gfp vector  (Lonza)


Bioz Verified Symbol Lonza is a verified supplier
Bioz Manufacturer Symbol Lonza manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    GS piggyBac Base Vector
    Description:
    GS piggyBac Base Vector SPB 007 20ug
    Catalog Number:
    SPB-007
    Price:
    None
    Category:
    Vectors plasmids
    Applications:
    CHO Cell line construction, cell line development, cell line engineering, cell line selection, gene expression, protein production, stable transfection, transient transfection, cloning, recombinant protein production, electroporation, transfection, transfectant pools, stable pools, mini pools, mini-pools, clonal cell line, monoclonal antibodies, bi-specific antibodies, Fc fusion proteins, minibodies, fusion proteins, recombinant proteins, difficult to express proteins, complex proteins, plasmid preparation , vector construction, golden gate, GS selection, GS selectable marker
    Size:
    20ug
    Buy from Supplier


    Structured Review

    Lonza gfp vector
    <t>BATF</t> silencing enhanced cytokine secretions by PPD-specific T cells in PBMCs in patients with ATB. (A) Representative fluorescence microscopy image of transfected primary human PBMCs after 24 h of electroporation with 2 μg <t>GFP</t> Vector, and red arrow indicated transfected PBMCs containing GFP (× 200). (B) Transfection efficiency of primary human PBMCs 24 h post electroporation were assessed by analysis of GFP protein expression by flow cytometry. (C) Silencing of BATF by a BATF siRNA SMART pool in primary human PBMCs from ATB patients measured by real-time quantitative PCR. Expression normalized to a housekeeping gene ( GAPDH ) is presented as fold change relative to negative control siRNA. (D) PBMCs were electroporated with indicated siRNA, then cultured with M. tb -specific antigen PPD (25 μg/mL) overnight, and IL-2 or IFN-γ mRNA levels were measured by real-time quantitative PCR. The information of controls and cell viability after transfection was provided in the Methods section BATF Small Interfering RNA (siRNA) Knockdown in ATB Patients ( 11 ). Data are expressed as mean ± SEM ( n = 7). * P
    GS piggyBac Base Vector SPB 007 20ug
    https://www.bioz.com/result/gfp vector/product/Lonza
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gfp vector - by Bioz Stars, 2021-05
    94/100 stars

    Images

    1) Product Images from "BATF Potentially Mediates Negative Regulation of PD-1/PD-Ls Pathway on T Cell Functions in Mycobacterium tuberculosis Infection"

    Article Title: BATF Potentially Mediates Negative Regulation of PD-1/PD-Ls Pathway on T Cell Functions in Mycobacterium tuberculosis Infection

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2019.02430

    BATF silencing enhanced cytokine secretions by PPD-specific T cells in PBMCs in patients with ATB. (A) Representative fluorescence microscopy image of transfected primary human PBMCs after 24 h of electroporation with 2 μg GFP Vector, and red arrow indicated transfected PBMCs containing GFP (× 200). (B) Transfection efficiency of primary human PBMCs 24 h post electroporation were assessed by analysis of GFP protein expression by flow cytometry. (C) Silencing of BATF by a BATF siRNA SMART pool in primary human PBMCs from ATB patients measured by real-time quantitative PCR. Expression normalized to a housekeeping gene ( GAPDH ) is presented as fold change relative to negative control siRNA. (D) PBMCs were electroporated with indicated siRNA, then cultured with M. tb -specific antigen PPD (25 μg/mL) overnight, and IL-2 or IFN-γ mRNA levels were measured by real-time quantitative PCR. The information of controls and cell viability after transfection was provided in the Methods section BATF Small Interfering RNA (siRNA) Knockdown in ATB Patients ( 11 ). Data are expressed as mean ± SEM ( n = 7). * P
    Figure Legend Snippet: BATF silencing enhanced cytokine secretions by PPD-specific T cells in PBMCs in patients with ATB. (A) Representative fluorescence microscopy image of transfected primary human PBMCs after 24 h of electroporation with 2 μg GFP Vector, and red arrow indicated transfected PBMCs containing GFP (× 200). (B) Transfection efficiency of primary human PBMCs 24 h post electroporation were assessed by analysis of GFP protein expression by flow cytometry. (C) Silencing of BATF by a BATF siRNA SMART pool in primary human PBMCs from ATB patients measured by real-time quantitative PCR. Expression normalized to a housekeeping gene ( GAPDH ) is presented as fold change relative to negative control siRNA. (D) PBMCs were electroporated with indicated siRNA, then cultured with M. tb -specific antigen PPD (25 μg/mL) overnight, and IL-2 or IFN-γ mRNA levels were measured by real-time quantitative PCR. The information of controls and cell viability after transfection was provided in the Methods section BATF Small Interfering RNA (siRNA) Knockdown in ATB Patients ( 11 ). Data are expressed as mean ± SEM ( n = 7). * P

