) showing primary spermatocytes. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining. The yellow arrow heads show primary spermatocytes. The scale bars are 10 µm (A and C) and 20 µm (B and D). Percentage of tubules containing spermatocytes (E) compared between the different culture conditions used. MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are represented in mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.
    Figure Legend Snippet: Morphological evaluation results for spermatocytes obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) with haematoxylin counter staining for Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 d pp adult rat testis control (C and D) showing primary spermatocytes. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining. The yellow arrow heads show primary spermatocytes. The scale bars are 10 µm (A and C) and 20 µm (B and D). Percentage of tubules containing spermatocytes (E) compared between the different culture conditions used. MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are represented in mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.

    Techniques Used: Staining, Cell Culture, Knock-Out

    Morphological evaluation results for round spermatids obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) of Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 days postpartum adult rat testis control (C and D) showing round spermatids. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining in the same samples to show overall organization in the tissue (small inserts; B and D). The violet arrow heads show acrosomal caps. The scale bars are 10 µm (A and C) and 50 µm (B and D). Percentage of tubules containing spermatids exhibiting acrosomal caps (E) compared between the different culture conditions used; MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.
    Figure Legend Snippet: Morphological evaluation results for round spermatids obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) of Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 days postpartum adult rat testis control (C and D) showing round spermatids. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining in the same samples to show overall organization in the tissue (small inserts; B and D). The violet arrow heads show acrosomal caps. The scale bars are 10 µm (A and C) and 50 µm (B and D). Percentage of tubules containing spermatids exhibiting acrosomal caps (E) compared between the different culture conditions used; MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.

    Techniques Used: Staining, Cell Culture, Knock-Out

    21) Product Images from "Metabotropic Glutamate Receptor-1 Contributes to Progression in Triple Negative Breast Cancer"

    Article Title: Metabotropic Glutamate Receptor-1 Contributes to Progression in Triple Negative Breast Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0081126

    mGluR1 is active in a TNBC cell line. BT549 cells were stimulated in glutamate-free media containing GlutaMAX™ (Life Technologies, Grand Island, NY) with mGluR1 agonist, L-quisqualate (10 µM). Cells were harvested and the fold-increase in phosphorylated ERK1/2 was assayed by Western blot. Pretreatment with mGluR1 antagonist LY367385 for 30 minutes markedly reduced pERK1/2 induction by L-quisqualate (right side of gel). Bottom gel: Same blot stripped and re-probed with ERK antibody for normalization. Experiments were repeated two times with similar results.
    Figure Legend Snippet: mGluR1 is active in a TNBC cell line. BT549 cells were stimulated in glutamate-free media containing GlutaMAX™ (Life Technologies, Grand Island, NY) with mGluR1 agonist, L-quisqualate (10 µM). Cells were harvested and the fold-increase in phosphorylated ERK1/2 was assayed by Western blot. Pretreatment with mGluR1 antagonist LY367385 for 30 minutes markedly reduced pERK1/2 induction by L-quisqualate (right side of gel). Bottom gel: Same blot stripped and re-probed with ERK antibody for normalization. Experiments were repeated two times with similar results.

    Techniques Used: Western Blot

    22) Product Images from "Glutamine supplementation enhances development of in vitro-produced porcine embryos and increases leucine consumption from the medium"

    Article Title: Glutamine supplementation enhances development of in vitro-produced porcine embryos and increases leucine consumption from the medium

    Journal: Biology of Reproduction

    doi: 10.1093/biolre/ioy129

    Blastocyst development after culture with glutamine, GlutaMAX, or alanine. (A) Percentage of embryos developed to the blastocyst stage at day 6. Values were determined from five replicates (n = 40–50 cleaved embryos per treatment per replicate). (B) Total number of nuclei in day 6 blastocysts. Values were determined from five replicates (n = 15 per treatment per replicate). Data are presented as mean ± standard error. Different lowercase letters indicate statistical differences ( P ÂÂ
    Figure Legend Snippet: Blastocyst development after culture with glutamine, GlutaMAX, or alanine. (A) Percentage of embryos developed to the blastocyst stage at day 6. Values were determined from five replicates (n = 40–50 cleaved embryos per treatment per replicate). (B) Total number of nuclei in day 6 blastocysts. Values were determined from five replicates (n = 15 per treatment per replicate). Data are presented as mean ± standard error. Different lowercase letters indicate statistical differences ( P ÂÂ

    Techniques Used:

    23) Product Images from "Glutamine supplementation enhances development of in vitro-produced porcine embryos and increases leucine consumption from the medium"

    Article Title: Glutamine supplementation enhances development of in vitro-produced porcine embryos and increases leucine consumption from the medium

    Journal: Biology of Reproduction

    doi: 10.1093/biolre/ioy129

    Blastocyst development after culture with glutamine, GlutaMAX, or alanine. (A) Percentage of embryos developed to the blastocyst stage at day 6. Values were determined from five replicates (n = 40–50 cleaved embryos per treatment per replicate). (B) Total number of nuclei in day 6 blastocysts. Values were determined from five replicates (n = 15 per treatment per replicate). Data are presented as mean ± standard error. Different lowercase letters indicate statistical differences ( P
    Figure Legend Snippet: Blastocyst development after culture with glutamine, GlutaMAX, or alanine. (A) Percentage of embryos developed to the blastocyst stage at day 6. Values were determined from five replicates (n = 40–50 cleaved embryos per treatment per replicate). (B) Total number of nuclei in day 6 blastocysts. Values were determined from five replicates (n = 15 per treatment per replicate). Data are presented as mean ± standard error. Different lowercase letters indicate statistical differences ( P

    Techniques Used:

    24) Product Images from "Co-Ingestion of Black Carrot and Strawberry. Effects on Anthocyanin Stability, Bioaccessibility and Uptake"

    Article Title: Co-Ingestion of Black Carrot and Strawberry. Effects on Anthocyanin Stability, Bioaccessibility and Uptake

    Journal: Foods

    doi: 10.3390/foods9111595

    TEER (transepithelial electrical resistance) measurements carried out in growth medium (Dulbecco’s Modified Eagle Medium, DMEM, with Glutamax, 10% fetal bovine serum, FBS, 1% Pen Strep and 1% nonessential amino acids, NEAA) and during incubations in Hank’s Balanced Salt Solution (HBSS). Data represent mean values ± SD (3 biological and 3 technical replicates). Solid line corresponds to the blank (no treatment); dashed line to black carrot; dotted line to strawberry; dashed-dotted line to the mixture black carrot-strawberry.
    Figure Legend Snippet: TEER (transepithelial electrical resistance) measurements carried out in growth medium (Dulbecco’s Modified Eagle Medium, DMEM, with Glutamax, 10% fetal bovine serum, FBS, 1% Pen Strep and 1% nonessential amino acids, NEAA) and during incubations in Hank’s Balanced Salt Solution (HBSS). Data represent mean values ± SD (3 biological and 3 technical replicates). Solid line corresponds to the blank (no treatment); dashed line to black carrot; dotted line to strawberry; dashed-dotted line to the mixture black carrot-strawberry.

    Techniques Used: Modification

    25) Product Images from "Macroscale Adipose Tissue from Cellular Aggregates: A Simplified Method of Mass Producing Cell-Cultured Fat for Food Applications"

    Article Title: Macroscale Adipose Tissue from Cellular Aggregates: A Simplified Method of Mass Producing Cell-Cultured Fat for Food Applications

    Journal: bioRxiv

    doi: 10.1101/2022.06.08.495192

    Pig DFAT cells cultured under adipogenic conditions with 0% FBS containing media for 30 days. Cells were grown similarly to adipocytes cultured in adipogenic media containing 2% FBS, except the media did not contain GlutaMAX or FBS. The induction and lipid accumulation phases lasted 6 days and 24 days respectively. Lipid staining is BODIPY (green) and nuclei staining is Hoescht 33342 (blue). Scale bar represents 100 μm.
    Figure Legend Snippet: Pig DFAT cells cultured under adipogenic conditions with 0% FBS containing media for 30 days. Cells were grown similarly to adipocytes cultured in adipogenic media containing 2% FBS, except the media did not contain GlutaMAX or FBS. The induction and lipid accumulation phases lasted 6 days and 24 days respectively. Lipid staining is BODIPY (green) and nuclei staining is Hoescht 33342 (blue). Scale bar represents 100 μm.

    Techniques Used: Cell Culture, Staining

    26) Product Images from "Histone Deacetylase Inhibitor Valproic Acid Promotes the Differentiation of Human Induced Pluripotent Stem Cells into Hepatocyte-Like Cells"

    Article Title: Histone Deacetylase Inhibitor Valproic Acid Promotes the Differentiation of Human Induced Pluripotent Stem Cells into Hepatocyte-Like Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104010

    Schematic protocol for hepatic differentiation of hiPS cells. Human iPS (hiPS) cells were differentiated into endodermal cells using Roswell Park Memorial Institute (RPMI) + GlutaMAX medium containing 100 ng/mL of activin A for 5 days, and then into hepatic progenitor cells (HPCs) using KnockOut Dulbecco's modified Eagle medium (KnockOut DMEM) containing 1% dimethyl sulfoxide (DMSO) for 7 days. Thereafter, HPCs were matured using Cosmedium 004 (Cosmedium) containing 10 ng/mL of hepatocyte growth factor (HGF), 20 ng/mL of oncostatin M (OSM), and 100 nM of dexamethasone (DEX) for 10 days. Finally, the cells were cultured in only Cosmedium for 3 days. Valproic acid (VPA) was added to the culture medium for 72 h from day 18, 168 h from day 12, or 312 h from day 12 at a final concentration of 2 mM.
    Figure Legend Snippet: Schematic protocol for hepatic differentiation of hiPS cells. Human iPS (hiPS) cells were differentiated into endodermal cells using Roswell Park Memorial Institute (RPMI) + GlutaMAX medium containing 100 ng/mL of activin A for 5 days, and then into hepatic progenitor cells (HPCs) using KnockOut Dulbecco's modified Eagle medium (KnockOut DMEM) containing 1% dimethyl sulfoxide (DMSO) for 7 days. Thereafter, HPCs were matured using Cosmedium 004 (Cosmedium) containing 10 ng/mL of hepatocyte growth factor (HGF), 20 ng/mL of oncostatin M (OSM), and 100 nM of dexamethasone (DEX) for 10 days. Finally, the cells were cultured in only Cosmedium for 3 days. Valproic acid (VPA) was added to the culture medium for 72 h from day 18, 168 h from day 12, or 312 h from day 12 at a final concentration of 2 mM.

    Techniques Used: Knock-Out, Modification, Cell Culture, Concentration Assay

    27) Product Images from "Nutrient Deprivation Affects Salmonella Invasion and Its Interaction with the Gastrointestinal Microbiota"

    Article Title: Nutrient Deprivation Affects Salmonella Invasion and Its Interaction with the Gastrointestinal Microbiota

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0159676

    Growth in minimal media alters the ability of S . Typhimurium to invade, but not replicate in epithelial cells. HeLa cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, and 1% GlutaMAX. Wildtype, Δ invA and Δ ssaR S . Typhimurium were cultured to mid-logarithmic phase in LB (blue) or MOPS minimal media (red). HeLa cells invasion was measured at 2 hours post infection and is represented as a precent of Wild Type S . Typhimurium cultured in LB (control). The replication index was calculated by dividing the CFU/well at 4 hours post infection with the CFU/well at 2 hours post infection. A. Wildtype, invasion. B. Δ invA , invasion. C. Δ ssaR , invasion. D. Wildtype, replication. B. Δ invA , replication. C. Δ ssaR , replication. Results represent the average of four independent measurements (n = 4). *, p
    Figure Legend Snippet: Growth in minimal media alters the ability of S . Typhimurium to invade, but not replicate in epithelial cells. HeLa cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, and 1% GlutaMAX. Wildtype, Δ invA and Δ ssaR S . Typhimurium were cultured to mid-logarithmic phase in LB (blue) or MOPS minimal media (red). HeLa cells invasion was measured at 2 hours post infection and is represented as a precent of Wild Type S . Typhimurium cultured in LB (control). The replication index was calculated by dividing the CFU/well at 4 hours post infection with the CFU/well at 2 hours post infection. A. Wildtype, invasion. B. Δ invA , invasion. C. Δ ssaR , invasion. D. Wildtype, replication. B. Δ invA , replication. C. Δ ssaR , replication. Results represent the average of four independent measurements (n = 4). *, p

    Techniques Used: Modification, Cell Culture, Infection

    28) Product Images from "In vitro differentiation of rat spermatogonia into round spermatids in tissue culture"

    Article Title: In vitro differentiation of rat spermatogonia into round spermatids in tissue culture

    Journal: Molecular Human Reproduction

    doi: 10.1093/molehr/gaw047

    Assessment of the rat male germ cell differentiation in vitro .Double immunofluorescent staining for 5 days postpartum (d pp ) rat testicular tissue after culturing in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) for 52 days, showing cells double positive for Ddx4 (DEAD box polypeptide 4; in green) and Crem (cAMp (cyclic adenosine mono phosphate) response element modulator; in red) labeled with red arrowheads (A and B), and Acrosin positive cells (in red) labeled with the red arrowheads (C and D). Rabbit IgGs were used instead of the primary antibodies in the negative control and DAPI (4’,6-Diamidino-2-Phenylindole) was utilized in counterstaining (in blue). The scale bars are 20 µm A and B, and negative controls), and 10 µm (C and D). The graph (E) shows the percentage of tubules containing Crem positive cells (in blue) or Acrosin positive cells (in red) after culturing the 5 d pp rat testicular tissue for 52 days in the different culture conditions. Values are mean ± SD ( n = 3–12 (Crem), n = 3–9 (Acrosin)). For statistical analysis, ANOVA on ranks test was applied to compare between the percentages of tubules from the different culture conditions. Abbreviations: minimal essential medium α (MEMα), melatonin (mel.), knock-out serum replacement (KSR), Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).
    Figure Legend Snippet: Assessment of the rat male germ cell differentiation in vitro .Double immunofluorescent staining for 5 days postpartum (d pp ) rat testicular tissue after culturing in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) for 52 days, showing cells double positive for Ddx4 (DEAD box polypeptide 4; in green) and Crem (cAMp (cyclic adenosine mono phosphate) response element modulator; in red) labeled with red arrowheads (A and B), and Acrosin positive cells (in red) labeled with the red arrowheads (C and D). Rabbit IgGs were used instead of the primary antibodies in the negative control and DAPI (4’,6-Diamidino-2-Phenylindole) was utilized in counterstaining (in blue). The scale bars are 20 µm A and B, and negative controls), and 10 µm (C and D). The graph (E) shows the percentage of tubules containing Crem positive cells (in blue) or Acrosin positive cells (in red) after culturing the 5 d pp rat testicular tissue for 52 days in the different culture conditions. Values are mean ± SD ( n = 3–12 (Crem), n = 3–9 (Acrosin)). For statistical analysis, ANOVA on ranks test was applied to compare between the percentages of tubules from the different culture conditions. Abbreviations: minimal essential medium α (MEMα), melatonin (mel.), knock-out serum replacement (KSR), Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).

    Techniques Used: Cell Differentiation, In Vitro, Staining, Knock-Out, Labeling, Negative Control

    Schematic overview of different culture conditions used for culturing 5 days post parum (d pp ) rat testicular tissue. In total, 66 testes of 5d pp old rats were used to obtain 198 testicular tissue samples sized about 1 mm 3 . Twenty-seven tissue samples were used as controls. The remaining samples were cultured on agarose pillars in organ culture conditions containing cell culture medium (minimal essential medium α + 1% penicillin/streptomycin + 10% (v/v) knock-out serum replacement) with the additions as stated in the figure. A representative picture of a 5d pp old rat testis is shown demonstrating the presence of gonocytes (white arrowheads) and spermatogonia (black arrowheads) in the tissue at the beginning of the culture. The scale bar is 20 µm. Abbreviations: Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).
    Figure Legend Snippet: Schematic overview of different culture conditions used for culturing 5 days post parum (d pp ) rat testicular tissue. In total, 66 testes of 5d pp old rats were used to obtain 198 testicular tissue samples sized about 1 mm 3 . Twenty-seven tissue samples were used as controls. The remaining samples were cultured on agarose pillars in organ culture conditions containing cell culture medium (minimal essential medium α + 1% penicillin/streptomycin + 10% (v/v) knock-out serum replacement) with the additions as stated in the figure. A representative picture of a 5d pp old rat testis is shown demonstrating the presence of gonocytes (white arrowheads) and spermatogonia (black arrowheads) in the tissue at the beginning of the culture. The scale bar is 20 µm. Abbreviations: Glutamax (Glx), epididymal fat (epidi. fat), and retinoic acid (RA).

    Techniques Used: Cell Culture, Organ Culture, Knock-Out

    Morphological evaluation results for spermatocytes obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) with haematoxylin counter staining for Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 d pp adult rat testis control (C and D) showing primary spermatocytes. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining. The yellow arrow heads show primary spermatocytes. The scale bars are 10 µm (A and C) and 20 µm (B and D). Percentage of tubules containing spermatocytes (E) compared between the different culture conditions used. MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are represented in mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.
    Figure Legend Snippet: Morphological evaluation results for spermatocytes obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) with haematoxylin counter staining for Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 d pp adult rat testis control (C and D) showing primary spermatocytes. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining. The yellow arrow heads show primary spermatocytes. The scale bars are 10 µm (A and C) and 20 µm (B and D). Percentage of tubules containing spermatocytes (E) compared between the different culture conditions used. MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are represented in mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.