    Techniques Used: Fluorescence, Microscopy, Transfection, Electroporation, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction, Negative Control, Cell Culture, Small Interfering RNA

    2) Product Images from "Glia Maturation Factor-γ Regulates Monocyte Migration through Modulation of β1-Integrin *"

    Article Title: Glia Maturation Factor-γ Regulates Monocyte Migration through Modulation of β1-Integrin *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.674200

    GMFG overexpression enhances chemoattractant-stimulated cell migration and adhesion to FN. Human monocytes or THP-1 cells were transfected with GFP vector or GFP-tagged GMFG plasmid for 48 h. A , Western blotting analysis of expression of GMFG or GMFG-GFP
    Figure Legend Snippet: GMFG overexpression enhances chemoattractant-stimulated cell migration and adhesion to FN. Human monocytes or THP-1 cells were transfected with GFP vector or GFP-tagged GMFG plasmid for 48 h. A , Western blotting analysis of expression of GMFG or GMFG-GFP

    Techniques Used: Over Expression, Migration, Transfection, Plasmid Preparation, Western Blot, Expressing

    Related Articles

    Modification:

    Article Title: Recombinase-mediated cassette exchange (RMCE) for monoclonal antibody expression in the commercially relevant CHOK1SV cell line.
    Article Snippet: To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics.

    Plasmid Preparation:

    Article Title: Recombinase-mediated cassette exchange (RMCE) for monoclonal antibody expression in the commercially relevant CHOK1SV cell line.
    Article Snippet: To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics.

    Article Title: Novel micro-bioreactor high throughput technology for cell culture process development: Reproducibility and scalability assessment of fed-batch CHO cultures.
    Article Snippet: With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes.

    Article Title: JAK/STAT3 signalling is sufficient and dominant over antagonistic cues for the establishment of naive pluripotency
    Article Snippet: PD173074 was used at a concentration of 0.1 μM. .. Transfection of PiggyBac vector into NS and pre-iPS cell lines was performed by nucleofection of plasmid DNA with the Lonza (amaxa) cell nucleofector, protocol T-020 (kit V). .. Transfection of PiggyBac vector into EpiSCs was made by lipofection (Invitrogen lipofectamine 2000).

    Article Title: Generation and characterization of a potent fully human monoclonal antibody against the interleukin-23 receptor.
    Article Snippet: .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively. .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively.

    Article Title: The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes
    Article Snippet: .. Competition experiment with qPCR U6-sgRNA-E+F scaffold and EFS-NS-Cas9-P2A-ZeocinR-WPRE digested from pTF vector with AflII and HindIII and cloned into the piggyBac backbone ( ). sgRNAs targeting Klf5 (5’ TGGCGAATTAACTGGCAGAG), Nanog (5’ TGTCCTTGAGTGCACACAGC), Oct4 (5’ CCGCCCGCATACGAGTTCTG), Zbtb10 (5’ AGAAACGGCTGCCTGCAACC), Zbtb11 (5’ AGCGCACAAGTCTGTCCTCT), Zfp131 (5’ GTTCTTTAAAGTGTCCAAAG) and non-targeting sgRNA (5’ GCCGCAACGTTAGATGTATA) were cloned into piggyBac plasmids. .. Equimolar ratio (0.5 μg) of plasmids were pooled and co-nucleofected (Lonza) with 0.5 μg pBac transposase to mESCs ( ).

    Mutagenesis:

    Article Title: Recombinase-mediated cassette exchange (RMCE) for monoclonal antibody expression in the commercially relevant CHOK1SV cell line.
    Article Snippet: To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics. .. To meet product quality and cost parameters for therapeutic monoclonal antibody (mAb) production, cell lines are required to have excellent growth, stability, and productivity characteristics.

    Transfection:

    Article Title: Novel micro-bioreactor high throughput technology for cell culture process development: Reproducibility and scalability assessment of fed-batch CHO cultures.
    Article Snippet: With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes.

    Article Title: JAK/STAT3 signalling is sufficient and dominant over antagonistic cues for the establishment of naive pluripotency
    Article Snippet: PD173074 was used at a concentration of 0.1 μM. .. Transfection of PiggyBac vector into NS and pre-iPS cell lines was performed by nucleofection of plasmid DNA with the Lonza (amaxa) cell nucleofector, protocol T-020 (kit V). .. Transfection of PiggyBac vector into EpiSCs was made by lipofection (Invitrogen lipofectamine 2000).