    Techniques Used: Staining, Cell Culture, Knock-Out

    Morphological evaluation results for round spermatids obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) of Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 days postpartum adult rat testis control (C and D) showing round spermatids. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining in the same samples to show overall organization in the tissue (small inserts; B and D). The violet arrow heads show acrosomal caps. The scale bars are 10 µm (A and C) and 50 µm (B and D). Percentage of tubules containing spermatids exhibiting acrosomal caps (E) compared between the different culture conditions used; MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.
    Figure Legend Snippet: Morphological evaluation results for round spermatids obtained from rat testicular tissue culture. Periodic acid Schiff's staining (PAS) of Bouin's solution-fixed paraffin-embedded testicular tissue cultured for 52 days in minimum essential medium alpha (MEMα) + 10% (v/v) knock-out serum replacement (KSR) (A and B) and 60 days postpartum adult rat testis control (C and D) showing round spermatids. Higher magnifications of B and D are shown in A and C, respectively. Hematoxylin was used for counter-staining in the same samples to show overall organization in the tissue (small inserts; B and D). The violet arrow heads show acrosomal caps. The scale bars are 10 µm (A and C) and 50 µm (B and D). Percentage of tubules containing spermatids exhibiting acrosomal caps (E) compared between the different culture conditions used; MEMα, minimal essential medium α;KSR, knock-out serum replacement; Glx, Glutamax; epidi. fat, epididymal fat; mel, melatonin; RA, retinoic acid. Values are mean ± SD ( n = 6–12). For statistical analysis, one-way ANOVA test was applied to compare between the percentages of tubules from the different culture conditions.

    Techniques Used: Staining, Cell Culture, Knock-Out

    29) Product Images from "In Vitro and In Vivo Characterization of MCT1 Inhibitor AZD3965 Confirms Preclinical Safety Compatible with Breast Cancer Treatment"

    Article Title: In Vitro and In Vivo Characterization of MCT1 Inhibitor AZD3965 Confirms Preclinical Safety Compatible with Breast Cancer Treatment

    Journal: Cancers

    doi: 10.3390/cancers13030569

    AZD3965 is not cytotoxic for proliferative breast-associated cells when glucose and glutamine are available as metabolic fuels. ( A ) Density of T47D, MCF7, MCF10A cells and BJ fibroblasts over time when cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate ( white circles ) or in medium containing 10 mmol/L sodium L -lactate, no glucose, no glutamine and 1% FBS (black circles) ( n = 8–16). ( B , C ) Cell density was assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( B ) Cell density over time after a single treatment (arrow) with vehicle or different doses of AZD3965 ( n = 8). ( C ) Cell density over time upon daily treatments (arrows) with vehicle or a given dose of AZD3965 ( n = 7–8). All data are shown as means ± SEM. *** p
    Figure Legend Snippet: AZD3965 is not cytotoxic for proliferative breast-associated cells when glucose and glutamine are available as metabolic fuels. ( A ) Density of T47D, MCF7, MCF10A cells and BJ fibroblasts over time when cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate ( white circles ) or in medium containing 10 mmol/L sodium L -lactate, no glucose, no glutamine and 1% FBS (black circles) ( n = 8–16). ( B , C ) Cell density was assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( B ) Cell density over time after a single treatment (arrow) with vehicle or different doses of AZD3965 ( n = 8). ( C ) Cell density over time upon daily treatments (arrows) with vehicle or a given dose of AZD3965 ( n = 7–8). All data are shown as means ± SEM. *** p

    Techniques Used: Cell Culture

    When MCT1 is used by proliferating cells to export lactate, AZD3965 induces an oxidative switch supporting ATP production in malignant but not in nonmalignant breast-associated cells. ( A ) Glycolytic efficiency of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate, calculated as the lactate production/glucose consumption ratio ( n = 3–5). ( B ) Glucose and lactate uptake over 24 h by untreated T47D, MCF7, MCF10A cells and BJ fibroblasts cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate (to determine basal glucose uptake, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine basal lactate uptake, grey bars) ( n = 3–5). ( C ) Basal mito OCR of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate (to determine glucose-dependent OCR, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine lactate-dependent OCR, grey bars) ( n = 11–22). ( D – K ) Cells were metabolically characterized in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( D ) Lactate release (right panel), pyruvate release (middle panel) and glucose uptake (right panel) over 24 h by T47D cells treated with increasing doses of AZD3965 ( n = 3–6). ( E ) As in D, but using MCF7 cells ( n = 3–6). ( F ) As in D, but using MCF10A cells ( n = 3–6). ( G ) As in D, but using BJ fibroblasts ( n = 3). ( H ) Basal mito OCR (left panel), maximal mito OCR (middle panel) and mito OCR linked to ATP production (right panel) of T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 9–12). ( I ) As in H, but using MCF7 cells ( n = 11). ( J ) As in H, but using MCF10A cells ( n = 11). ( K ) As in H, but using BJ fibroblasts ( n = 11–12). All data are shown as means ± SEM. * p
    Figure Legend Snippet: When MCT1 is used by proliferating cells to export lactate, AZD3965 induces an oxidative switch supporting ATP production in malignant but not in nonmalignant breast-associated cells. ( A ) Glycolytic efficiency of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate, calculated as the lactate production/glucose consumption ratio ( n = 3–5). ( B ) Glucose and lactate uptake over 24 h by untreated T47D, MCF7, MCF10A cells and BJ fibroblasts cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX and 10% FBS, without added lactate (to determine basal glucose uptake, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine basal lactate uptake, grey bars) ( n = 3–5). ( C ) Basal mito OCR of the cells cultured in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate (to determine glucose-dependent OCR, black bars) or in medium containing 10 mmol/L sodium L -lactate with no glucose, no glutamine and with 1% FBS (to determine lactate-dependent OCR, grey bars) ( n = 11–22). ( D – K ) Cells were metabolically characterized in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( D ) Lactate release (right panel), pyruvate release (middle panel) and glucose uptake (right panel) over 24 h by T47D cells treated with increasing doses of AZD3965 ( n = 3–6). ( E ) As in D, but using MCF7 cells ( n = 3–6). ( F ) As in D, but using MCF10A cells ( n = 3–6). ( G ) As in D, but using BJ fibroblasts ( n = 3). ( H ) Basal mito OCR (left panel), maximal mito OCR (middle panel) and mito OCR linked to ATP production (right panel) of T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 9–12). ( I ) As in H, but using MCF7 cells ( n = 11). ( J ) As in H, but using MCF10A cells ( n = 11). ( K ) As in H, but using BJ fibroblasts ( n = 11–12). All data are shown as means ± SEM. * p

    Techniques Used: Cell Culture, Metabolic Labelling

    Proliferative breast-associated cells upregulate MCT4 expression upon MCT1 inhibition by AZD3965. ( A – D ) Cells were assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( A ) mRNA (left panel) and protein (middle and right panels) expression of MCT1, MCT2, MCT4 and CD147/basigin in T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 3–6 for RT-qPCR, n = 3 for WB). ( B ) As in A, but using MCF7 cells ( n = 3–6 for RT-qPCR, n = 6 for WB). ( C ) As in A, but using MCF10A cells ( n = 3–6 for RT-qPCR, n = 3–9 for WB). ( D ) As in A, but using BJ fibroblasts ( n = 3–6 for RT-qPCR, n = 3–6 for WB). All data are shown as means ± SEM. * p
    Figure Legend Snippet: Proliferative breast-associated cells upregulate MCT4 expression upon MCT1 inhibition by AZD3965. ( A – D ) Cells were assayed in medium containing 25 mmol/L glucose with 10 mmol/L GlutaMAX, 10% FBS and without added lactate. ( A ) mRNA (left panel) and protein (middle and right panels) expression of MCT1, MCT2, MCT4 and CD147/basigin in T47D cells treated for 24 h ± 10 µM AZD3965 ( n = 3–6 for RT-qPCR, n = 3 for WB). ( B ) As in A, but using MCF7 cells ( n = 3–6 for RT-qPCR, n = 6 for WB). ( C ) As in A, but using MCF10A cells ( n = 3–6 for RT-qPCR, n = 3–9 for WB). ( D ) As in A, but using BJ fibroblasts ( n = 3–6 for RT-qPCR, n = 3–6 for WB). All data are shown as means ± SEM. * p

    Techniques Used: Expressing, Inhibition, Quantitative RT-PCR, Western Blot

    30) Product Images from "Epigenetic reprogramming of melanoma cell state through fatty acid β-oxidation and Toll-like receptor 4 signaling"

    Article Title: Epigenetic reprogramming of melanoma cell state through fatty acid β-oxidation and Toll-like receptor 4 signaling

    Journal: bioRxiv

    doi: 10.1101/2022.06.16.496450

    The fatty acid β-oxidation/ACLY/p300 axis regulates the abundance of histone acetylation Protein levels of histone acetylation in Zmel-1 ( A ) and A375 cells ( B ). Cells were supplied with indicated concentrations of octanoate for 20 hrs followed by Western blot analysis. β-actin was used as the loading control, respectively, n=3. ( C ) Immunofluorescence of H3K9ac in response to various fatty acid treatments. Zmel-1 were incubated with a vehicle control (BSA+isopropanol), 2 mM of octanoate (OctA) or 250 mM of palmitate (PA) or 250 mM of oleate (OA) for 48 hrs upon glucose-deprived DMEM condition (DMEM glucose-/glutaMAX+ ). Images were taken using ZEISS AXIO microscope with AXIOcam 503 mono camera system under 40X objectives across the whole field. H3K9ac fluorescence of each cell was outlined and normalized based on the nuclear area. Over 200 cells of each replicate were measured and quantified using ImageJ. Mean ± SEM, unpaired t-test, n=2, ****, p
    Figure Legend Snippet: The fatty acid β-oxidation/ACLY/p300 axis regulates the abundance of histone acetylation Protein levels of histone acetylation in Zmel-1 ( A ) and A375 cells ( B ). Cells were supplied with indicated concentrations of octanoate for 20 hrs followed by Western blot analysis. β-actin was used as the loading control, respectively, n=3. ( C ) Immunofluorescence of H3K9ac in response to various fatty acid treatments. Zmel-1 were incubated with a vehicle control (BSA+isopropanol), 2 mM of octanoate (OctA) or 250 mM of palmitate (PA) or 250 mM of oleate (OA) for 48 hrs upon glucose-deprived DMEM condition (DMEM glucose-/glutaMAX+ ). Images were taken using ZEISS AXIO microscope with AXIOcam 503 mono camera system under 40X objectives across the whole field. H3K9ac fluorescence of each cell was outlined and normalized based on the nuclear area. Over 200 cells of each replicate were measured and quantified using ImageJ. Mean ± SEM, unpaired t-test, n=2, ****, p

    Techniques Used: Western Blot, Immunofluorescence, Incubation, Microscopy, Fluorescence

    31) Product Images from "Cellular and computational models reveal environmental and genetic interactions in MMUT-type methylmalonic aciduria"

    Article Title: Cellular and computational models reveal environmental and genetic interactions in MMUT-type methylmalonic aciduria

    Journal: bioRxiv

    doi: 10.1101/2022.08.10.503435

    Metabolic dependencies of MMUT-deficient BJ5ta fibroblast cells. a Biolog phenotype microarrays for BJ5ta cells. Δ m,d,g represents the difference in absorbance between mutant (g) and WT for each metabolite (m) on day (d). Absorbance was measured after 24h. Metabolites were selected by Lenth statistical analysis (see Methods ). Results from two independent experiments (symbols). b Hypoxanthine secretion measured in the spent medium of the four cell lines indicated. c Glutamate secretion (top) and glutamine consumption (bottom) detected in the spent medium of BJ5ta fibroblast cells; symbols as in b. d Fraction of viable cells in a medium containing neither glutamax nor glutamine as a function of time. Dots: well; solid line: fit of a 3-parameter logistic curve. For parameter estimates and associated confidence intervals, see Supplementary table 9. Symbols as in b. e Growth rate as a function of glutamax concentration. Solid line: fit of a Michaelis-Menten curve. Estimated parameters and associated confidence intervals can be found in Supplementary table 4. Symbols as in b .
    Figure Legend Snippet: Metabolic dependencies of MMUT-deficient BJ5ta fibroblast cells. a Biolog phenotype microarrays for BJ5ta cells. Δ m,d,g represents the difference in absorbance between mutant (g) and WT for each metabolite (m) on day (d). Absorbance was measured after 24h. Metabolites were selected by Lenth statistical analysis (see Methods ). Results from two independent experiments (symbols). b Hypoxanthine secretion measured in the spent medium of the four cell lines indicated. c Glutamate secretion (top) and glutamine consumption (bottom) detected in the spent medium of BJ5ta fibroblast cells; symbols as in b. d Fraction of viable cells in a medium containing neither glutamax nor glutamine as a function of time. Dots: well; solid line: fit of a 3-parameter logistic curve. For parameter estimates and associated confidence intervals, see Supplementary table 9. Symbols as in b. e Growth rate as a function of glutamax concentration. Solid line: fit of a Michaelis-Menten curve. Estimated parameters and associated confidence intervals can be found in Supplementary table 4. Symbols as in b .

    Techniques Used: Mutagenesis, Concentration Assay

    32) Product Images from "T cell-recruiting triplebody 19-3-19 mediates serial lysis of malignant B-lymphoid cells by a single T cell"

    Article Title: T cell-recruiting triplebody 19-3-19 mediates serial lysis of malignant B-lymphoid cells by a single T cell

    Journal: Oncotarget

    doi:

    Specific redirected lysis of malignant target cell lines mediated by the 19-3 BiTE and triplebody 19-3-19 in conjunction with effector T cells Standard Calcein Release Assays with an E : T ratio of 10 : 1 (MNCs : target cells) and a duration of 3 hrs were performed unless indicated otherwise. Error bars indicate SEM. ( A ) Dose-Response-Curve for SEM cells (triangles: triplebody 19-3-19; squares: 19-3 BiTE; cross: specificity control Her2-3-Her2; n=4). ( B ) Maximum specific lysis of several CD19-positive malignant B-lymphoid cell lines (n=4 each) induced by 19-3 (white bars), triplebody 19-3-19 (black bars) and specificity control Her2-3-Her2 (grey bars), respectively. ( C ) Serial lysis of unlabeled SEM target cells mediated by triplebody 19-3-19 at different E : T ratios. The reaction mixture (purified T cells and SEM target cells in RPMI1640 GlutaMAX medium containing 10% FCS) was incubated with or without 1nM triplebody overnight (approx. 15 hrs) (n = 3). The total number of viable cells in each reaction was determined and the fraction of CD19-positive target cells was established by FACS analysis.
    Figure Legend Snippet: Specific redirected lysis of malignant target cell lines mediated by the 19-3 BiTE and triplebody 19-3-19 in conjunction with effector T cells Standard Calcein Release Assays with an E : T ratio of 10 : 1 (MNCs : target cells) and a duration of 3 hrs were performed unless indicated otherwise. Error bars indicate SEM. ( A ) Dose-Response-Curve for SEM cells (triangles: triplebody 19-3-19; squares: 19-3 BiTE; cross: specificity control Her2-3-Her2; n=4). ( B ) Maximum specific lysis of several CD19-positive malignant B-lymphoid cell lines (n=4 each) induced by 19-3 (white bars), triplebody 19-3-19 (black bars) and specificity control Her2-3-Her2 (grey bars), respectively. ( C ) Serial lysis of unlabeled SEM target cells mediated by triplebody 19-3-19 at different E : T ratios. The reaction mixture (purified T cells and SEM target cells in RPMI1640 GlutaMAX medium containing 10% FCS) was incubated with or without 1nM triplebody overnight (approx. 15 hrs) (n = 3). The total number of viable cells in each reaction was determined and the fraction of CD19-positive target cells was established by FACS analysis.

    Techniques Used: Lysis, Purification, Incubation, FACS

    33) Product Images from "Pyruvate attenuates the anti-neoplastic effect of carnosine independently from oxidative phosphorylation"

    Article Title: Pyruvate attenuates the anti-neoplastic effect of carnosine independently from oxidative phosphorylation

    Journal: Oncotarget

    doi: 10.18632/oncotarget.13039

    Amount of ATP in cell lysates of the line U87 under the influence of carnosine and CPI-613 Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without GlutaMax and FBS for 20 hours. Then, fresh medium was added with 25 mM glucose, 5 mM pyruvate or a combination of both nutrients. In addition, cells received 50 mM carnosine and/or 50 μM CPI-613. 24 hours later the amount of ATP in cell lysates was determined. Results are represented as mean and standard deviation of 6 wells for each condition normalized to cells cultivated in the presence of glucose (set as 100%). Statistical significance was determined by Student's t-test with: * p
    Figure Legend Snippet: Amount of ATP in cell lysates of the line U87 under the influence of carnosine and CPI-613 Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without GlutaMax and FBS for 20 hours. Then, fresh medium was added with 25 mM glucose, 5 mM pyruvate or a combination of both nutrients. In addition, cells received 50 mM carnosine and/or 50 μM CPI-613. 24 hours later the amount of ATP in cell lysates was determined. Results are represented as mean and standard deviation of 6 wells for each condition normalized to cells cultivated in the presence of glucose (set as 100%). Statistical significance was determined by Student's t-test with: * p

    Techniques Used: Standard Deviation

    Amount of ATP in cell lysates and NAD(P)H production in cells from the line U87 under different culture conditions Cells from the line U87 were cultivated for 20 hours at a density of 5000 cells per well in 96-well microplates in DMEM standard culture medium before they received fresh medium with different supplements: FBS: fetal bovine serum, 10%; Glx: GlutaMax, 2 mM; Glu/Gal/Pyr: glucose, galactose, pyruvate: each 25 mM; 0: no Glu/Gal/Pyr. 24 hours later the CellTiter-Glo assay (measuring ATP in cell lysates, left part of the panel) and the CellTiter-Blue assay (measuring NAD(P)H production, right part of the panel) were employed to assess cell viability. Signals obtained from cells cultivated in 25 mM glucose, 10% FBS and 2 mM GlutaMax were set as 100%. Results are presented as mean and standard deviation of 6 wells. Statistical significance was determined by Student's t-test with: * p
    Figure Legend Snippet: Amount of ATP in cell lysates and NAD(P)H production in cells from the line U87 under different culture conditions Cells from the line U87 were cultivated for 20 hours at a density of 5000 cells per well in 96-well microplates in DMEM standard culture medium before they received fresh medium with different supplements: FBS: fetal bovine serum, 10%; Glx: GlutaMax, 2 mM; Glu/Gal/Pyr: glucose, galactose, pyruvate: each 25 mM; 0: no Glu/Gal/Pyr. 24 hours later the CellTiter-Glo assay (measuring ATP in cell lysates, left part of the panel) and the CellTiter-Blue assay (measuring NAD(P)H production, right part of the panel) were employed to assess cell viability. Signals obtained from cells cultivated in 25 mM glucose, 10% FBS and 2 mM GlutaMax were set as 100%. Results are presented as mean and standard deviation of 6 wells. Statistical significance was determined by Student's t-test with: * p