    Expressing:

    Article Title: Novel micro-bioreactor high throughput technology for cell culture process development: Reproducibility and scalability assessment of fed-batch CHO cultures.
    Article Snippet: With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes. .. With increasing timeline pressures to get therapeutic and vaccine candidates into the clinic, resource intensive approaches such as the use of shake flasks and bench-top bioreactors may limit the design space for experimentation to yield highly productive processes.

    Synthesized:

    Article Title: Generation and characterization of a potent fully human monoclonal antibody against the interleukin-23 receptor.
    Article Snippet: .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively. .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively.

    Clone Assay:

    Article Title: Generation and characterization of a potent fully human monoclonal antibody against the interleukin-23 receptor.
    Article Snippet: .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively. .. Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively.

    Article Title: The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes
    Article Snippet: .. Competition experiment with qPCR U6-sgRNA-E+F scaffold and EFS-NS-Cas9-P2A-ZeocinR-WPRE digested from pTF vector with AflII and HindIII and cloned into the piggyBac backbone ( ). sgRNAs targeting Klf5 (5’ TGGCGAATTAACTGGCAGAG), Nanog (5’ TGTCCTTGAGTGCACACAGC), Oct4 (5’ CCGCCCGCATACGAGTTCTG), Zbtb10 (5’ AGAAACGGCTGCCTGCAACC), Zbtb11 (5’ AGCGCACAAGTCTGTCCTCT), Zfp131 (5’ GTTCTTTAAAGTGTCCAAAG) and non-targeting sgRNA (5’ GCCGCAACGTTAGATGTATA) were cloned into piggyBac plasmids. .. Equimolar ratio (0.5 μg) of plasmids were pooled and co-nucleofected (Lonza) with 0.5 μg pBac transposase to mESCs ( ).

    Real-time Polymerase Chain Reaction:

    Article Title: The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes
    Article Snippet: .. Competition experiment with qPCR U6-sgRNA-E+F scaffold and EFS-NS-Cas9-P2A-ZeocinR-WPRE digested from pTF vector with AflII and HindIII and cloned into the piggyBac backbone ( ). sgRNAs targeting Klf5 (5’ TGGCGAATTAACTGGCAGAG), Nanog (5’ TGTCCTTGAGTGCACACAGC), Oct4 (5’ CCGCCCGCATACGAGTTCTG), Zbtb10 (5’ AGAAACGGCTGCCTGCAACC), Zbtb11 (5’ AGCGCACAAGTCTGTCCTCT), Zfp131 (5’ GTTCTTTAAAGTGTCCAAAG) and non-targeting sgRNA (5’ GCCGCAACGTTAGATGTATA) were cloned into piggyBac plasmids. .. Equimolar ratio (0.5 μg) of plasmids were pooled and co-nucleofected (Lonza) with 0.5 μg pBac transposase to mESCs ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Lonza pmax green fluorescent protein gfp vector
    Transfection, expression and establishment of bovine mammary epithelial stable cell lines with recombinant PiggyBac-LFcinB (A) Expression of <t>Pmax</t> <t>GFP</t> (positive control) after 24 h of transfection (100x); (B) Expression of recombinant bovine lactoferricin GFP after 24 h of transfection (100x); (C) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin as selection marker (100x); (D) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin which was used as selection marker at high resolution (200x). Cells showed the clear morphology of bovine mammary epithelial stem cells with nucleus and nucleolus.
    Pmax Green Fluorescent Protein Gfp Vector, supplied by Lonza, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmax green fluorescent protein gfp vector/product/Lonza
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pmax green fluorescent protein gfp vector - by Bioz Stars, 2021-05
    94/100 stars
      Buy from Supplier