    Techniques Used: Glo Assay, CtB Assay, Standard Deviation

    Amount of ATP in cell lysates and NAD(P)H production in the line U87 under the influence of glucose, galactose or pyruvate and carnosine after pre-starvation Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and were incubated for 20 hours in medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, medium was substituted for medium with different supplements: glucose (Glu), galactose (Gal), pyruvate (Pyr): 25 mM, no supplement (0); and with or without 50 mM carnosine. 24 and 48 hours later CellTiter-Glo and CellTiter-Blue assays were employed to determine ATP in cell lysates and NAD(P)H production in intact cells. In order to compare the effects of glucose, galactose and pyruvate in the presence and absence of carnosine, results are grouped into data sets with regard to the amount of ATP in cell lysates ( A ) and dehydrogenase activity ( B ). Results are represented as mean and standard deviation of 6 wells from three independent experiments for each condition normalized to signals recorded from cells cultivated in the presence of glucose and the absence of carnosine (set as 100%). Statistical significance was determined by Student's t-test with: * p
    Figure Legend Snippet: Amount of ATP in cell lysates and NAD(P)H production in the line U87 under the influence of glucose, galactose or pyruvate and carnosine after pre-starvation Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and were incubated for 20 hours in medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, medium was substituted for medium with different supplements: glucose (Glu), galactose (Gal), pyruvate (Pyr): 25 mM, no supplement (0); and with or without 50 mM carnosine. 24 and 48 hours later CellTiter-Glo and CellTiter-Blue assays were employed to determine ATP in cell lysates and NAD(P)H production in intact cells. In order to compare the effects of glucose, galactose and pyruvate in the presence and absence of carnosine, results are grouped into data sets with regard to the amount of ATP in cell lysates ( A ) and dehydrogenase activity ( B ). Results are represented as mean and standard deviation of 6 wells from three independent experiments for each condition normalized to signals recorded from cells cultivated in the presence of glucose and the absence of carnosine (set as 100%). Statistical significance was determined by Student's t-test with: * p

    Techniques Used: Incubation, Activity Assay, Standard Deviation

    Amount of ATP in cell lysates of cells from the lines U87, T98G and LN405 under the influence of the pyruvate dehydrogenase inhibitor CPI-613 Cells were seeded at a density of 5000 cells per well in 96-well microplates before they received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. 20 hours later fresh medium was added with different concentrations of CPI-613 (0 μM, 10 μM, 25 μM, 50 μM) in the presence of either glucose (Glu; 25 mM) or pyruvate (Pyr; 5 mM). 24 hours later ATP amount in cell lysates was determined using the CellTiter-Glo assay. ATP amount in cell lysates in the absence of inhibitor was set as 100%. Results are represented as mean and standard deviation of 6 wells for each condition. Statistical significance was determined by Student's t-test with: ** p
    Figure Legend Snippet: Amount of ATP in cell lysates of cells from the lines U87, T98G and LN405 under the influence of the pyruvate dehydrogenase inhibitor CPI-613 Cells were seeded at a density of 5000 cells per well in 96-well microplates before they received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. 20 hours later fresh medium was added with different concentrations of CPI-613 (0 μM, 10 μM, 25 μM, 50 μM) in the presence of either glucose (Glu; 25 mM) or pyruvate (Pyr; 5 mM). 24 hours later ATP amount in cell lysates was determined using the CellTiter-Glo assay. ATP amount in cell lysates in the absence of inhibitor was set as 100%. Results are represented as mean and standard deviation of 6 wells for each condition. Statistical significance was determined by Student's t-test with: ** p

    Techniques Used: Glo Assay, Standard Deviation

    Amount of ATP in cell lysates of the lines U87, T98G and LN405 under the influence of different concentrations of carnosine in the presence of glucose and glucose plus pyruvate Cells were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, fresh medium was added with either glucose (Glu; 25 mM) or a mixture of 25 mM glucose and 5 mM pyruvate (Glu+Pyr) and cell line dependent inhibitory concentrations of carnosine (see Supplementary Data S2 ). 24 hours later the amount of ATP in cell lysates was determined using the CellTiter-Glo assay. The amount of ATP in the absence of carnosine was set as 100%. Results are represented as mean and standard deviation of 6 wells for each condition. Statistical significance was determined by Student's t-test with: * p
    Figure Legend Snippet: Amount of ATP in cell lysates of the lines U87, T98G and LN405 under the influence of different concentrations of carnosine in the presence of glucose and glucose plus pyruvate Cells were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, fresh medium was added with either glucose (Glu; 25 mM) or a mixture of 25 mM glucose and 5 mM pyruvate (Glu+Pyr) and cell line dependent inhibitory concentrations of carnosine (see Supplementary Data S2 ). 24 hours later the amount of ATP in cell lysates was determined using the CellTiter-Glo assay. The amount of ATP in the absence of carnosine was set as 100%. Results are represented as mean and standard deviation of 6 wells for each condition. Statistical significance was determined by Student's t-test with: * p

    Techniques Used: Glo Assay, Standard Deviation

    Amount of ATP in cell lysates of the line U87 under the influence of carnosine and 2,4-dinitrophenol (DNP) Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without GlutaMax and FBS for 20 hours. Then, fresh medium was added with 25 mM glucose, 5 mM pyruvate or a combination of both nutrients. In addition, cells received 50 mM carnosine and/or 0.5 mM DNP. 24 hours later the amount of ATP in cell lysates was determined. Results are represented as mean and standard deviation of 6 wells for each condition normalized to cells cultivated in the presence of glucose (set as 100%). Statistical significance was determined by Student's t-test with: * p
    Figure Legend Snippet: Amount of ATP in cell lysates of the line U87 under the influence of carnosine and 2,4-dinitrophenol (DNP) Cells from the line U87 were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without GlutaMax and FBS for 20 hours. Then, fresh medium was added with 25 mM glucose, 5 mM pyruvate or a combination of both nutrients. In addition, cells received 50 mM carnosine and/or 0.5 mM DNP. 24 hours later the amount of ATP in cell lysates was determined. Results are represented as mean and standard deviation of 6 wells for each condition normalized to cells cultivated in the presence of glucose (set as 100%). Statistical significance was determined by Student's t-test with: * p

    Techniques Used: Standard Deviation

    Viability of U87 cells under the influence of carnosine in the presence of glucose, pyruvate, carnosine (Car), 2,4-dinitrophenol (DNP) and CPI-613 (CPI) U87 cells were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, fresh medium was added with either glucose (25 mM), pyruvate (5 mM) or both nutrients and in addition cells received carnosine (50 mM), CPI-613 (50 μM) or DNP (0.5 mM) or mixtures of these supplements. After 24 hours living cells were stained using Calcein AM (green) and dead cells were stained using propidium iodide (red). Fluorescence images were captured by microscopy. Scale bars: 200 μm. For quantification see Table 1 .
    Figure Legend Snippet: Viability of U87 cells under the influence of carnosine in the presence of glucose, pyruvate, carnosine (Car), 2,4-dinitrophenol (DNP) and CPI-613 (CPI) U87 cells were seeded at a density of 5000 cells per well in 96-well microplates and received medium without glucose, galactose or pyruvate and without FBS and GlutaMax. After 20 hours, fresh medium was added with either glucose (25 mM), pyruvate (5 mM) or both nutrients and in addition cells received carnosine (50 mM), CPI-613 (50 μM) or DNP (0.5 mM) or mixtures of these supplements. After 24 hours living cells were stained using Calcein AM (green) and dead cells were stained using propidium iodide (red). Fluorescence images were captured by microscopy. Scale bars: 200 μm. For quantification see Table 1 .

    Techniques Used: Staining, Fluorescence, Microscopy

    34) Product Images from "Bimodal regulation of axonal transport by the GDNF-RET signalling axis in healthy and diseased motor neurons"

    Article Title: Bimodal regulation of axonal transport by the GDNF-RET signalling axis in healthy and diseased motor neurons

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-022-05031-0

    Stimulation with GDNF enhances WT axonal transport. A Schematic representation of GDNF and GFRα1 transport experiments in three-compartment MFCs. Primary ventral horn neurons were cultured in the central (somatic) compartment of 3-channel MFCs, with axons projecting to two lateral fluidically isolated axonal chambers. 100 ng/ml GDNF, GFRα1, or both together were added to one axonal compartment, with PBS added to the other as an internal control. B – D Average endosome speeds following the addition of GDNF ( B ), GFRα1 ( C ), and GDNF + GFRα1 ( D ) in the right compartment and PBS in the left compartment ( B – D ). Each point represents a biological replicate. Connecting lines represent speeds observed in control and experimental condition-treated axons from the same cultures. Speeds were significantly increased with GDNF alone (* p = 0.02) and GDNF with GFRα1 (* p = 0.04), but not GFRα1 alone ( p = 0.6799), as determined by two-tailed paired t tests. E Representative kymographs showing signalling endosome transport in axons of WT primary MN cultures following treatment with PBS, GDNF, GFRα1 or GDNF together with GFRα1. N = 3–5 biological replicates. Bars represent mean ± SEM. PBS results were collected from 443 endosomes in 42 videos for a total of 45 569 single movements ( n = 5). GDNF results were collected from 218 endosomes in 22 videos for a total of 17 938 single movements ( n = 4). GFRα1 results were obtained from 216 endosomes in 24 videos for a total of 21 981 single movements ( n = 3). GDNF and GFRα1 results were collected from 400 endosomes in 29 axons for a total of 31 809 single movements ( n = 5). F Representative western blot of primary MN lysates following starvation in Neurobasal and Glutamax, and treatment with 50 ng/ml BDNF, or 100 ng/ml GDNF, and GDNF and GFRα1 (both 100 ng/ml). G – I Western blot quantification of RET, AKT and ERK1/2 activation after starvation and stimulation with BDNF, GDNF and GFRα1. Starvation significantly decreased activation of AKT (**** p
    Figure Legend Snippet: Stimulation with GDNF enhances WT axonal transport. A Schematic representation of GDNF and GFRα1 transport experiments in three-compartment MFCs. Primary ventral horn neurons were cultured in the central (somatic) compartment of 3-channel MFCs, with axons projecting to two lateral fluidically isolated axonal chambers. 100 ng/ml GDNF, GFRα1, or both together were added to one axonal compartment, with PBS added to the other as an internal control. B – D Average endosome speeds following the addition of GDNF ( B ), GFRα1 ( C ), and GDNF + GFRα1 ( D ) in the right compartment and PBS in the left compartment ( B – D ). Each point represents a biological replicate. Connecting lines represent speeds observed in control and experimental condition-treated axons from the same cultures. Speeds were significantly increased with GDNF alone (* p = 0.02) and GDNF with GFRα1 (* p = 0.04), but not GFRα1 alone ( p = 0.6799), as determined by two-tailed paired t tests. E Representative kymographs showing signalling endosome transport in axons of WT primary MN cultures following treatment with PBS, GDNF, GFRα1 or GDNF together with GFRα1. N = 3–5 biological replicates. Bars represent mean ± SEM. PBS results were collected from 443 endosomes in 42 videos for a total of 45 569 single movements ( n = 5). GDNF results were collected from 218 endosomes in 22 videos for a total of 17 938 single movements ( n = 4). GFRα1 results were obtained from 216 endosomes in 24 videos for a total of 21 981 single movements ( n = 3). GDNF and GFRα1 results were collected from 400 endosomes in 29 axons for a total of 31 809 single movements ( n = 5). F Representative western blot of primary MN lysates following starvation in Neurobasal and Glutamax, and treatment with 50 ng/ml BDNF, or 100 ng/ml GDNF, and GDNF and GFRα1 (both 100 ng/ml). G – I Western blot quantification of RET, AKT and ERK1/2 activation after starvation and stimulation with BDNF, GDNF and GFRα1. Starvation significantly decreased activation of AKT (**** p

    Techniques Used: Cell Culture, Isolation, Two Tailed Test, Western Blot, Activation Assay

    35) Product Images from "A Sprouty4 reporter to monitor FGF/ERK signaling activity in ESCs and mice"

    Article Title: A Sprouty4 reporter to monitor FGF/ERK signaling activity in ESCs and mice

    Journal: Developmental biology

    doi: 10.1016/j.ydbio.2018.06.017

    Response of Spry4 H2B-Venus reporter to FGF signaling inhibition during early post-implantation development. A. Schematic diagram of experimental design. E6.5 Spry4 H2B-Venus /+ embryos were dissected and cultured ex vivo for 24 hours either in control medium containing 50% DMEM with GlutaMAX and 50% rat serum or in control medium with 2 μM of the FGF receptor inhibitor (FGFRi) AZD4547 in combination with 1 μM of the MEK inhibitor (MEKi) PD0325901. B. Confocal images of E6.5 Spry4 H2B-Venus /+ embryos after 24 hours of ex vivo culture in described conditions. Upper to lower panels show: maximum intensity projections (MIP), optical sagittal sections and optical transverse sections. Nuclei are stained with Hoechst. Epi, epiblast; PS, primitive streak; M, mesoderm; Pr, proximal; Ds, distal; A, anterior; P, posterior; R, right; L, left. Dashed white line indicates plane of transverse optical section. Bracket demarcates the primitive streak. Scale bars, 100 μm. C. Quantification of mean Venus fluorescence in embryos after ex vivo culture. Venus fluorescence, measured in arbitrary units (a.u.) was measured in 100 randomly selected cells/embryo (50 visceral endoderm (VE) and 50 epiblast (Epi) cells) in wild-type embryos (n = 3 embryos, 300 cells), Spry4 H2B-Venus /+ non-treated (NT) embryos (n = 5 embryos, 500 cells) or Spry4 H2B-Venus /+ . *** p =
    Figure Legend Snippet: Response of Spry4 H2B-Venus reporter to FGF signaling inhibition during early post-implantation development. A. Schematic diagram of experimental design. E6.5 Spry4 H2B-Venus /+ embryos were dissected and cultured ex vivo for 24 hours either in control medium containing 50% DMEM with GlutaMAX and 50% rat serum or in control medium with 2 μM of the FGF receptor inhibitor (FGFRi) AZD4547 in combination with 1 μM of the MEK inhibitor (MEKi) PD0325901. B. Confocal images of E6.5 Spry4 H2B-Venus /+ embryos after 24 hours of ex vivo culture in described conditions. Upper to lower panels show: maximum intensity projections (MIP), optical sagittal sections and optical transverse sections. Nuclei are stained with Hoechst. Epi, epiblast; PS, primitive streak; M, mesoderm; Pr, proximal; Ds, distal; A, anterior; P, posterior; R, right; L, left. Dashed white line indicates plane of transverse optical section. Bracket demarcates the primitive streak. Scale bars, 100 μm. C. Quantification of mean Venus fluorescence in embryos after ex vivo culture. Venus fluorescence, measured in arbitrary units (a.u.) was measured in 100 randomly selected cells/embryo (50 visceral endoderm (VE) and 50 epiblast (Epi) cells) in wild-type embryos (n = 3 embryos, 300 cells), Spry4 H2B-Venus /+ non-treated (NT) embryos (n = 5 embryos, 500 cells) or Spry4 H2B-Venus /+ . *** p =

    Techniques Used: Inhibition, Cell Culture, Ex Vivo, Staining, Fluorescence

    36) Product Images from "The Importance of Multifrequency Impedance Sensing of Endothelial Barrier Formation Using ECIS Technology for the Generation of a Strong and Durable Paracellular Barrier"

    Article Title: The Importance of Multifrequency Impedance Sensing of Endothelial Barrier Formation Using ECIS Technology for the Generation of a Strong and Durable Paracellular Barrier

    Journal: Biosensors

    doi: 10.3390/bios8030064

    Changes in R b as a consequence of altering growth medium components as shown by brain endothelium. Endothelial cells were seeded at 20,000 cells per well on a 96w20idf ECIS array. Time 0 h denotes the time cells were seeded. The dotted vertical line indicates 48 h of cell growth in each respective media type, with a subsequent media change carried out at this time. ( A ) Brain endothelium grown in Enriched Media containing either 10%, 5%, or 2% FBS; ( B ) Brain endothelium grown in Enriched Media containing either 160 µM, 80 µM, 40 µM, or 0 µM cAMP; ( C ) Brain endothelium grown in Enriched Media containing either 1 µg/mL, 39 ng/mL, or 0 ng/mL hydrocortisone; ( D ) Brain endothelium grown in Enriched Media containing either 1 ng/mL or 0 ng/mL EGF; ( E ) Brain endothelium grown in Enriched Media containing either 3 ng/mL or 0 ng/mL FGF; ( F ) Brain endothelium grown in Enriched Media containing either 10 µg/mL or 0 µg/mL heparin; ( G ) Brain endothelium grown in Enriched Media containing either 1× or no Glutamax. Data show the mean ± SD (n = 3 wells) of one independent experiment representative of three experimental repeats. Graphical representations of p values are * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.
    Figure Legend Snippet: Changes in R b as a consequence of altering growth medium components as shown by brain endothelium. Endothelial cells were seeded at 20,000 cells per well on a 96w20idf ECIS array. Time 0 h denotes the time cells were seeded. The dotted vertical line indicates 48 h of cell growth in each respective media type, with a subsequent media change carried out at this time. ( A ) Brain endothelium grown in Enriched Media containing either 10%, 5%, or 2% FBS; ( B ) Brain endothelium grown in Enriched Media containing either 160 µM, 80 µM, 40 µM, or 0 µM cAMP; ( C ) Brain endothelium grown in Enriched Media containing either 1 µg/mL, 39 ng/mL, or 0 ng/mL hydrocortisone; ( D ) Brain endothelium grown in Enriched Media containing either 1 ng/mL or 0 ng/mL EGF; ( E ) Brain endothelium grown in Enriched Media containing either 3 ng/mL or 0 ng/mL FGF; ( F ) Brain endothelium grown in Enriched Media containing either 10 µg/mL or 0 µg/mL heparin; ( G ) Brain endothelium grown in Enriched Media containing either 1× or no Glutamax. Data show the mean ± SD (n = 3 wells) of one independent experiment representative of three experimental repeats. Graphical representations of p values are * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.