    93
    Lonza gfp control vector
    <t>GAPDH</t> overexpression increases in SNO-Hsp60, but not SNO-DHRS2 levels. SNO-Hsp60 ( A ) and SNO-DHRS2 ( B ) levels from Hep2G cells transfected with either a control <t>GFP</t> plasmid or siRNA scramble, a plasmid encoding DDK-tagged GAPDH for overexpression, a GAPDH siRNA for knock-down, or a plasmid encoding DDK-tagged GAPDH C150S were assessed via SNO-RAC proteomic analysis, followed by label-free peptide quantification (n = 6).
    Gfp Control Vector, supplied by Lonza, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp control vector/product/Lonza
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gfp control vector - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    86
    Lonza green fluorescent protein gfp expression vectors
    Depletion of <t>MELK</t> delays HIV-1 CA disassembly. (A) Non-T or MELK-KD-2 MT4C5 cells were mock-infected or infected with 100 or 500 ng of p24-measured amounts of NL4-3 virions containing BlaM-Vpr, based on the measured amount of p24, in the presence or absence of AMD3100 (100 nM). They were then analyzed in the fusion assay by flow cytometry using a violet laser to excite CCF2. Each experiment was performed in triplicate, repeated three times and one set of representative data is shown. (B) Relative numbers of BlaM + MELK-KD-2 MT4C5 cells are shown as percentages (%) of Non-T MT4C5 cells with standard deviations calculated from three independent experiments. (C) Virion-associated viral RNA was quantified by quantitative RT-PCR 2 h after infection of Non-T or MELK-KD-2 MT4C5 cells with wild-type HIV-1. Error bars indicate the standard deviations calculated from five independent experiments. ( D) Immunoblot analysis of envelope-stripped HIV-1 cores. Concentrated virions were subjected to step-gradient centrifugation in the absence (-) or presence (+) of 0.1% of Triton-X100. (E) Electron micrographs showing envelope-stripped cores of HIV-1. TEM images of a negatively stained envelope-stripped core of HIV-1 prepared from HIV-1 NL4-3 virions. Bars indicate 50 nm. (F) Immunoblot analyses showing MELK bound to envelope-stripped cores of HIV-1. HeLa cells were transfected with pCAG-OSF (lane 1) or increasing amounts of <t>pCAG-OSF-GFP</t> (lanes 2 to 3), pCAG-OSF-MELK (lanes 4 to 5), pCAG-FOS2-rhT5α (lanes 6 to 7) or pCAG-OSF-CypA (lanes 8 to 9). Purified OSF- or FOS2-tagged proteins were incubated with envelope-stripped cores and complex formation was assessed. Masses of molecular weight standards are indicated on the left. Arrows indicate the position of MELK in the gel. (G) Schematic diagram of the fate-of-capsid assay. (H) Forced expression of rhesus Trim5α (rhT5α) inhibits HIV-1 replication in human T cells. Cell lysates were prepared from MT4C5 cells transduced with empty lentivirus (vector-control) or lentivirus for C-terminally HA-tagged rhesus Trim5α expression (rhT5α-HA) and processed for immunoblotting with anti-HA (HA) and anti-alpha-tubulin (α-tubulin) antibodies. Experiments were performed at least three times and one representative set of data is shown (upper panels). Vector-control and rhT5α-HA cells were infected with VSV-G-env-pseudotyped NL4-3luc. Relative luciferase activity is shown as a percentage (%) of the RLU of vector-control cells with standard deviations calculated from five independent experiments (lower panel). (I) Effect of MELK depletion on the fate of the HIV-1 CA in MT4C5 cells. Non-T, MELK-KD-2, MT4C5 cells expressing rhT5α (rhT5α), or Non-T cells treated with 10 μM nevirapine (Non-T + NVP) were infected with wild-type HIV-1 for 8 h in the presence or absence of 10 μM MG132 (MG132 [+] or MG132 [–]). HIV-1 stock inactivated by incubation at 65°C for 30 min was used as a negative control (HI control). Cell lysates were subjected to 20%–60% step-gradient centrifugation and three fractions were collected from the top (fraction #1), middle (fraction #2) and interface between the 20% and 60% sucrose layers (fraction #3). Aliquots of each fraction were processed for immunoblotting with anti-p24 antibody (CA) (upper panel). Experiments were performed at least five times and one representative set of data is shown. The amount of CA in each fraction in the absence of MG132 was quantified by HIV-1 p24 ELISA (lower panel). Error bars indicate the standard deviations calculated from five independent experiments. (J) Percentage of the pelletable CA (fraction #3) within total CA in the absence of MG132 was calculated based on the p24 ELISA data shown in Fig 2H. Total CA denotes the sum of the amount of p24 antigen which was calculated based on the p24 ELISA data of fractions #1, #2, and #3. Error bars represent the standard deviations calculated from five independent experiments. Statistical significance was determined by unpaired two-tailed Student’s t test (B , C , H and J) , or one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test (I) . ns, not significant ( P > 0.05); * P
    Green Fluorescent Protein Gfp Expression Vectors, supplied by Lonza, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/green fluorescent protein gfp expression vectors/product/Lonza
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    green fluorescent protein gfp expression vectors - by Bioz Stars, 2021-05
    86/100 stars
      Buy from Supplier

    Image Search Results


    Transfection, expression and establishment of bovine mammary epithelial stable cell lines with recombinant PiggyBac-LFcinB (A) Expression of Pmax GFP (positive control) after 24 h of transfection (100x); (B) Expression of recombinant bovine lactoferricin GFP after 24 h of transfection (100x); (C) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin as selection marker (100x); (D) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin which was used as selection marker at high resolution (200x). Cells showed the clear morphology of bovine mammary epithelial stem cells with nucleus and nucleolus.

    Journal: Oncotarget

    Article Title: A PiggyBac mediated approach for lactoferricin gene transfer in bovine mammary epithelial stem cells for management of bovine mastitis

    doi: 10.18632/oncotarget.22210

    Figure Lengend Snippet: Transfection, expression and establishment of bovine mammary epithelial stable cell lines with recombinant PiggyBac-LFcinB (A) Expression of Pmax GFP (positive control) after 24 h of transfection (100x); (B) Expression of recombinant bovine lactoferricin GFP after 24 h of transfection (100x); (C) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin as selection marker (100x); (D) Purified recombinant bovine lactoferricin cell line after 14 days of transfection in puromycin which was used as selection marker at high resolution (200x). Cells showed the clear morphology of bovine mammary epithelial stem cells with nucleus and nucleolus.

    Article Snippet: Nucleofection was performed using U-029 program of Amaxa Nucleofector-II system and 5 μg Pmax Green Fluorescent Protein (GFP) vector (Lonza, Amaxa) containing GFP gene was used as positive control. bMESCs are very hard to transfect, hence current study optimized dimethyl sulfoxide (DMSO, Sigma, USA) concentration and used as 1.6% in transfection reagent and for 24 h after the pulse.

    Techniques: Transfection, Expressing, Stable Transfection, Recombinant, Positive Control, Purification, Selection, Marker

    Expansion and transfection efficiency test of cells from urine samples. (A) : Representative images of human trisomic urine‐derived cell expansion on days 0, 4, and 19. Scale bar = 100 µm. (B) : Representative images of GFP expression 1 day after transfection of pmax‐GFP in urine‐derived T21 cells with indicated solutions and programs. Seven different transfection programs were used in cells transfected in either P1 or P3 solution. Scale bar = 50 µm. (C) : Bar graph representation of the survival rate (blue) and efficiency of pmax‐GFP transfection (red) in urine‐derived T21 cells as a function of the transfection program in either P1 (upper panel) or P3 (lower panel) solution. Red arrow in the P1 panel indicates the final program (EA‐104) selected for episomal vector transfection. Efficiencies were calculated as number of GFP positive cells divided by total cell numbers (bar graphs represent means ± SEM); and dead cells were determined by morphology. Abbreviation: GFP, green fluorescent protein.

    Journal: Stem Cells Translational Medicine

    Article Title: Generation of Integration‐Free Induced Pluripotent Stem Cells from Urine‐Derived Cells Isolated from Individuals with Down Syndrome

    doi: 10.1002/sctm.16-0128

    Figure Lengend Snippet: Expansion and transfection efficiency test of cells from urine samples. (A) : Representative images of human trisomic urine‐derived cell expansion on days 0, 4, and 19. Scale bar = 100 µm. (B) : Representative images of GFP expression 1 day after transfection of pmax‐GFP in urine‐derived T21 cells with indicated solutions and programs. Seven different transfection programs were used in cells transfected in either P1 or P3 solution. Scale bar = 50 µm. (C) : Bar graph representation of the survival rate (blue) and efficiency of pmax‐GFP transfection (red) in urine‐derived T21 cells as a function of the transfection program in either P1 (upper panel) or P3 (lower panel) solution. Red arrow in the P1 panel indicates the final program (EA‐104) selected for episomal vector transfection. Efficiencies were calculated as number of GFP positive cells divided by total cell numbers (bar graphs represent means ± SEM); and dead cells were determined by morphology. Abbreviation: GFP, green fluorescent protein.

    Article Snippet: Five micrograms of pmax green fluorescent protein (GFP) vector (1 µg/µl, Lonza) was mixed with 0.6–1.2 × 106 urine‐derived T21 cells in P1 or P3 solution and transferred to 16 wells in Nucleocuvette strips.

    Techniques: Transfection, Derivative Assay, Expressing, Plasmid Preparation

    GAPDH overexpression increases in SNO-Hsp60, but not SNO-DHRS2 levels. SNO-Hsp60 ( A ) and SNO-DHRS2 ( B ) levels from Hep2G cells transfected with either a control GFP plasmid or siRNA scramble, a plasmid encoding DDK-tagged GAPDH for overexpression, a GAPDH siRNA for knock-down, or a plasmid encoding DDK-tagged GAPDH C150S were assessed via SNO-RAC proteomic analysis, followed by label-free peptide quantification (n = 6).