    Techniques Used: Electric Cell-substrate Impedance Sensing

    37) Product Images from "Lentiviral Vector Production from a Stable Packaging Cell Line Using a Packed Bed Bioreactor"

    Article Title: Lentiviral Vector Production from a Stable Packaging Cell Line Using a Packed Bed Bioreactor

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1016/j.omtm.2020.08.010

    FBS Concentration Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 1%–10% FBS and 2 mM GlutaMAX. The pH set point was adjusted to 6.8 after induction in all reactors. (A) Cell density on each day post-induction in each reactor at FBS concentrations from 1% to 10%. (B) Glucose consumption per day post-induction at FBS concentrations from 1% to 10%. (C) Viral yield on each day post-induction at FBS concentrations from 1% to 10%. (D) Scale-up. A 10-cm iCELLis bioreactor was inoculated with 4 × 10 8 cells and induced 5 days later. At induction, the pH set point was adjusted to 6.8 and the FBS concentration was reduced to 5%. A cell factory was inoculated with 1.4 × 10 8 cells and induced 3 days later. The FBS concentration remained at 10%.
    Figure Legend Snippet: FBS Concentration Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 1%–10% FBS and 2 mM GlutaMAX. The pH set point was adjusted to 6.8 after induction in all reactors. (A) Cell density on each day post-induction in each reactor at FBS concentrations from 1% to 10%. (B) Glucose consumption per day post-induction at FBS concentrations from 1% to 10%. (C) Viral yield on each day post-induction at FBS concentrations from 1% to 10%. (D) Scale-up. A 10-cm iCELLis bioreactor was inoculated with 4 × 10 8 cells and induced 5 days later. At induction, the pH set point was adjusted to 6.8 and the FBS concentration was reduced to 5%. A cell factory was inoculated with 1.4 × 10 8 cells and induced 3 days later. The FBS concentration remained at 10%.

    Techniques Used: Concentration Assay

    Comparison of pH and Glucose Consumption after Induction (A) pH after induction in engineering run 6 (ER6) and production run (GMP batch 17-135). Both runs were performed in 10-layer cell factories. (B) Glucose consumption post-induction in ER6 and production run (GMP batch 17-135). (C) Cell density post-induction in iCELLis bioreactors at pH 6.6, 6.8, 7.0, and 7.2. Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 10% FBS and 2 mM GlutaMAX. (D) Glucose consumption per day after induction at each pH value in iCELLis bioreactors. (E) Average viral yield on each day post-induction in iCELLis bioreactors at pH 6.6, 6.8, 7.0, and 7.2 (n = 2). (F) Viral yield on each day post-induction in bioreactors at pH 6.2, 6.4, and 6.6. Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 10% FBS and 2 mM GlutaMAX.
    Figure Legend Snippet: Comparison of pH and Glucose Consumption after Induction (A) pH after induction in engineering run 6 (ER6) and production run (GMP batch 17-135). Both runs were performed in 10-layer cell factories. (B) Glucose consumption post-induction in ER6 and production run (GMP batch 17-135). (C) Cell density post-induction in iCELLis bioreactors at pH 6.6, 6.8, 7.0, and 7.2. Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 10% FBS and 2 mM GlutaMAX. (D) Glucose consumption per day after induction at each pH value in iCELLis bioreactors. (E) Average viral yield on each day post-induction in iCELLis bioreactors at pH 6.6, 6.8, 7.0, and 7.2 (n = 2). (F) Viral yield on each day post-induction in bioreactors at pH 6.2, 6.4, and 6.6. Bioreactors were inoculated with 8 × 10 7 cells and induced 5 days later in DMEM with 10% FBS and 2 mM GlutaMAX.

    Techniques Used:

    Day of Induction Bioreactors were inoculated with 8 × 10 7 cells and induced 4–7 days later in DMEM with 10% FBS and 2 mM GlutaMAX. The pH set point was adjusted to 6.8 after induction in all reactors. Culture continued for 11 days post-induction in the reactor induced 4 days after seeding, for 10 days in the reactor induced 5 days after seeding, for 9 days in the reactor induced 6 days after seeding, and for 8 days in the reactor induced 7 days after seeding. (A) Cell density on each day post-induction in reactors induced 4–7 days after inoculation. (B) Glucose consumption per day post-induction for reactors induced 4–7 days after inoculation. (C) Viral yield on each day post-induction for reactors induced 4–7 days after inoculation.
    Figure Legend Snippet: Day of Induction Bioreactors were inoculated with 8 × 10 7 cells and induced 4–7 days later in DMEM with 10% FBS and 2 mM GlutaMAX. The pH set point was adjusted to 6.8 after induction in all reactors. Culture continued for 11 days post-induction in the reactor induced 4 days after seeding, for 10 days in the reactor induced 5 days after seeding, for 9 days in the reactor induced 6 days after seeding, and for 8 days in the reactor induced 7 days after seeding. (A) Cell density on each day post-induction in reactors induced 4–7 days after inoculation. (B) Glucose consumption per day post-induction for reactors induced 4–7 days after inoculation. (C) Viral yield on each day post-induction for reactors induced 4–7 days after inoculation.

    Techniques Used:

    38) Product Images from "Uncovering the secretome of mesenchymal stromal cells exposed to healthy, traumatic, and degenerative intervertebral discs: a proteomic analysis"

    Article Title: Uncovering the secretome of mesenchymal stromal cells exposed to healthy, traumatic, and degenerative intervertebral discs: a proteomic analysis

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-020-02062-2

    Experimental setup. a Mesenchymal stromal cells (MSCs; N = 12) were isolated from vertebral bone marrow aspirates obtained with written consent from patients undergoing spine surgery. b Intervertebral disc (IVD) tissue from patients suffering from spinal trauma (referred to as traumatic), from patients with disc degeneration (referred to as degenerative), and non-degenerated IVDs from organ donors (referred to as healthy) were obtained with written patient and/or familial consent. Tissue was incubated in basal medium for 48 h to collect released factors (referred to as IVD conditioned medium (CM)). Basal medium supplemented with IL-1β (10 ng/mL) was prepared as proinflammatory control. c MSCs were seeded in 6-well plates. After overnight attachment and 6 h of starvation, MSCs were stimulated with healthy CM ( N = 4, pooled), traumatic CM ( N = 4, pooled), degenerative CM ( N = 4, pooled), IL-1β, and basal medium (baseline control), respectively. After 24 h of stimulation, stimulants were removed, and fresh basal medium was added to collect the MSC secretome during the following 24 h. MSC secretome was analyzed by LC-MS/MS and immunoassay. MSCs were analyzed by CellTiter-Blue, lactate dehydrogenase (LDH) assay, DNA quantification. BM = basal medium (low glucose-DMEM, 1% L-Ascorbic acid 2-phosphate, 1% Glutamax)
    Figure Legend Snippet: Experimental setup. a Mesenchymal stromal cells (MSCs; N = 12) were isolated from vertebral bone marrow aspirates obtained with written consent from patients undergoing spine surgery. b Intervertebral disc (IVD) tissue from patients suffering from spinal trauma (referred to as traumatic), from patients with disc degeneration (referred to as degenerative), and non-degenerated IVDs from organ donors (referred to as healthy) were obtained with written patient and/or familial consent. Tissue was incubated in basal medium for 48 h to collect released factors (referred to as IVD conditioned medium (CM)). Basal medium supplemented with IL-1β (10 ng/mL) was prepared as proinflammatory control. c MSCs were seeded in 6-well plates. After overnight attachment and 6 h of starvation, MSCs were stimulated with healthy CM ( N = 4, pooled), traumatic CM ( N = 4, pooled), degenerative CM ( N = 4, pooled), IL-1β, and basal medium (baseline control), respectively. After 24 h of stimulation, stimulants were removed, and fresh basal medium was added to collect the MSC secretome during the following 24 h. MSC secretome was analyzed by LC-MS/MS and immunoassay. MSCs were analyzed by CellTiter-Blue, lactate dehydrogenase (LDH) assay, DNA quantification. BM = basal medium (low glucose-DMEM, 1% L-Ascorbic acid 2-phosphate, 1% Glutamax)

    Techniques Used: Isolation, Incubation, Liquid Chromatography with Mass Spectroscopy, Lactate Dehydrogenase Assay

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher α mem
    Pirfenidone significantly reduced TGF-β1-stimulated phosphorylation of ERK1/2 in both CT- and DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in <t>α-MEM</t> medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β1 (10 ng/ml) for 15 min. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated ERK1/2. b Densitometry results are reported as the ratio of phosphorylated ERK1/2 protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p
    α Mem, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α mem/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    α mem - by Bioz Stars, 2022-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher transfection medium
    G15 enhanced doxorubicin sensitivity through inhibition of GPR30. Knockdown of GPR30 enhanced the doxorubicin sensitivity of Bcap-37 (A), MCF-7 (B), and MDA-MB-231 (C) cells. After <t>transfection</t> with GPR30 siRNA, CCK-8 cell viability assays were performed
    Transfection Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transfection medium/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transfection medium - by Bioz Stars, 2022-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Pirfenidone significantly reduced TGF-β1-stimulated phosphorylation of ERK1/2 in both CT- and DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β1 (10 ng/ml) for 15 min. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated ERK1/2. b Densitometry results are reported as the ratio of phosphorylated ERK1/2 protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Journal: BMC Musculoskeletal Disorders

    Article Title: Investigating the effects of Pirfenidone on TGF-β1 stimulated non-SMAD signaling pathways in Dupuytren’s disease -derived fibroblasts

    doi: 10.1186/s12891-019-2486-3

    Figure Lengend Snippet: Pirfenidone significantly reduced TGF-β1-stimulated phosphorylation of ERK1/2 in both CT- and DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β1 (10 ng/ml) for 15 min. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated ERK1/2. b Densitometry results are reported as the ratio of phosphorylated ERK1/2 protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Article Snippet: Fibroblasts were cultured in the α-MEM (Invitrogen™, ThermoFisher Scientific, Pittsburgh, PA) containing 10% FBS and 10% penicillin/streptomycin (Gibco®, ThermoFisher Scientific) and maintained in an incubator with 5% CO2 .