    Journal: PLoS ONE

    Article Title: Glyceraldehyde-3-Phosphate Dehydrogenase Acts as a Mitochondrial Trans-S-Nitrosylase in the Heart

    doi: 10.1371/journal.pone.0111448

    Figure Lengend Snippet: GAPDH overexpression increases in SNO-Hsp60, but not SNO-DHRS2 levels. SNO-Hsp60 ( A ) and SNO-DHRS2 ( B ) levels from Hep2G cells transfected with either a control GFP plasmid or siRNA scramble, a plasmid encoding DDK-tagged GAPDH for overexpression, a GAPDH siRNA for knock-down, or a plasmid encoding DDK-tagged GAPDH C150S were assessed via SNO-RAC proteomic analysis, followed by label-free peptide quantification (n = 6).

    Article Snippet: GAPDH-DDK or GAPDHC150S -DDK or a GFP control vector (pMax-GFP; Lonza, Walkersville, MD) was transfected into HepG2 cells using XtremeGene DNA HP (Roche) according to the manufacturer's instruction; cells were incubated with the vector/transfection mixture for 48 hours.

    Techniques: Over Expression, Transfection, Plasmid Preparation

    HepG2 cell line as a model system for examining GAPDH as a trans-S-nitrosylase. ( A ) Expression of neuronal and endothelial isoforms of NO synthase in HepG2 cells. Representative western blots are shown for neuronal (top right) and endothelial (top left) NO synthase and β-actin (lower). ( B ) Mitochondrial GAPDH protein levels were assessed after the addition of purified GAPDH to isolated HepG2 mitochondria. Representative western blots for GAPDH (upper), TOM20 (center), and the α subunit of F 1 F 0 -ATPase (lower) in HepG2 mitochondria. Control: non-treated mitochondrial control; GAPDH: purified GAPDH treated mitochondria; (n = 3). ( C ) and ( D ) Hep2G cells were transfected with either a control GFP plasmid or siRNA scramble, a plasmid encoding DDK-tagged GAPDH for overexpression, a GAPDH siRNA for knock-down, or a plasmid encoding DDK-tagged GAPDH C150S for overexpression. Representative western blots are shown together with the densitometry of GAPDH normalized to β-actin for total GAPDH (upper; GAPDH, GAPDH-DDK, GAPDH C150S -DDK) and β-actin (lower; *p

    Journal: PLoS ONE

    Article Title: Glyceraldehyde-3-Phosphate Dehydrogenase Acts as a Mitochondrial Trans-S-Nitrosylase in the Heart

    doi: 10.1371/journal.pone.0111448

    Figure Lengend Snippet: HepG2 cell line as a model system for examining GAPDH as a trans-S-nitrosylase. ( A ) Expression of neuronal and endothelial isoforms of NO synthase in HepG2 cells. Representative western blots are shown for neuronal (top right) and endothelial (top left) NO synthase and β-actin (lower). ( B ) Mitochondrial GAPDH protein levels were assessed after the addition of purified GAPDH to isolated HepG2 mitochondria. Representative western blots for GAPDH (upper), TOM20 (center), and the α subunit of F 1 F 0 -ATPase (lower) in HepG2 mitochondria. Control: non-treated mitochondrial control; GAPDH: purified GAPDH treated mitochondria; (n = 3). ( C ) and ( D ) Hep2G cells were transfected with either a control GFP plasmid or siRNA scramble, a plasmid encoding DDK-tagged GAPDH for overexpression, a GAPDH siRNA for knock-down, or a plasmid encoding DDK-tagged GAPDH C150S for overexpression. Representative western blots are shown together with the densitometry of GAPDH normalized to β-actin for total GAPDH (upper; GAPDH, GAPDH-DDK, GAPDH C150S -DDK) and β-actin (lower; *p

    Article Snippet: GAPDH-DDK or GAPDHC150S -DDK or a GFP control vector (pMax-GFP; Lonza, Walkersville, MD) was transfected into HepG2 cells using XtremeGene DNA HP (Roche) according to the manufacturer's instruction; cells were incubated with the vector/transfection mixture for 48 hours.

    Techniques: Expressing, Western Blot, Purification, Isolation, Transfection, Plasmid Preparation, Over Expression

    Depletion of MELK delays HIV-1 CA disassembly. (A) Non-T or MELK-KD-2 MT4C5 cells were mock-infected or infected with 100 or 500 ng of p24-measured amounts of NL4-3 virions containing BlaM-Vpr, based on the measured amount of p24, in the presence or absence of AMD3100 (100 nM). They were then analyzed in the fusion assay by flow cytometry using a violet laser to excite CCF2. Each experiment was performed in triplicate, repeated three times and one set of representative data is shown. (B) Relative numbers of BlaM + MELK-KD-2 MT4C5 cells are shown as percentages (%) of Non-T MT4C5 cells with standard deviations calculated from three independent experiments. (C) Virion-associated viral RNA was quantified by quantitative RT-PCR 2 h after infection of Non-T or MELK-KD-2 MT4C5 cells with wild-type HIV-1. Error bars indicate the standard deviations calculated from five independent experiments. ( D) Immunoblot analysis of envelope-stripped HIV-1 cores. Concentrated virions were subjected to step-gradient centrifugation in the absence (-) or presence (+) of 0.1% of Triton-X100. (E) Electron micrographs showing envelope-stripped cores of HIV-1. TEM images of a negatively stained envelope-stripped core of HIV-1 prepared from HIV-1 NL4-3 virions. Bars indicate 50 nm. (F) Immunoblot analyses showing MELK bound to envelope-stripped cores of HIV-1. HeLa cells were transfected with pCAG-OSF (lane 1) or increasing amounts of pCAG-OSF-GFP (lanes 2 to 3), pCAG-OSF-MELK (lanes 4 to 5), pCAG-FOS2-rhT5α (lanes 6 to 7) or pCAG-OSF-CypA (lanes 8 to 9). Purified OSF- or FOS2-tagged proteins were incubated with envelope-stripped cores and complex formation was assessed. Masses of molecular weight standards are indicated on the left. Arrows indicate the position of MELK in the gel. (G) Schematic diagram of the fate-of-capsid assay. (H) Forced expression of rhesus Trim5α (rhT5α) inhibits HIV-1 replication in human T cells. Cell lysates were prepared from MT4C5 cells transduced with empty lentivirus (vector-control) or lentivirus for C-terminally HA-tagged rhesus Trim5α expression (rhT5α-HA) and processed for immunoblotting with anti-HA (HA) and anti-alpha-tubulin (α-tubulin) antibodies. Experiments were performed at least three times and one representative set of data is shown (upper panels). Vector-control and rhT5α-HA cells were infected with VSV-G-env-pseudotyped NL4-3luc. Relative luciferase activity is shown as a percentage (%) of the RLU of vector-control cells with standard deviations calculated from five independent experiments (lower panel). (I) Effect of MELK depletion on the fate of the HIV-1 CA in MT4C5 cells. Non-T, MELK-KD-2, MT4C5 cells expressing rhT5α (rhT5α), or Non-T cells treated with 10 μM nevirapine (Non-T + NVP) were infected with wild-type HIV-1 for 8 h in the presence or absence of 10 μM MG132 (MG132 [+] or MG132 [–]). HIV-1 stock inactivated by incubation at 65°C for 30 min was used as a negative control (HI control). Cell lysates were subjected to 20%–60% step-gradient centrifugation and three fractions were collected from the top (fraction #1), middle (fraction #2) and interface between the 20% and 60% sucrose layers (fraction #3). Aliquots of each fraction were processed for immunoblotting with anti-p24 antibody (CA) (upper panel). Experiments were performed at least five times and one representative set of data is shown. The amount of CA in each fraction in the absence of MG132 was quantified by HIV-1 p24 ELISA (lower panel). Error bars indicate the standard deviations calculated from five independent experiments. (J) Percentage of the pelletable CA (fraction #3) within total CA in the absence of MG132 was calculated based on the p24 ELISA data shown in Fig 2H. Total CA denotes the sum of the amount of p24 antigen which was calculated based on the p24 ELISA data of fractions #1, #2, and #3. Error bars represent the standard deviations calculated from five independent experiments. Statistical significance was determined by unpaired two-tailed Student’s t test (B , C , H and J) , or one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test (I) . ns, not significant ( P > 0.05); * P

    Journal: PLoS Pathogens

    Article Title: Phosphorylation of the HIV-1 capsid by MELK triggers uncoating to promote viral cDNA synthesis