    Techniques: Derivative Assay, Western Blot, Expressing

    Pirfenidone significantly reduced TGF-β1-induced phosphorylation of MLC in DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either treated or untreated with PFD (800 μg/ml) and in the presence or absence of TGF-β1 (10 ng/ml) for additional 24 h. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated MLC. b Densitometry results are reported as the ratio of phosphorylated MLC protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Journal: BMC Musculoskeletal Disorders

    Article Title: Investigating the effects of Pirfenidone on TGF-β1 stimulated non-SMAD signaling pathways in Dupuytren’s disease -derived fibroblasts

    doi: 10.1186/s12891-019-2486-3

    Figure Lengend Snippet: Pirfenidone significantly reduced TGF-β1-induced phosphorylation of MLC in DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either treated or untreated with PFD (800 μg/ml) and in the presence or absence of TGF-β1 (10 ng/ml) for additional 24 h. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated MLC. b Densitometry results are reported as the ratio of phosphorylated MLC protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Article Snippet: Fibroblasts were cultured in the α-MEM (Invitrogen™, ThermoFisher Scientific, Pittsburgh, PA) containing 10% FBS and 10% penicillin/streptomycin (Gibco®, ThermoFisher Scientific) and maintained in an incubator with 5% CO2 .

    Techniques: Derivative Assay, Western Blot, Expressing

    Pirfenidone reduced both TGF-β1-induced and basal phospho-p38 levels in DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β 1 (10 ng/ml) for 5 min. Cell lysates collected were subjected to Western blot analyses to determine the expression of phospho-p38. b Densitometry results are reported as the ratio of phosphorylated p-38 protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Journal: BMC Musculoskeletal Disorders

    Article Title: Investigating the effects of Pirfenidone on TGF-β1 stimulated non-SMAD signaling pathways in Dupuytren’s disease -derived fibroblasts

    doi: 10.1186/s12891-019-2486-3

    Figure Lengend Snippet: Pirfenidone reduced both TGF-β1-induced and basal phospho-p38 levels in DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β 1 (10 ng/ml) for 5 min. Cell lysates collected were subjected to Western blot analyses to determine the expression of phospho-p38. b Densitometry results are reported as the ratio of phosphorylated p-38 protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. * p

    Article Snippet: Fibroblasts were cultured in the α-MEM (Invitrogen™, ThermoFisher Scientific, Pittsburgh, PA) containing 10% FBS and 10% penicillin/streptomycin (Gibco®, ThermoFisher Scientific) and maintained in an incubator with 5% CO2 .

    Techniques: Derivative Assay, Western Blot, Expressing

    Pirfenidone significantly reduced TGF-β1-induced phosphorylation of Akt in CT- and DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β1 (10 ng/ml) for an additional 24 h. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated Akt. b Densitometry results are reported as the ratio of phosphorylated Akt protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. b Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. *** p

    Journal: BMC Musculoskeletal Disorders

    Article Title: Investigating the effects of Pirfenidone on TGF-β1 stimulated non-SMAD signaling pathways in Dupuytren’s disease -derived fibroblasts

    doi: 10.1186/s12891-019-2486-3

    Figure Lengend Snippet: Pirfenidone significantly reduced TGF-β1-induced phosphorylation of Akt in CT- and DD-derived fibroblasts. a CT- and DD-cord derived fibroblasts derived from three different patient samples ( N = 3/group) were maintained in α-MEM medium containing 0.1% dialyzed FBS for 24 h. After 24 h, cells were either left as controls or treated with PFD (800 μg/ml) in the presence or absence of TGF-β1 (10 ng/ml) for an additional 24 h. Cell lysates were subjected to Western blot analyses to determine the expression of phosphorylated Akt. b Densitometry results are reported as the ratio of phosphorylated Akt protein level to GAPDH expression. Values are means ± standard error mean (SEM) of three independent studies from each of CT- and DD- derived fibroblasts. b Shown here is a representative image of Western blots from three different cultures of CT- and DD-cord derived fibroblasts, each showing similar results. *** p

    Article Snippet: Fibroblasts were cultured in the α-MEM (Invitrogen™, ThermoFisher Scientific, Pittsburgh, PA) containing 10% FBS and 10% penicillin/streptomycin (Gibco®, ThermoFisher Scientific) and maintained in an incubator with 5% CO2 .

    Techniques: Derivative Assay, Western Blot, Expressing

    Regulation of mRNA expression of osteoclast differentiation markers by rLOX-PP . BMSCs were plated in 6-well plates in a 5 × 10 6 cells per well and grown in α-MEM supplemented with 10 % fetal bovine serum (FBS).

    Journal: Journal of Cell Communication and Signaling

    Article Title: Lysyl oxidase propeptide stimulates osteoblast and osteoclast differentiation and enhances PC3 and DU145 prostate cancer cell effects on bone in vivo

    doi: 10.1007/s12079-015-0311-9

    Figure Lengend Snippet: Regulation of mRNA expression of osteoclast differentiation markers by rLOX-PP . BMSCs were plated in 6-well plates in a 5 × 10 6 cells per well and grown in α-MEM supplemented with 10 % fetal bovine serum (FBS).

    Article Snippet: Dulbecco’s Modified Eagle’s Medium (DMEM), α-MEM medium, phosphate-buffered saline (PBS), trypsin and antibiotics (Penn/Strep) were obtained from Invitrogen.

    Techniques: Expressing

    ( a ) Mass signal intensities of [Au + ] ions ( I [Au1]+ ) obtained when using Apt MUC1 –Au NPs/GO to analyze apigenin-treated (0–75 μM) MCF-7 cells (10 5 cells well –1 ). ( b ) Cell viability of MCF-7 cells incubated with apigenin in alpha-MEM at 37 °C under 5% CO 2 for 24 h. ( c ) Western blotting for MUC1 in the cell lysates of ( A ) MCF-7 cells (10 5 cells well –1 ), ( B ) MCF-7 cells (10 5 cells well –1 ) after treatment with 75 μM apigenin for 24 h, and ( C ) 293T cells (10 5 cells well –1 ). Other conditions were the same as those described in Fig. 2 .

    Journal: Scientific Reports

    Article Title: Multivalent Aptamer/Gold Nanoparticle–Modified Graphene Oxide for Mass Spectrometry–Based Tumor Tissue Imaging

    doi: 10.1038/srep10292

    Figure Lengend Snippet: ( a ) Mass signal intensities of [Au + ] ions ( I [Au1]+ ) obtained when using Apt MUC1 –Au NPs/GO to analyze apigenin-treated (0–75 μM) MCF-7 cells (10 5 cells well –1 ). ( b ) Cell viability of MCF-7 cells incubated with apigenin in alpha-MEM at 37 °C under 5% CO 2 for 24 h. ( c ) Western blotting for MUC1 in the cell lysates of ( A ) MCF-7 cells (10 5 cells well –1 ), ( B ) MCF-7 cells (10 5 cells well –1 ) after treatment with 75 μM apigenin for 24 h, and ( C ) 293T cells (10 5 cells well –1 ). Other conditions were the same as those described in Fig. 2 .

    Article Snippet: Alpha-MEM and fetal bovine serum were purchased from GIBCO (Campinas, Brazil).

    Techniques: Incubation, Western Blot

    G15 enhanced doxorubicin sensitivity through inhibition of GPR30. Knockdown of GPR30 enhanced the doxorubicin sensitivity of Bcap-37 (A), MCF-7 (B), and MDA-MB-231 (C) cells. After transfection with GPR30 siRNA, CCK-8 cell viability assays were performed

    Journal: American Journal of Translational Research

    Article Title: G15 sensitizes epithelial breast cancer cells to doxorubicin by preventing epithelial-mesenchymal transition through inhibition of GPR30

    doi:

    Figure Lengend Snippet: G15 enhanced doxorubicin sensitivity through inhibition of GPR30. Knockdown of GPR30 enhanced the doxorubicin sensitivity of Bcap-37 (A), MCF-7 (B), and MDA-MB-231 (C) cells. After transfection with GPR30 siRNA, CCK-8 cell viability assays were performed

    Article Snippet: The transfection medium (Opti-MEM; Gibco, USA) was replaced with complete medium 12 h after transfection, and the cells were incubated for the indicated times.

    Techniques: Inhibition, Multiple Displacement Amplification, Transfection, CCK-8 Assay