    doi: 10.1371/journal.ppat.1006441

    Figure Lengend Snippet: Depletion of MELK delays HIV-1 CA disassembly. (A) Non-T or MELK-KD-2 MT4C5 cells were mock-infected or infected with 100 or 500 ng of p24-measured amounts of NL4-3 virions containing BlaM-Vpr, based on the measured amount of p24, in the presence or absence of AMD3100 (100 nM). They were then analyzed in the fusion assay by flow cytometry using a violet laser to excite CCF2. Each experiment was performed in triplicate, repeated three times and one set of representative data is shown. (B) Relative numbers of BlaM + MELK-KD-2 MT4C5 cells are shown as percentages (%) of Non-T MT4C5 cells with standard deviations calculated from three independent experiments. (C) Virion-associated viral RNA was quantified by quantitative RT-PCR 2 h after infection of Non-T or MELK-KD-2 MT4C5 cells with wild-type HIV-1. Error bars indicate the standard deviations calculated from five independent experiments. ( D) Immunoblot analysis of envelope-stripped HIV-1 cores. Concentrated virions were subjected to step-gradient centrifugation in the absence (-) or presence (+) of 0.1% of Triton-X100. (E) Electron micrographs showing envelope-stripped cores of HIV-1. TEM images of a negatively stained envelope-stripped core of HIV-1 prepared from HIV-1 NL4-3 virions. Bars indicate 50 nm. (F) Immunoblot analyses showing MELK bound to envelope-stripped cores of HIV-1. HeLa cells were transfected with pCAG-OSF (lane 1) or increasing amounts of pCAG-OSF-GFP (lanes 2 to 3), pCAG-OSF-MELK (lanes 4 to 5), pCAG-FOS2-rhT5α (lanes 6 to 7) or pCAG-OSF-CypA (lanes 8 to 9). Purified OSF- or FOS2-tagged proteins were incubated with envelope-stripped cores and complex formation was assessed. Masses of molecular weight standards are indicated on the left. Arrows indicate the position of MELK in the gel. (G) Schematic diagram of the fate-of-capsid assay. (H) Forced expression of rhesus Trim5α (rhT5α) inhibits HIV-1 replication in human T cells. Cell lysates were prepared from MT4C5 cells transduced with empty lentivirus (vector-control) or lentivirus for C-terminally HA-tagged rhesus Trim5α expression (rhT5α-HA) and processed for immunoblotting with anti-HA (HA) and anti-alpha-tubulin (α-tubulin) antibodies. Experiments were performed at least three times and one representative set of data is shown (upper panels). Vector-control and rhT5α-HA cells were infected with VSV-G-env-pseudotyped NL4-3luc. Relative luciferase activity is shown as a percentage (%) of the RLU of vector-control cells with standard deviations calculated from five independent experiments (lower panel). (I) Effect of MELK depletion on the fate of the HIV-1 CA in MT4C5 cells. Non-T, MELK-KD-2, MT4C5 cells expressing rhT5α (rhT5α), or Non-T cells treated with 10 μM nevirapine (Non-T + NVP) were infected with wild-type HIV-1 for 8 h in the presence or absence of 10 μM MG132 (MG132 [+] or MG132 [–]). HIV-1 stock inactivated by incubation at 65°C for 30 min was used as a negative control (HI control). Cell lysates were subjected to 20%–60% step-gradient centrifugation and three fractions were collected from the top (fraction #1), middle (fraction #2) and interface between the 20% and 60% sucrose layers (fraction #3). Aliquots of each fraction were processed for immunoblotting with anti-p24 antibody (CA) (upper panel). Experiments were performed at least five times and one representative set of data is shown. The amount of CA in each fraction in the absence of MG132 was quantified by HIV-1 p24 ELISA (lower panel). Error bars indicate the standard deviations calculated from five independent experiments. (J) Percentage of the pelletable CA (fraction #3) within total CA in the absence of MG132 was calculated based on the p24 ELISA data shown in Fig 2H. Total CA denotes the sum of the amount of p24 antigen which was calculated based on the p24 ELISA data of fractions #1, #2, and #3. Error bars represent the standard deviations calculated from five independent experiments. Statistical significance was determined by unpaired two-tailed Student’s t test (B , C , H and J) , or one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test (I) . ns, not significant ( P > 0.05); * P

    Article Snippet: For construction of Strep-tag II fusion-MELK, -Cyclophilin A (CypA), -rhesus monkey Trim5α (rhT5α) and Green Fluorescent Protein (GFP) expression vectors, the cDNA of human MELK was amplified by RT-PCR using MT4C5 cell-derived total RNA as the template and the cDNAs of CypA, rhT5α, and GFP were amplified by PCR using pcDNA-HA-CypA [ ], pRhT5α [ ], and pMax-GFP (Lonza Japan Ltd., Tokyo, Japan) as the template, respectively.

    Techniques: Infection, Single Vesicle Fusion Assay, Flow Cytometry, Cytometry, Quantitative RT-PCR, Gradient Centrifugation, Transmission Electron Microscopy, Staining, Transfection, Purification, Incubation, Molecular Weight, Expressing, Transduction, Plasmid Preparation, Luciferase, Activity Assay, Negative Control, Enzyme-linked Immunosorbent Assay, Two Tailed Test